CN104250665B - No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum and method - Google Patents
No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum and method Download PDFInfo
- Publication number
- CN104250665B CN104250665B CN201410410006.6A CN201410410006A CN104250665B CN 104250665 B CN104250665 B CN 104250665B CN 201410410006 A CN201410410006 A CN 201410410006A CN 104250665 B CN104250665 B CN 104250665B
- Authority
- CN
- China
- Prior art keywords
- ralstonia solanacearum
- microspecies
- pcr
- primer
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
No. 5 microspecies RTQ PCR detection primers of Ralstonia solanacearum and method, sequence is: RS72F:5'ATGGATAAAGGGTTCGTGGTG 3'；RS312R:5'CAGGCTCAGCGAGATTGC 3'.The present invention is different from the specific fragment design of other Ralstonia solanacearum microspecies based on No. 5 microspecies of Ralstonia solanacearum and has screened a pair specific primer, utilize the fluorescent quantitative PCR detection method of this design of primers mulberry Ralstonia solanacearum simultaneously, there is the best, highly sensitive feature, and substantially reducing detection required time, sample treatment only needs 4～5h to obtaining a result.It is applicable to the early diagnosis of mulberry bacterial wilt.
Description
Technical field
The invention belongs to field of molecular detection, be specifically related to plant quarantine technology, particularly relate to one and be exclusively used in detection and cause
The primer of No. 5 microspecies of Ralstonia solanacearum of mulberry tree bacterial wilt and detection method.
Background technology
Bacterial wilt (Bacterial wilt) is to be distributed the most extensively, endanger the most seriously and be most difficult to the great bacterial disease of preventing and treating in the world, in
The list being listed in reply bio-terrorism by the U.S. in 2002.This disease is widely current in the torrid zone, subtropical zone and Temperate Region in China, right
Section more than 50 300 various plants including draft, shrub and Qiao Ben work the mischief (Annual review of phytopathology,
1991,29(1):65-87).Bacterial wilt can cause the highest underproduction of crops 95%, causes direct economic loss the most in the world
Up to 50,000,000,000 dollars, cause the extensive concern of people.
Bacterial wilt is caused by blue or green withered Raul Salmonella (Ralstonia solanacearum), and Ralstonia solanacearum can be divided into 5 according to its host range
Biological strain (physiology No. 5 microspecies of No. 1 microspecies physiology)；According to 3 kinds of disaccharide (maltose, lactose and cellobiose) and 3 kinds
The difference of hexanol (mannitol, sorbierite and sweet and pure) oxidation acid producing ability can be divided into 5 biochemical types (the biochemical type V of biochemical type I)
(Acta Horticulturae,2005,695:127-136).China Lv Zhi waits by force the result of study of (2007) to show, the green grass or young crops infecting mulberry tree is withered
Raul Salmonella belongs to biological strain 1 and 5, distinguishes by biochemical type, has biochemical type I, biochemical type III, biochemical type IV and biochemical type
V etc..Be otherwise known as mulberry bacterial wilt (Mulberry bacterial wilt) " droop ", bacterialo wilt disease, popular name " pest mulberry ", " subcutaneous ulcer
Mulberry ", this disease oncoming force is violent, it is fast to spread, and is that one has destructive soil biography plant quarantine venereal disease evil to mulberry tree, can cause novel species mulberry
Or the Sang Dangnian that grows into forest is dead, it has also become the key factor of restriction sericulture there sustainable development.Bacterial wilt once occurs, be difficult to into
The effective radical cure of row, and be in preclinical plant tissue and separate with normal structure, therefore, fast and effectively from very difficult in appearance
Early diagnose and spread and avoid the generation of heavy losses significant for controlling bacterial wilt.
Detection of pathogens means are to improve the basis of Defect inspection efficiency in early days fast, accurately, are also to reduce biological control cost
Premise.The generation of mulberry bacterial wilt is owing to its cause of disease is bred in plant vasular bundle, causes pipe obstruction, plant water transport
It is obstructed, so that plant performance wilting symptom.And other diseases on mulberry tree, as mulberry tree enterobacteria (Enterobacter mori) is drawn
The droop that rises, the mulberry epidemic disease that causes of mulberry pseudomonas syringae (Pseudomonas syringae pv.mori), often bring to diagnosis
Erroneous judgement, thus increase cost accounting.
For the detection of Ralstonia solanacearum, current topmost selective culture medium and the method for molecular biology.Selective medium
It is TTC/TZC (the Tripheny tetrazolium chloride) culture medium worked out in 1954 by Kelman the earliest, Rica etc.
