KR102213526B1 - Method for improving the resistance to cold stress using ABA receptor RCAR5 in plants - Google Patents

Abstract

The present invention relates to an Arabidopsis thaliana abcisic acid receptor RCAR5 gene, a protein composed of an amino acid encoded by the gene, and a method for enhancing low temperature stress resistance of plants using the gene or protein, and RCAR5 functions as a positive regulator of ABA signaling. It was confirmed that the effect of increasing the resistance to low temperature stress in the transgenic plant overexpressing the protein was confirmed, and it can be used for improvement of crops that can be used by humans through the regulation of the expression of the RCAR5 gene, and in particular, it can be usefully used to improve the productivity of plants. It is expected to be possible.

Description

Method for improving the resistance to cold stress using ABA receptor RCAR5 in plants}

The present invention relates to a Regulatory Components ABA Receptor 5 ( RCAR5 ) gene, a protein composed of an amino acid encoded by the gene, and a method for enhancing low temperature stress resistance of plants using the gene or protein.

Global warming causes extreme climate change, causing environmental stress that hinders normal growth and development of plants, and against this, plants have evolved sophisticated defense mechanisms to survive in adverse environments such as cold, high salt, and drought.

ABA is a regulator for protecting plants against abiotic stress, especially low temperature and dry stress, and is known to play a very important role in plant growth and development. It has been reported that plants treated with ABA in advance and stressed are more resistant to stress than plants that are not, whereas mutant plants that do not produce ABA or respond to ABA are known to be weaker to stress. Therefore, it is expected that plants with improved resistance to environmental stress can be developed using proteins involved in the response of ABA.

ABA signaling is known to regulate the expression of various stress-related genes such as E3 ligase and transcription factors involved in the regulation of osmotic adaptation and root hydraulic conductivity, but the complete ABA signaling pathway has yet to be identified. Didn't. In order to initiate ABA signaling in plant cells, the ABA receptor must be present and the signal must be transmitted to the lower protein. Until now, it was known that PYR/PYL/RCARs as ABA receptors play a role in recognizing ABA. When the receptor recognizes ABA, it promotes the expression of certain genes and activation of ion channels through phosphorylation of the target protein, which allows the plant to adapt to adverse environments.

In the case of many crops targeted for cultivation such as rice, wheat, barley, and corn, exposure to low temperatures can cause serious damage. In particular, high-land regions or subtropical regions can be frequently exposed to low temperatures of 20℃ or less because of the wide range of temperature changes. Low temperature inhibits growth, lowers photosynthetic efficiency, and significantly reduces grain yield by interfering with the development of powdery and spikes of rice. For example, in Korea, 17, 18, and 20% of total rice production area were lost in 1971, 1980, and 1993, respectively, when a low-temperature climate occurred during the reproductive stage, and a maximum of 3.9 in 1980. A loss equivalent to t/ha has been recorded.

Accordingly, a method for improving the resistance of plants to low temperature stress is being studied, and in this regard, studies on genes related to low temperature stress resistance and the resulting transgenic plants are being conducted, but the situation is still insufficient.

Republic of Korea Patent Publication 10-2016-0053106

The present inventors were studying to find out the relationship between the cold stress response through the regulation of the ABA signaling pathway, while the RCAR5 gene of Arabidopsis thaliana regulates ABA-mediated pore occlusion, thereby enhancing the resistance to cold stress in plants. The present invention was completed by finding out that it functions as a ruler.

Accordingly, an object of the present invention is to provide a composition for enhancing low temperature stress resistance of a plant comprising the RCAR5 gene, the RCAR5 protein, and the gene or protein as an active ingredient.

Another object of the present invention is to provide a method for enhancing low temperature stress resistance of a plant, comprising transforming a gene encoding the RCAR5 protein into the plant, and a transgenic plant prepared by the method.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention, the present invention provides a RCAR5 gene encoding a protein for a positive regulator against low temperature stress and consisting of the nucleotide sequence of SEQ ID NO: 1.

In addition, the present invention provides a RCAR5 protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the RCAR5 gene.