On the basis of TZC, the SM-1 culture medium of a kind of improvement is obtained in nineteen eighty-three.Ralstonia solanacearum is cultivated under the conditions of 28 DEG C on culture medium
2-5d, it may appear that typical mobility is strong, the tool white halo pink bacterium colony of irregular cycle.Elphinstone is equal to 1996
Year obtains SMSA culture medium, the separable Ralstonia solanacearum detected in band soil bacteria after improving further.Withered point of currently used green grass or young crops
Above several culture medium or improvement mostly it is also based on from culture medium.Indicator plant detection method is also the method for detection pathogen
One of, but owing to its cycle is oversize, and limited by seasonality, therefore this method is not suitable for quickly detecting the former bacterium of bacterial wilt.
The method of molecular biology mainly includes making nucleic acid molecular hybridization and PCR method, and Chen Yongfang etc. utilizes RAPD technology screening to arrive
Article 1, the distinctive DNA fragmentation of Ralstonia solanacearum, and according to its base sequence, devise PCR special primer, so that potato can be infected
Other pathogenetic bacterias be comparison, sample DNA is expanded, result shows, only Ralstonia solanacearum amplifiable go out 773bp
DNA segment, other comparison bacteriums all do not amplify these bands of a spectrum.The pathogenic bacteria of Africa eucalyptus and potato are entered by Fouche etc.
Go detection, used PCR-RFLP technology, carried out expanding with Hrp gene region so that it is determined that the bion of ralstonia solanacearum
(Journal of General Plant Pathology,2006,72(6):369–373)。
Any of the above method all can only separate Ralstonia solanacearum in blue or green withered kind of level, can not distinguish as mulberry tree sick from microspecies level
Withered No. 5 microspecies of green grass or young crops of former bacterium.Patent CN103602727A discloses the detection primer group of a kind of quick detection Ralstonia solanacearum, detection
Kit and detection method, patent CN103468794A disclose a kind of tobacco bacterial wilt molecular detection primer, detection method and
Application, patent CN102465173A discloses the PCR method for detecting specificity of No. 2 microspecies of Ralstonia solanacearum, patent
CN101724692A discloses the another kind of mulberry tree and causes the specific primer of bacterium mulberry tree enterobacteria and the diagnosis side of droop
Method.Z.C.Pan etc. utilize suppressed subtractive hybridization technology to establish No. 5 microspecies of Ralstonia solanacearum and are different from standard cyan dry strain GMI1000
Subtractive Sequence Library (Eur J Plant Pathol, 2013,137:377 391).But, above method is all based on specific primer
Regular-PCR detection, at present and have no and utilize No. 5 microspecies single amplified fragments special primers of Ralstonia solanacearum and quantitative fluorescent PCR
Technology combines the report of detection mulberry Ralstonia solanacearum.
The present invention attempts using the method for quantitative fluorescent PCR that mulberry Ralstonia solanacearum is spent absolutely quantitatively detection, improves the special of detection
Property and sensitivity, can avoid producing erroneous judgement to mulberry tree disease, reduce the time needed for detection, for mulberry bacterial wilt simultaneously
Early diagnose and take prophylactico-therapeutic measures to lay the foundation early.
Summary of the invention
Solve the technical problem that: the present invention provides a kind of No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum and method, by design
No. 5 little species-specific primers of Ralstonia solanacearum set up the fluorescence quantitative PCR detection side of a kind of mulberry tree Ralstonia solanacearum sensitive, stable, reliable
Method.
Technical scheme: No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum, it is characterised in that sequence is: RS72F:
5'-ATGGATAAAGGGTTCGTGGTG-3'；RS312R:5'-CAGGCTCAGCGAGATTGC-3'.Utilize institute
Stating the RTQ-PCR method of primer detection No. 5 microspecies of Ralstonia solanacearum, step includes: (1) uses TM fluid nutrient medium to cultivate quilt
Survey bacterium, and extract tested bacterium DNA, preparation bacteria liquid sample and DNA sample；(2) use primer to step 1) in bacterium solution sample
Product and DNA sample carry out PCR amplification, obtain amplified production；(3) according to step 2) in the presence or absence of amplified production i.e. can determine whether
Whether institute's test sample product are No. 5 microspecies of Ralstonia solanacearum.
PCR reagent and step include: amplification reaction system: comprise 2 μ L bacterium solution template or DNA profilings in 25 μ L reactant liquors,
12.5 μ L 2 × Taq MasterMix: containing 2.5U Taq Polymerase/ μ L, 20mM Tris-HCl, 3mM MgCl2、500μM
DNTP and 100mM KCl, 10pmoles primer RS72F, 10pmoles primer RS312R；PCR amplification program is 94 DEG C
Denaturation 5min, 94 DEG C of sex change 15s, 53 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, and last 72 DEG C extend 10min；
Electrophoresis detection: after reaction terminates, take 10 μ L product and detect on 1.5% agarose gel electrophoresis, and use gel imaging
System is taken pictures under uviol lamp, according to the length judged result that has that it's too late of product.
No. 5 microspecies RTQ-PCR detection primers of described Ralstonia solanacearum are the application in pathogen in quantitatively detecting soil, tissue.Step
Suddenly include: the genomic DNA of (1) extracting mulberry Ralstonia solanacearum, and carry out gradient dilution；(2) mulberry Ralstonia solanacearum is cultivated, and
Carry out gradient dilution；(3) with above-mentioned steps 1) and 2) in sample be that template carries out quantitative fluorescent PCR, and draw calibration curve；
(4) amplification reaction system: in 20 μ L reaction systems, comprises 10 μ L SYBR Premix Ex Taq II (Tli RNaseH Plus) (2 ×),
0.8 μ L RS72F 10 μMs, 0.8 μ L RS312R 10 μMs, 0.4 μ L ROX Reference Dye (50 ×), 2.0 μ L templates；(5)
Amplification program: two-step method amplification program: the first step: 95 DEG C of denaturations 10min；Second step: 95 DEG C of sex change 15s, 60 DEG C are prolonged
Stretch 31s, react 45 circulations.
Method particularly includes: it is different from the diversity sequence of other Ralstonia solanacearum microspecies by No. 5 microspecies of Ralstonia solanacearum in search GenBank,
Primer Premier 5 is utilized to design primer, by PCR and electrophoresis detection, it is thus achieved that No. 5 little species specificity of 1 pair of Ralstonia solanacearum are drawn
After thing RS72F/RS312R, PCR reaction, product is detected by agarose gel electrophoresis, can be direct according to product clip size
Judge whether testing sample is No. 5 microspecies of Ralstonia solanacearum.Meanwhile, this design of primers sensitivity higher mulberry Ralstonia solanacearum is utilized
RTQ-PCR detection method.
For detecting the PCR method of No. 5 microspecies of Ralstonia solanacearum, including:
(1) prepared by the sample for detection
TM fluid nutrient medium is used to cultivate No. 5 microspecies Ralstonia solanacearums, other microspecies Ralstonia solanacearums and the control strain of other kind,
About 10 are reached to its concentration8cfu/mL；Bioflux Biospin Genomic DNA Extraction Kit is used to extract sample gene
Group DNA.
(2) for the specific primer of detection
Primer sequence is:
RS72F:5'-ATGGATAAAGGGTTCGTGGTG-3'；
RS312R:5'-CAGGCTCAGCGAGATTGC-3'；
RS72F/312R primer is to can specifically amplify, from No. 5 microspecies bacterial strains of Ralstonia solanacearum, the product that fragment length is 241bp；
Using the public specificity primer AU759/760 of all types Ralstonia solanacearum as comparison, its sequence is simultaneously:
AU759:5'-GTCGCCGTCAACTCACTTTCC-3'；
AU760:5'-GTCGCCGTCAGCAATGCGGAATCG-3'；
AU759/760 primer is to can specifically amplify the product that fragment length is 282bp from the Ralstonia solanacearum of all little types
Thing.
(3) pcr amplification reaction system
In 25 μ L reactant liquors, comprising 2 μ L bacterium solution template or DNA profilings, 12.5 μ L 2 × Taq MasterMix are (containing 2.5U Taq
Polymerase/ μ L, 20mM Tris-HCl, 3mM MgCl2, 500 μMs of dNTP, 100mM KCl), 10pmoles upstream
Primer, 10pmoles downstream primer.
(4) PCR amplification program
94 DEG C of denaturations 5min, 94 DEG C of sex change 15s, 53 DEG C of annealing 30s, 72 DEG C of extension 30s, 30 circulations, last 72 DEG C
Extend 10min.
(5) qualification of PCR primer
Take 10 μ L product to detect on 1.5% agarose gel electrophoresis, and use gel imaging system to take pictures under uviol lamp,
The length judged result that has that it's too late according to product.