In addition, the present invention provides a composition for enhancing low temperature stress resistance of plants, comprising the gene or the protein as an active ingredient.

In addition, the present invention provides a method for improving the resistance to low temperature stress of plants, comprising the following steps:

(a) transforming the gene of SEQ ID NO: 1 encoding the RCAR5 protein into a plant; And

(b) overexpressing the RCAR5 protein in the transformed plant.

In addition, the present invention provides a transgenic plant with improved resistance to low temperature stress by the method.

In the present invention, RCAR5 functions as a positive regulator of ABA signaling, and it was confirmed that the effect of enhancing low temperature stress resistance in the transgenic plant overexpressing the protein was confirmed. By controlling the expression of the RCAR5 gene, it is possible to improve crops that can be used by humans. It can be utilized, and in particular, it is expected to be useful in improving the productivity of plants.

1A is a result of analyzing the expression of various types of RCAR genes induced by low temperature by qRT-PCR.
Figure 1b shows the expression pattern of the cold-induced RCAR5 gene in ABA deficient aba1-6, aba1-3 and ABA non-sensitized abi5 mutants.
Figure 2a shows the expression level of the RCAR gene in the leaves of Pro35S : RCAR transgenic plants compared to wild type (WT).
2b and 2c compare the phenotype and green cotyledon ratio of wild type and RCAR transgenic plants according to ABA treatment.
Figures 2d and 2e compare the degree of root growth of wild-type and RCAR transgenic plants according to ABA treatment.
Figure 3a is a measurement of the germination rate of Arabidopsis seeds in low temperature conditions.
Figure 3b is a comparison of the phenotype at day 21 after germination of wild-type and RCAR transgenic plants subjected to cold treatment.
3C is a result of comparing the germination rate and the ratio of etiolated seedling of wild type and RCAR transgenic plants.
3D is a result of observing changes in phenotype when wild-type and RCAR5 transgenic plants are grown under normal conditions after low-temperature treatment.
Figures 4a and 4b show the effect of norflurazon on the seedling growth of wild type and Pro35S/ RCAR5 plants.
Figures 4c and 4d compare the germination rate and seedling growth degree of Pro35S: RCAR5 /aba1-6 mutant under low temperature conditions.
Figure 5a is a comparison of the expression level of the RCAR5 gene in leaves of WT, abi5, Pro35S: RCAR5 and Pro35S: RCAR5 /abi1-5 mutant plants.
Figures 5b to 5e analyze the effect of overexpression of the RCAR5 gene in the abi5 mutant, Figure 5b is a comparison of the germination rate, Figures 5c and 5d root growth, Figure 5e is a ratio of green cotyledons.
5F to 5G are the results of observing whether the germination rate of abi5 and Pro35S: RCAR5 /abi5 seeds increased under low temperature conditions.
6A to 6I are observations of the improved tolerance of Pro35S: RCAR5 plants to low temperature stress, FIG. 6A is a phenotype of wild type and Pro35S: RCAR5 plants, FIG. 6B is a water loss rate, and FIGS. 6C and 6D are leaf temperatures 6e and 6f show the degree of porosity, FIG. 6g shows the phenotype after low-temperature treatment, Figure 6h shows the survival rate after low-temperature treatment, and FIG.
7 shows the expression patterns of low temperature and ABA response genes in RCAR5 plants during low temperature treatment.

The present inventors completed the present invention by clarifying that the RCAR5 gene of Arabidopsis thaliana regulates ABA-mediated pore occlusion, thereby functioning as a positive regulator that enhances the low temperature stress resistance of plants.

In one embodiment of the present invention, as a result of observing whether RCAR gene induction was observed when cold stress was treated, RCAR5 showed the highest induction level, and the RCAR5 gene was independent of ABA, and further, cold stress regardless of ecological type. It was confirmed that it was induced by (see Example 2).

In another embodiment of the present invention, it was confirmed that the transgenic plant overexpressing the RCAR5 gene plays a role of inhibiting seed germination under low temperature conditions (see Example 3).

In another embodiment of the present invention, it was confirmed that RCAR5 contributes to delaying germination under low temperature conditions through an ABA dependent pathway (see Example 4).

In another embodiment of the present invention, it was confirmed that the Pro35S: RCAR5 transgenic plant exhibited a less withered phenotype under low temperature conditions compared to the wild type, and showed a smaller porosity, and thus improved resistance to low temperature stress (see Example 5). .

In another embodiment of the invention, Pro35S: RCAR5 transformant confirmed that expression of the gene except for the low-temperature reactive cold stress during processing CBF1 -3, RD29A and DREB2A to promote conversion plant (see Example 6).

Hereinafter, the present invention will be described in detail.

The present invention provides a RCAR5 gene that encodes a protein that is a positive regulator for low temperature stress and consists of the nucleotide sequence of SEQ ID NO: 1.

In the present invention, "positive regulator protein" means a protein that acts in an increasing direction in the regulation of life phenomena. That is, when RCAR5 , the gene of the present invention, is overexpressed, ABA sensitivity may increase and resistance to low temperature stress may increase.

As another aspect of the present invention, the present invention provides a RCAR5 protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded by the RCAR5 gene.

As another aspect of the present invention, the present invention provides a composition for enhancing low temperature stress resistance of plants, comprising the gene or the protein as an active ingredient.

As another aspect of the present invention, the present invention provides a method for improving the resistance to low temperature stress of a plant, comprising the following steps:

(a) transforming the gene of SEQ ID NO: 1 encoding the RCAR5 protein into a plant; And

(b) overexpressing the RCAR5 protein in the transformed plant.

As another aspect of the present invention, the present invention provides a transgenic plant having improved resistance to low temperature stress by the above method.

In the present invention, the plant (body) is rice, wheat, barley, corn, beans, potatoes, red beans, oats, food crops including sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion, and carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut, and rapeseed; Fruit trees including apple tree, pear tree, jujube tree, peach, poplar, grape, tangerine, persimmon, plum, apricot, and banana; Flowers including rose, gladiolus, gerbera, carnation, chrysanthemum, lily, and tulip; And feed distribution including ryegrass, red clover, orchardgrass, alpha wave, tall fescue, perennial ryegrass, and the like, most preferably Arabidopsis or red pepper, but is not limited thereto.

Hereinafter, a preferred embodiment is presented to aid the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[ Example ]

Example 1. Experiment preparation and method

1-1. Plant material and growing conditions

In the present invention, Arabidopsis thaliana (Ecotype Col-0) plants were used as wild type (WT), and T-DNA insertion mutant abi5 and EMS-mutant mutant aba1-6 were obtained from Arabidopsis Biological Resource Center. The plants were grown in a soil mixture containing peat moss, perlite and vermiculite in a ratio of 9: 1: 1 and 24 under a fluorescent lamp (130 μmol photon ㆍ m ^-2 s ^-1 ). Maintained 60% humidity and 16 hours of light / 8 hours of dark cycle for hours.

Prior to in vitro culture, Arabidopsis seeds were surface sterilized with 70% ethanol for 1 minute and treated with 2% sodium hydroxide for 10 minutes, and then the seeds were washed 10 times with sterile distilled water and supplemented with 1% sucrose. It was sprayed on MS agar medium (Sigma, St. Louis, MO, USA). After two days and optimization layer in 4 ℃, seal the plate and ^{fluorescent-incubated} cycle (130 μmol photons m ^-2 s and ¹⁾ and in the chamber for 24 hours 16 hours light / 8 hours arm. Tobacco ( Nicotiana benthamiana ) For plants, seeds are steam-sterilized soil mixture (peat moss, perlite and vermiculite, 5:3:2, v/v/v), sand and loam (1:1):1, v/v/v ), and grown under the same conditions as above in a growth chamber of 25 ± 1°C.

1-2. RCAR Production of transgenic plants overexpressing genes

In addition to the above four Arabidopsis genetically modified lines overexpressing RCAR2, RCAR3, RCAR4 and RCAR5, 10 RCAR gene overexpressing plants were prepared. The 10 RCAR gene coding sequences were cloned into pENTR / D-TOPO vector (Invitrogen) and integrated into pK2GW7 through an LR reaction to induce constitutive expression of the RCAR gene under the control of the Cauliflower mosaic virus 35S promoter.