(6) preparation of RTQ-PCR standard sample
The Elution Buffer in DNA extraction kit is used to carry out ten times of gradient dilutions the DNA of No. 5 microspecies of Ralstonia solanacearum,
Its final concentration is made to be respectively 5.0 × 102Ng/ μ L, 5.0 × 101Ng/ μ L, 5.0 × 100Ng/ μ L, 5.0 × 10-1Ng/ μ L, 5.0 × 10-2Ng/ μ L,
5.0×10-3Ng/ μ L, 5.0 × 10-4 ng/μL。
No. 5 microspecies bacterium solution of Ralstonia solanacearum of pure culture are configured to concentration gradient is 1 × 108Cfu/mL, 5 × 107Cfu/mL, 2 × 107
Cfu/mL, 1 × 107Cfu/mL, 5 × 106Cfu/mL, 2 × 106Cfu/mL, 1 × 106Cfu/mL, 1 × 105Cfu/mL, 1 × 104Cfu/mL,
1×103Cfu/mL, 1 × 102Cfu/mL cell suspending liquid.
(7) RTQ-PCR reaction system
In 20 μ L reaction systems, comprise 10 μ L SYBR Premix Ex Taq II (Tli RNaseH Plus) (2 ×), 0.8 μ L
RS72F (10 μMs), 0.8 μ L RS312R (10 μMs), 0.4 μ L ROX Reference Dye (50 ×), 2.0 μ L templates.
(8) RTQ-PCR amplification program
Two-step method amplification program: the first step: 95 DEG C of denaturations 10min；Second step: 95 DEG C of sex change 15s, 60 DEG C extend 31s,
React 45 circulations.
(9) drafting of calibration curve
Respectively with the LOG value of DNA concentration and the LOG value of bacterial concentration as abscissa, corresponding CT value (each reaction tube
The period that interior fluorescence signal is experienced when arriving the threshold value set) it is that ordinate draws calibration curve.
Beneficial effect
The present invention based on No. 5 microspecies of Ralstonia solanacearum be different from other Ralstonia solanacearum microspecies specific fragment design and screened a pair special
Property primer, utilizes the fluorescent quantitative PCR detection method of this design of primers mulberry Ralstonia solanacearum simultaneously, has the best, sensitivity
High feature, and substantially reduce detection required time, sample treatment only needs 4～5h to obtaining a result.It is applicable to mulberry bacterial wilt
Early diagnosis.
Accompanying drawing explanation
Fig. 1 a primer RS72F/312R amplification figure to Ralstonia solanacearum:
M:DNA molecular weight standard Marker (600bp, 500bp, 400bp, 300bp, 200bp, 100bp)；1: No. 5 microspecies of Ralstonia solanacearum
(GIM1.73)；2: No. 1 microspecies (GIM1.74) of Ralstonia solanacearum；3: No. 2 microspecies (GIM1.76) of Ralstonia solanacearum；4: Ralstonia solanacearum 3 is little
Plant (RS-3)；5: blue or green withered reference culture GMI1000 (No. 3 microspecies)；6: blue or green withered No. 4 microspecies (GIM1.71)；CK: blank
TM nutrient solution.It it is primer AU759/760 amplification on the left of dotted line；It it is primer RS72F/312R amplification on the right side of dotted line.
Fig. 1 b primer RS72F/312R amplification figure to other kind control strains:
M:DNA molecular weight standard Marker (600bp, 500bp, 400bp, 300bp, 200bp, 100bp)；1: No. 5 microspecies of Ralstonia solanacearum
(GIM1.73)；7: mulberry pseudomonas syringae (M4-13)；8: mulberry enterobacteria (JX-6)；9: Escherichia coli (DCG)；10: fluorescence
Pseudomonad (A-S1)；11: pseudomonas putida (ECJ)；12: bacillus subtilis (KCY)；13: bacillus cereus (LYY)；
14: bacillus thuringiensis (SYJ)；15: staphylococcus aureus (PTQ)；16: tetrads (SLQ)；17: tangerine green trichoderma
(JLM)；18: yellow streptomycete (HLM).
Fig. 2 a is with CT value as ordinate, and the LOG value of DNA concentration draws fluorescent quantitation absolute quantitation calibration curve for abscissa
Figure:
DNA concentration is 10-4～102In the range of ng/ μ L, its LOG value and CT value are good linear relationship,
Y=-2.747X+21.834, R2=0.993.
Fig. 2 b is with CT value as ordinate, and the fluorescent quantitation absolute quantitation standard that the LOG value of bacterial concentration is drawn for abscissa is bent
Line chart:
Bacterial concentration is 103～107In the range of cfu/mL, its LOG value and CT value are good linear relationship,
Y=-3.418X+45.447, R2=0.998.