The resultant product was introduced into A. tumefaciens strain GV3101 through electroporation, and was transformed by Agrobacterium using the floral dip method, and seeds harvested from transformed plants for selection of transformed lines Was plated on MS agar plates containing 50 μg/ml of kanamycin.

1-3. Cold treatment and phenotypic analysis

In order to measure the germination rate of wild type (WT) and transgenic plants under low temperature conditions, the seeds of the plants were vernalized at 4° C. for 2 days, and continuously cultured in the dark according to each experiment.

To analyze whether the low temperature sensitivity of Arabidopsis plants is related to ABA signaling, seeds were seeded on MS agar medium supplemented with ABA (0.75 μM) and/or norflurazon (NF; 25 and 50 μM) as ABA biosynthesis inhibitors, For the freezing resistance test, 3-week-old Arabidopsis seedlings grown in soil were exposed at 4±1° C. for 0.5 hours and then at 1° C. for 1 hour.

The experimental temperature reduction setting was designed to go down to 2℃ over 30 minutes and hold for 1 hour, and the frozen-treated plants were left for 12 hours in a dark room at 4±1℃ and transferred to normal conditions, and the survival rate was calculated for 4 days. Became.

1-4. Thermal image analysis

For thermal imaging analysis, two-week-old Arabidopsis seedlings were exposed to 4±1° C. until a predetermined time point in each experiment to treat low temperature stress. Thermal images were obtained using infrared cameras (FLIR systems; T420) and leaf temperatures were measured with FLIR Tools + version 5.2 software.

1-5. Electrolyte leak test

The electrolyte leakage of WT and Pro35S: RCAR5 transgenic plants treated with freezing stress was applied with a slight modification in consideration of the sample type and incubation time of the present invention, based on a known method.

For low temperature acclimation, two-week-old plants grown in soil were placed at 4±1° C. for 2 days, and then exposed to -4° C. for 1 hour before electrolyte leakage test. Leaf samples were separated from each plant line and placed in a tube with 20 mL of deionized water (S0), and after shaking at room temperature for 12 hours, the conductivity of the sample was measured (S1). Then, after autoclaving for 15 minutes, the tube was shaken for 1 hour and the conductivity was measured (S2). The electrolyte leakage amount of each sample was calculated by the formula S1-S0 / S2-S0.

1-6. RNA isolation and quantitative RT- PCR (quantitative reverse transcription-polymerase chain reaction)

Total RNA isolation and RT-PCR analysis were performed by a conventionally known method. Two-week-old wild-type (WT) plants and transgenic plants were treated with cold stress (4° C.), and leaf samples were harvested at designated time points in each experiment.

Using the Transcript First Strand cDNA Synthesis kit (Roche, Indianapolis, IN), cDNA was synthesized using 1 μg of total RNA according to the manufacturer's instructions, and for quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis, The synthesized cDNA was amplified in a CFX96 TouchTM Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA) together with iQTMSYBR Green Supermix and specific primers shown in Table 1 below.

All reactions were performed three times, and the relative expression level of each gene was calculated using the ΔΔCt method as previously described, and Arabidopsis actin 8 (AtACT8) was used for normalization.

Primer name Primer sequence (5'- 3') Sequence number Actin8 Forward: CAACTATGTTCTCAGGTATTGCAGA 3 Reverse: GTCATGGAAACGATGTCTCTTTAGT 4 COR15A Forward: GATACATTGGGTAAAGAAGCTGAGA 5 Reverse: ACATGAAGAGAGAGGATATGGATCA 6 DREB2A Forward: CTACAAAGCCTCAACTACGGAATAC 7 Reverse: AAACTCGGATAGAGAATCAACAGTC 8 COR47 Forward: TGAAGAGGAAGTGAAGAAAGAAAAA 9 Reverse: AAAATAAAGGATCAAATGCAATCAA 10 CBF1 Forward: GATGAGGAGACAATGTTTGGGATGC 11 Reverse: GGAAACGACTATCGAATATTAGTAACTC 12 CBF2 Forward: TCGGTTCAATGGAACTATAATTTTG 13 Reverse: TTACCATTTACATTCGTTTCTCACA 14 CBF3 Forward: GCGTTTCAGGATGAGATGTGTGATG 15 Reverse: TGTACGGACGGAAGCGGCA 16 RAB18 Forward: GGAAGAAGGGAATAACACAAAAGAT 17 Reverse: GCGTTACAAACCCTCATTATTTTTA 18 RD29A Forward: CACAATCACTTGGCTCCACTGTTG 19 Reverse: ACCTAGTAGCTGGTATGGAGGAACT 20 RD29B Forward: GTTGAAGAGTCTCCACAATCACTTG 21 Reverse: ATACAAATCCCCAAACTGAATAACA 22 RD26
Forward: AGGTCTTAATCCAATTCCAGAGCTA 23 Reverse: ACCCATCAGTAACTTCACATCTCTC 24 KIN1 Forward: TGTTAACTTCGTGAAGGACAAGAC 25 Reverse: AAGTTTGGCTCGTCTAATAATTTTG 26 KIN2 Forward: TGTTAACTTCGTGAAGGACAAGAC 27 Reverse: ACAACAACAAGTACGATGAGTACGA 28

1-7. Pore calibration

For stomatal aperture bioassay, leaf bark was collected from three-week-old rosette leaves of Arabidopsis thaliana and added to pore opening solution (SOS; 50mM KCl, 10mM MES-KOH, 10μM CaCl ₂ , pH 6.15). Floated. Then, the peel was incubated for 3 hours under a fluorescent lamp at 24°C to obtain >80% porosity in Arabidopsis thaliana Col-0 plants, and the buffer was replaced with fresh SOS and leaf peeling was added for 3 hours at 4°C under a fluorescent lamp. Induced by.

In each individual sample, 100 pores were observed randomly through a Nikon Eclipse 80i microscope, and the width and length of the individual pore pores were recorded using Image J 1.46r software (http://imagej.nih. gov/ij), each experiment was repeated 3 times.

Example 2. By low temperature stress RCAR5 Gene induction analysis

The RCAR family of Arabidopsis is composed of 14 members that mediate ABA signaling. The RCAR gene plays various roles in spite of functional redundancy, and there is evidence that ABA signaling is related to the cold stress response in previous studies. Based on this, the functional relationship between the cold stress and the RCAR gene was investigated.

As a result of confirming the change of low-temperature-induced RCAR gene expression by performing a quantitative RT-PCR analysis on 14 RCAR genes, RCAR1, 2, 5, and 6 were highly induced (2) similar to in-silico data as shown in FIG. On the other hand, RCAR 7, 8, 10, 11, 12 and 13 gradually decreased in expression level compared to the control group, and it was confirmed that RCAR5 showed the highest induction level (4 times).

In addition, in order to analyze whether cold-induced RCAR5 expression is dependent on ABA, the expression pattern of RCAR5 gene using ABA deficient mutants aba1 -6 (Col-0 background), aba1 -3 (Ler background) and non-ABA sensitive mutants abi5 Was analyzed. As a result, as shown in Figure 1b, in response to low temperature, the mutants showed a pattern similar to that of wild-type Col-0 plants, and the result was that the RCAR5 gene was independent of ABA, and furthermore, it was affected by low temperature stress regardless of the ecological type. Means to be guided by.

Example 3. Functional analysis of RCAR5 for inhibition of seed germination under low temperature conditions

In order to analyze the role of the RCAR gene in the cold stress response, Arabidopsis transgenic plants overexpressing each RCAR gene were prepared under the control of the 35S promoter.

Compared with the wild type, 14 transgenic plants each showed high RCAR gene expression (> 30-300 fold) (see Fig. 2A), and as shown in Figs. 2B to 2E, high ABA for seed germination and seedling growth. Showed sensitivity. In addition, as a result of confirming whether an increase in RCAR-mediated ABA susceptibility can affect seed germination or seedling growth under low temperature stress, as shown in Figs. 2b to 2e, the transgenic plant under normal conditions (24° C.) compared with the wild type, There was no significant difference in the aspect of seedling growth, and in general, wild-type (WT) seeds germinated completely within 3 days after incubation at 24°C (DAI), but germination of wild-type seeds when cultured in the dark and under 4°C conditions, It started at 11 DAI and nearly completed at 16 DAI (see Figure 3A).