Detailed description of the invention
Embodiment 1
(1) participate in the experiment the cultivation of bacterial strain and DNA extracts
The 18 strain bacterial strains participated in the experiment include a strain mulberry Stalk Rot GIM1.73, and (blue or green withered No. 5 microspecies, it is pathogenic in mulberry tree
On through section's conspicuous rule checking), the Ralstonia solanacearum (GIM1.74, GIM1.76, GIM1.71, RS-3, GMI1000) of 5 other microspecies of strain,
Wherein GIM1.73, GIM1.74 (blue or green withered No. 1 microspecies), GIM1.76 (blue or green withered No. 2 microspecies), GIM1.71 (blue or green withered No. 4 microspecies)
Purchased from Guangdong Province's Culture Collection (GIMCC)；RS-3 (blue or green withered No. 3 microspecies) is by Agricultural University Of Nanjing's Plant Protection
Institute provides；GMI1000 (blue or green withered No. 3 microspecies) is purchased from American Type Culture collecting center (ATCC).Other 12 kinds of withered genus of non-green grass or young crops
Control strain (M4-13, JX-6, DCG, A-S1, ECJ, KCY, LYY, SYJ, PTQ, SLQ, JLM, HLM)
Being preserved by this laboratory, wherein M4-13 is mulberry epidemic disease pathogen (Pseudomonas syringae pv.mori), and JX-6 is that mulberry is thin
Bacterium property Pathogen of Fusarium Wilt (Enterobacter mori), remaining is then some Pseudomonas common in soil.By inoculation to TM
In fluid nutrient medium (glucose 5g, peptone 10g, caseinhydrolysate 1g, distilled water 1000mL), 28 DEG C, cultivate 2 days.
Biospin Genomic DNA Extraction Kit is used to extract the DNA of bacterial strain of participating in the experiment.
(2) synthesis of primer
RS72F:5'-ATGGATAAAGGGTTCGTGGTG-3'；
RS312R:5'-CAGGCTCAGCGAGATTGC-3'；
AU759:5'-GTCGCCGTCAACTCACTTTCC-3'；
AU760:5'-GTCGCCGTCAGCAATGCGGAATCG-3'；
Primer is synthesized by Shanghai Sheng Gong company.
(3) pcr amplification reaction
1. in 25 μ L reaction systems, comprising 2 μ L DNA profilings, 12.5 μ L 2 × Taq MasterMix are (containing 2.5U Taq
Polymerase/ μ L, 20mM Tris-HCl, 3mM MgCl2, 500 μMs of dNTP, 100mM KCl), 10pmoles primer
RS72F, 10pmoles primer RS312R.
2. in 25 μ L reaction systems, comprising 2 μ L DNA profilings, 12.5 μ L 2 × Taq MasterMix are (containing 2.5U Taq
Polymerase/ μ L, 20mM Tris-HCl, 3mM MgCl2, 500 μMs of dNTP, 100mM KCl), 10pmoles primer
AU759,10pmoles primer AU760.
(4) PCR amplification program
94 DEG C of denaturations 5min, 94 DEG C of sex change 15s, 53 DEG C of annealing 30s, 72 DEG C of extension 30s, 30 circulations, last 72 DEG C
Extend 10min.
(5) qualification of PCR primer
Take 10 μ L product to detect on 2% agarose gel electrophoresis, and use gel imaging system to take pictures under uviol lamp,
The length judged result that has that it's too late according to product.
(6) preparation of quantitative fluorescent PCR template
1. the Elution Buffer in DNA extraction kit is used to carry out ten times of gradients the DNA of No. 5 microspecies of Ralstonia solanacearum dilute
Release so that it is final concentration is respectively 5.0 × 102Ng/ μ L, 5.0 × 101Ng/ μ L, 5.0 × 100Ng/ μ L, 5.0 × 10-1Ng/ μ L, 5.0 × 10-2
Ng/ μ L, 5.0 × 10-3Ng/ μ L, 5.0 × 10-4 ng/μL。
2. nutrient solution is used to carry out gradient dilution No. 5 microspecies bacterium solution of Ralstonia solanacearum so that it is final concentration is respectively 5.0 × 107cfu/mL；
2.0×107cfu/mL；1.0×107cfu/mL；5.0×106cfu/mL；2.0×106cfu/mL；1.0×106cfu/mL；1.0×105
cfu/mL；1.0×104cfu/mL；1.0×103 cfu/mL。
(7) fluorescent quantitative PCR system
In 20 μ L reaction systems, comprise 10 μ L SYBR Premix Ex Taq II (Tli RNaseH Plus) (2 ×), 0.8 μ L
RS72F (10 μMs), 0.8 μ L RS312R (10 μMs), 0.4 μ L ROX Reference Dye (50 ×), 2.0 μ L templates.Each sample
Product carry out 5 times and repeat.