As a result, Pro35S:RCAR2 and Pro35S:RCAR5 plants showed lower germination rates (56.0% and 25.9%, respectively) than wild-type plants (64.4%) at 14 DAI (see FIG. 3C). After DAI 21, the number of etiolated seedlings did not differ between wild-type and Pro35S:RCAR2 , but still low values in Pro35S:RCAR5 plants (see FIGS. 3b and 3c). In Pro35S:RCAR5 , cold-induced germination inhibition showed normal growth 4 days after transfer to normal conditions (see FIG. 3D). The above results indicate that the RCAR5 gene plays a role in regulating seed germination under low temperature conditions.

Example 4. Through the ABA-dependent pathway under low temperature conditions Pro35S:RCAR5 Verification of delayed germination of seeds

As confirmed in Example 3, the expression level of the RCAR gene was positively correlated with the ABA sensitivity in seed germination and seedling growth. Only Pro35S:RCAR5 seeds showed significant delay in germination due to low temperature, but ABA hypersensitivity may be the cause, so to confirm the possibility, seeds of the WT and Pro35S:RCAR5 strains were used as the ABA biosynthesis inhibitor norflurazon (norflurazon) . NF) was placed in a supplemented half strength MS medium and germinated in the dark conditions at 4°C. As a result, as shown in Figs. 4a and 4b, the addition of NF increased the germination rate of all seeds in a dose-dependent manner, and in particular, the germination rate of the Pro35S:RCAR5 line in 14 DAI increased 2 to 6 times in the presence of NF. As previously expected, NF was antagonistic against ABA-mediated seed germination inhibition, and NF treatment helped to germinate 48.2-64.5 % (5.6% without NF) of WT seeds at 13 DAI and Pro35S:RCAR5. Seed germination was promoted by up to 26%.

However, selective herbicides before germination (preemergent herbicide), because the NF is the cause of stress for the photo-oxidation and bleaching plant ABA deficiency in order to avoid undesirable effects such as the aba1 -6: - in (Pro35S RCAR5 / aba1 6) The relationship between ABA signaling and delayed seed germination under low temperature was analyzed in more detail by overexpressing the RCAR5 gene. As a result, consistent with the data shown in Fig. 4A, the aba1 -6 seeds showed nearly twice increased germination and longer radicles compared to WT (see Figs. 4C and 5D). The overexpression of the RCAR5 gene did not cause any changes, and the germination rate of Pro35S :RCAR5/aba1-6 plants was not statistically different from that of aba1 -6 . These results imply that RCAR5 contributes to delaying germination under low temperature conditions through an ABA-dependent pathway.

In addition, as a bZIP transcription factor, ABI5 is primarily expressed in dried seeds and plays a positive role in ABA signaling during seed germination and early seedling growth development. The abi5 mutation showed enhanced ABA-sensitization (see FIGS. 5A and 5B), but plants overexpressing ABI5 showed hypersensitivity to ABA. Because ABI5 acts downstream of RCAR , overexpression of the RCAR5 gene in the abi5 mutant did not affect the ABA sensitivity of abi5 with respect to germination and seedling formation (see Figs. 5A-5E).

Based on the reduced ABA sensitivity, increased germination of abi5 and Pro35S:RCAR5 / abi5 seeds under low temperature was expected. However, as shown in FIGS. 5F and 5G, the germination rate of abi5 was slightly decreased compared to WT, but was not statistically significant, and the length of the short roots of the germinated seedlings was shorter. Also, Pro35S: RCAR5 / aba1 -6 to crops in contrast, over-expression of genes in RCAR5 abi5 is exhibited an increased germination inhibition at a low temperature, Pro35S: germination of RCAR5 / abi5 is Pro35S: was similar to the germination of plant RCAR5. The data indicate that the cold-induced delay in germination of Pro35S:RCAR5 plants is absolutely dependent on endogenous ABA and occurs regardless of the ABA susceptibility regulated by ABI5.

Example 5. Pro35S:RCAR5 Verification of improvement of resistance to cold stress in transgenic plants

Under dehydration stress, Pro35S:RCAR5 plants have improved drought tolerance by preventing evaporative moisture loss from leaves compared to WT, and cold stress causes leaves to wilt and pore occlusion. Based on this, the phenotype of Pro35S:RCAR5 plants reacted to low temperatures was examined. As a result, as shown in FIG. 6A, after incubation at 4° C. for 24 hours, WT plants significantly withered, but Pro35S:RCAR5 plants did not show a phenotypic difference compared to WT plants.

In addition, in order to quantitatively monitor dehydration due to low temperature, the fresh weight of the above-ground parts of WT and Pro35S:RCAR5 plants was measured under the same conditions and times. As a result, as shown in Fig. 6b, it was found that moisture loss occurs more rapidly than Pro35S:RCAR5 in WT. After incubation at 4° C. for 24 hours, the fresh weight of WT decreased to about 44%, but only 29% in Pro35S:RCAR5 .

Further, in order to test whether the difference is related to cold-induced pore occlusion, the results of measuring the leaf surface temperature of WT and Pro35S:RCAR5 plants, WT and Pro35S:RCAR5 under normal conditions as shown in Figs.6c and 6d. There was no difference between plants, but when cultured at 4°C, Pro35S:RCAR5 plants showed higher leaf temperature at all test points compared to WT, and in particular, significant differences were found between the two plants after 4 hours of culture. In addition, as shown in Figs. 6e and 6f, the pore opening degree of the Pro35S:RCAR5 plant was smaller than that of the WT plant, and compared with the plant not subjected to low temperature treatment, the average pore opening degree of the WT and Pro35S:RCAR5 plants during low temperature treatment Decreased by 31% and 40%, respectively. This means that RCAR5 is involved in cold-induced pore occlusion.

As confirmed from the above results, since overexpression of the RCAR5 gene causes rapid cold-induced pore blockage with ABA-sensitive pore blockage, Pro35S:RCAR5 plants were determined to be resistant to cold stress compared to WT, and then WT to confirm this. And 7-day-old seedlings of Pro35S:RCAR5 were exposed to a photoperiod of 16 hours and 4° C. for 7 and 28 days to apply low temperature stress. As a result, as expected, as shown in FIG. 6G, a relatively large number of Pro35S:RCAR5 seedlings grew weaker than when not treated with low temperature stress, but grew well, but WT seedlings did not wither or even grow severely, as shown in FIG. 6H. As shown, on the 28th day after low temperature treatment, Pro35S:RCAR5 seedlings showed a remarkably high survival rate.

In addition, cell membranes under low temperature stress are often damaged due to dehydration due to cold stress, so the degree of damage to the membrane of plants by relative electrolyte leakage was evaluated as an indicator of the plant's ability to react to low temperature stress. As a result, as shown in Fig. 6i, consistent with the high survival rate of Pro35S:RCAR5 plants, the transgenic plants showed significantly lower electrolyte leakage compared to WT.

Example 6. Pro35S:RCAR5 Confirmation of expression of low-temperature responsive genes in transgenic plants by low-temperature stress

In order to analyze the expression of cold-responsive genes during cold stress treatment in Pro35S:RCAR5 transgenic plants, CBF1 -3 ( AT4G25490 , AT4G25470 , AT4G25480 ), RD29A (AT5G52310), RD29B ( AT5G52300 ), RAB18 ( AT5G66400 ), DREB2A ( AT5G05410 ) , COR15A ( AT2G42540 ), COR47 ( AT1G20440 ), RD26 ( AT4G27410 ), KIN1 -2 ( AT3G21960 , AT5G15970) selected 12 representative genes related to low temperature stress, water stress and ABA signaling, and expression patterns during low temperature treatment Was analyzed by qRT-PCR.