(8) fluorescent quantitative PCR program
Two-step method amplification program:
The first step: 95 DEG C of denaturations 10min；Second step: 95 DEG C of sex change 15s, 60 DEG C extend 31s, react 45 circulations.
(9) DNA is the absolute quantitation calibration curve of template
With CT value as ordinate, the LOG value of DNA concentration draws calibration curve for abscissa.
(10) bacterium solution is the absolute quantitation calibration curve of template
With CT value as ordinate, the LOG value of bacterial concentration draws calibration curve for abscissa.
Result of implementation
Utilize the primer RS72F/312R that the present invention designs, with the Ralstonia solanacearum of No. 5 microspecies of Ralstonia solanacearum and other microspecies as template, enter
Performing PCR expands, and result as shown in Figure 1a, uses the special primer AU759/760 in Ralstonia solanacearum kind level, often on the left of dotted line
Kind of Ralstonia solanacearum the most amplifiable go out 282bp fragment, the bacterial strain that proves to participate in the experiment in kind of level is Ralstonia solanacearum；This is used on the right side of dotted line
The primer RS72F/312R of invention design, the blueest or green withered No. 5 microspecies can be amplified out the specific fragment of 241bp, prove with this
The primer of the present invention has specifically in Ralstonia solanacearum microspecies level.
Utilize the present invention to design, with the comparison bacterium of No. 5 microspecies of Ralstonia solanacearum and other kinds as template, carry out PCR amplification, knot
As shown in Figure 1 b, only No. 5 microspecies of Ralstonia solanacearum can be amplified out the specific fragment of 241bp to fruit, illustrates that the primer of the present invention exists
In the level of kind, there is Idiotype.
The little species specific DNA sequence dna of the Ralstonia solanacearum amplified by primer RS72F/312R 5:
ATGGATAAAGGGTTCGTGGTGCGGCACATCAAATTTGATATGTGCCGGATGTGCCGTAGT
TGGCCGGCATTGGCTACCATAATGCTGAGTGCTTGTTGCGGCACATTCTGAATTGCGAGG
CGAGGGGGGCGATTGAGCTATTCCACTGAGAACATTCTCCCGAGTGGCGTTACGGTTGC
GCAGGTCGTCGCATTCGCCAAGCTGCTCGGCTACACGCCCGGCGGCAATCTCGCTGAGC
CTG
Utilize primer RS72F/312R design fluorescence quantifying PCR method that No. 5 microspecies DNA of Ralstonia solanacearum are carried out absolute quantitation inspection
Surveying, as shown in Figure 2 a, DNA concentration is 10-4～102In the range of ng/ μ L, its LOG value and CT value are good linear pass
System, Y=-2.747X+21.834, R2=0.993.
Utilize primer RS72F/312R design fluorescence quantifying PCR method that No. 5 microspecies bacterium solution of Ralstonia solanacearum are carried out absolute quantitation detection,
As shown in Figure 2 b, bacterial concentration is 103～107In the range of cfu/mL, its LOG value and CT value are good linear relationship,
Y=-3.418X+45.447, R2=0.998.
The solubility curve of quantitative fluorescent PCR reaction shows, product single peak occurs at 87.9 DEG C, illustrates in reaction without non-specific
The amplification of property or the interference of primer dimer.
Above-mentioned embodiment is only and patent of the present invention is described, but can not limit protection scope of the present invention with this.The skill of this area
The variations and alternatives of any unsubstantiality that art personnel are done on the basis of the present invention belong to scope of the present invention.