As a result, as shown in FIG. 7, CBF1 -3, RD29A and DREB2A showed the opposite pattern of decreasing expression at 6 hours and/or 12 hours after cold treatment, but in other cases, Pro35S:RCAR5 transformation than WT Gene expression was high in plants. The above results indicate that low temperature, dehydration and/or upregulation of the ABA-inducing gene may contribute to enhancing the tolerance of Pro35S:RCAR5 transgenic plants to low temperature.

The above description of the present invention is for illustrative purposes only, and those of ordinary skill in the art to which the present invention pertains will be able to understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not limiting.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving the resistance to cold stress using ABA receptor RCAR5 in plants <130> MP19-078 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 486 <212> DNA <213> RCAR5 <400> 1 atggaaactt ctcaaaaata tcatacgtgc ggttccacac tagtacaaac tatagatgct 60 ccactatctc tagtttggtc aattctacgt cggtttgata accctcaagc ctacaaacaa 120 ttcgtgaaaa cgtgcaatct aagctccggc gatggaggag aaggctccgt ccgtgaagtg 180 acggtggttt ccggtcttcc agcggagttc agccgagaga gattagatga acttgacgat 240 gagtctcatg tgatgatgat tagcattata ggtggtgatc atcgtttggt taattaccgg 300 tcgaaaacga tggcgtttgt ggcggcggat acggaggaga agacggtggt ggtggagagt 360 tatgtggtgg atgtgccgga aggaaatagt gaggaggaaa cgacgtcttt tgctgataca 420 atcgttgggt ttaatcttaa gtcattggct aagctctcgg agagggtggc tcatctaaag 480 ttgtaa 486 <210> 2 <211> 161 <212> PRT <213> RCAR5 <400> 2 Met Glu Thr Ser Gln Lys Tyr His Thr Cys Gly Ser Thr Leu Val Gln 1 5 10 15 Thr Ile Asp Ala Pro Leu Ser Leu Val Trp Ser Ile Leu Arg Arg Phe 20 25 30 Asp Asn Pro Gln Ala Tyr Lys Gln Phe Val Lys Thr Cys Asn Leu Ser 35 40 45 Ser Gly Asp Gly Gly Glu Gly Ser Val Arg Glu Val Thr Val Val Ser 50 55 60 Gly Leu Pro Ala Glu Phe Ser Arg Glu Arg Leu Asp Glu Leu Asp Asp 65 70 75 80 Glu Ser His Val Met Met Ile Ser Ile Ile Gly Gly Asp His Arg Leu 85 90 95 Val Asn Tyr Arg Ser Lys Thr Met Ala Phe Val Ala Ala Asp Thr Glu 100 105 110 Glu Lys Thr Val Val Val Glu Ser Tyr Val Val Asp Val Pro Glu Gly 115 120 125 Asn Ser Glu Glu Glu Thr Thr Ser Phe Ala Asp Thr Ile Val Gly Phe 130 135 140 Asn Leu Lys Ser Leu Ala Lys Leu Ser Glu Arg Val Ala His Leu Lys 145 150 155 160 Leu <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Actin8 Forward primer <400> 3 caactatgtt ctcaggtatt gcaga 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Actin8 Reverse primer <400> 4 gtcatggaaa cgatgtctct ttagt 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> COR15A Forward primer <400> 5 gatacattgg gtaaagaagc tgaga 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> COR15A Reverse primer <400> 6 acatgaagag agaggatatg gatca 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> DREB2A Forward primer <400> 7 ctacaaagcc tcaactacgg aatac 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> DREB2A Reverse primer <400> 8 aaactcggat agagaatcaa cagtc 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> COR47 Forward primer <400> 9 tgaagaggaa gtgaagaaag aaaaa 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> COR47 Reverse primer <400> 10 aaaataaagg atcaaatgca atcaa 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CBF1 Forward primer <400> 11 gatgaggaga caatgtttgg gatgc 25 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> CBF1 Reverse primer <400> 12 ggaaacgact atcgaatatt agtaactc 28 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CBF2 Forward primer <400> 13 tcggttcaat ggaactataa ttttg 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CBF2 Reverse primer <400> 14 