SEQUENCE LISTING
<110>Jiangsu University of Science and Technology
<120>No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum and method
<130>
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213>artificial sequence
<400> 1
atggataaag ggttcgtggt
g
21
<210> 2
<211> 18
<212> DNA
<213>artificial sequence
<400> 2
caggctcagc gagattgc
18
<210> 3
<211> 21
<212> DNA
<213>artificial sequence
<400> 3
gtcgccgtca actcactttc
c
21
<210> 4
<211> 24
<212> DNA
<213>artificial sequence
<400> 4
gtcgccgtca gcaatgcgga atcg
24
<210> 5
<211> 241
<212> DNA
<213> Ralstonia solanacearum
<400> 5
atggataaag ggttcgtggt gcggcacatc aaatttgata tgtgccggat gtgccgtagt 60
tggccggcat tggctaccat aatgctgagt gcttgttgcg gcacattctg aattgcgagg 120
cgaggggggc gattgagcta ttccactgag aacattctcc cgagtggcgt tacggttgcg 180
caggtcgtcg cattcgccaa gctgctcggc tacacgcccg gcggcaatct cgctgagcct 240
g
241
Claims (5)
1. No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum, it is characterised in that sequence is:
RS72F:5'-ATGGATAAAGGGTTCGTGGTG-3'
RS312R:5'-CAGGCTCAGCGAGATTGC-3'；
Target sequences is:
ATGGATAAAGGGTTCGTGGTGCGGCACATCAAATTTGATATGTGCCGGATGTGCCGT
AGTTGGCCGGCATTGGCTACCATAATGCTGAGTGCTTGTTGCGGCACATTCTGAATTGCG
AGGCGAGGGGGGCGATTGAGCTATTCCACTGAGAACATTCTCCCGAGTGGCGTTACGGT
TGCGCAGGTCGTCGCATTCGCCAAGCTGCTCGGCTACACGCCCGGCGGCAATCTCGCTG
AGCCTG。
2. utilize the RTQ-PCR method of primer detection No. 5 microspecies of Ralstonia solanacearum described in claim 1, it is characterised in that step includes:
1) use TM fluid nutrient medium to cultivate tested bacterium, and extract tested bacterium DNA, preparation bacteria liquid sample and DNA sample；
2) use primer to step 1) in bacteria liquid sample and DNA sample carry out PCR amplification, obtain amplified production；
3) according to step 2) in the presence or absence of amplified production i.e. can determine whether whether institute's test sample product are No. 5 microspecies of Ralstonia solanacearum.
RTQ-PCR method the most according to claim 2, it is characterised in that PCR reagent and step include:
1) amplification reaction system: comprise 2 μ L bacterium solution template or DNA profilings, 12.5 μ L 2 × Taq in 25 μ L reactant liquors
MasterMix: containing 2.5U Taq Polymerase/ μ L, 20mM Tris-HCl, 3mM MgCl2, 500 μMs of dNTP and 100mM
KCl, 10pmoles primer RS72F, 10pmoles primer RS312R；
2) PCR amplification program is 94 DEG C of denaturations 5min, 94 DEG C of sex change 15s, 53 DEG C of annealing 30s, 72 DEG C of extension 30s, 30
Individual circulation, last 72 DEG C extend 10min；
3) electrophoresis detection: after reaction terminates, take 10 μ L product and detect on 1.5% agarose gel electrophoresis, and use solidifying
Glue imaging system is taken pictures under uviol lamp, according to the length judged result that has that it's too late of product.
4. No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum described in claim 1 are in quantitatively detecting soil, tissue in pathogen
Application.
Application the most according to claim 4, it is characterised in that step includes:
1) extract the genomic DNA of mulberry Ralstonia solanacearum, and carry out gradient dilution；
2) mulberry Ralstonia solanacearum is cultivated, and carry out gradient dilution；
3) with above-mentioned steps 1) and 2) in sample be that template carries out quantitative fluorescent PCR, and draw calibration curve；
4) amplification reaction system:
In 20 μ L reaction systems, comprise 10 μ L 2 × SYBR Premix Ex Taq II (Tli RNaseH Plus),
0.8 μ L RS72F 10 μMs, 0.8 μ L RS312R 10 μMs, 0.4 μ L 50 × ROX Reference Dye, 2.0 μ L templates；
5) amplification program
Two-step method amplification program:
The first step: 95 DEG C of denaturations 10min；Second step: 95 DEG C of sex change 15s, 60 DEG C extend 31s, react 45 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410410006.6A CN104250665B (en) | 2014-08-20 | 2014-08-20 | No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410410006.6A CN104250665B (en) | 2014-08-20 | 2014-08-20 | No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum and method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104250665A CN104250665A (en) | 2014-12-31 |
| CN104250665B true CN104250665B (en) | 2016-08-17 |
Family
ID=52185914
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410410006.6A Expired - Fee Related CN104250665B (en) | 2014-08-20 | 2014-08-20 | No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104250665B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114686609B (en) * | 2022-03-30 | 2024-03-01 | 中国农业科学院农业资源与农业区划研究所 | Specific primer for identifying tomato bacterial wilt and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250580A (en) * | 2008-04-11 | 2008-08-27 | 重庆大学 | Primer, probe and real-time fluorescent PCR reagent case for detecting tobacco ralstonia solanacearum |
| CN102465173A (en) * | 2010-11-08 | 2012-05-23 | 中国农业科学院植物保护研究所 | Specific PCR detection method of Ralstonia solanacearum race 2 |
-
2014
- 2014-08-20 CN CN201410410006.6A patent/CN104250665B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250580A (en) * | 2008-04-11 | 2008-08-27 | 重庆大学 | Primer, probe and real-time fluorescent PCR reagent case for detecting tobacco ralstonia solanacearum |
| CN102465173A (en) * | 2010-11-08 | 2012-05-23 | 中国农业科学院植物保护研究所 | Specific PCR detection method of Ralstonia solanacearum race 2 |
Non-Patent Citations (1)
| Title |
|---|
| "植物青枯菌遗传多样性及致病力分化研究";潘哲超;《中国博士学位论文全文数据库 农业科技辑》;20101015;正文第59-72页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104250665A (en) | 2014-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of Fusarium oxysporum f. sp. cubense race 4 | |
| Schena et al. | Detection and quantification of Phytophthora ramorum, P. kernoviae, P. citricola and P. quercina in symptomatic leaves by multiplex real‐time PCR | |
| Strayer-Scherer et al. | Recombinase polymerase amplification assay for field detection of tomato bacterial spot pathogens | |
| Tooley et al. | Real-time fluorescent polymerase chain reaction detection of Phytophthora ramorum and Phytophthora pseudosyringae using mitochondrial gene regions | |
| Chen et al. | Development and evaluation of specific PCR and LAMP assays for the rapid detection of Phytophthora melonis | |
| Shen et al. | Development of a loop-mediated isothermal amplification method for the rapid detection of Pythium ultimum | |
| CN103215357B (en) | High throughput test method for tomato bacterial disease by locking-type probe | |
| CN108676910A (en) | A kind of LAMP detection primer of fusarium prolifertum and its application | |
| Li et al. | Specific and sensitive detection of Phytophthora nicotianae by nested PCR and loop‐mediated isothermal amplification assays | |
| KR101149422B1 (en) | Primers and its application in multiplex PCR to identify Rinderpest, Peste-des-petits-ruminants virus, Bluetongue virus and Rift Valley fever | |
| Shan et al. | A loop-mediated isothermal amplification (LAMP) assay for the rapid detection of toxigenic Fusarium temperatum in maize stalks and kernels | |
| CN104372104A (en) | LAMP (loop-mediated isothermal amplification) detection primer composition, LAMP detection kit and LAMP detection method for phytophthora cinnamomi | |
| Yang et al. | Multiplex real-time PCR detection and differentiation of Colletotrichum species infecting soybean | |
| Pérez‐Sierra et al. | High vegetative compatibility diversity of Cryphonectria parasitica infecting sweet chestnut (Castanea sativa) in Britain indicates multiple pathogen introductions | |
| Yang et al. | Development of a single-tube duplex real-time fluorescence method for the rapid quantitative detection of Fusarium oxysporum f. sp. cubense race 1 (FOC1) and race 4 (FOC4) using TaqMan probes | |
| Bi et al. | A multiplex PCR assay for three pathogenic Phytophthora species related to kiwifruit diseases in China | |
| Jun-Hai et al. | Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of bacterial blight pathogen (Xanthomonas axonopodis pv. dieffenbachiae) in anthurium | |
| Buddhachat et al. | One-step colorimetric LAMP (cLAMP) assay for visual detection of Xanthomonas oryzae pv. oryzae in rice | |
| CN104745698A (en) | Ring mediated isothermal amplification primer composite for Didymella bryoniae | |
| Li et al. | Rapid diagnosis of Ralstonia solanacearum infection sweet potato in China by loop-mediated isothermal amplification | |
| CN104946760B (en) | A kind of method and dedicated kit for detecting Pythium inflatum | |
| Tian et al. | Visual detection of Didymella bryoniae in cucurbit seeds using a loop-mediated isothermal amplification assay | |
| Zhou et al. | Rapid visual detection of Aeromonas salmonicida by loop‐mediated isothermal amplification with hydroxynaphthol blue dye | |
| Horn et al. | Development of a multiplex Q-PCR to detect Trichoderma harzianum Rifai strain T22 in plant roots | |
| CN104250665B (en) | No. 5 microspecies RTQ-PCR detection primers of Ralstonia solanacearum and method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160817 Termination date: 20190820 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |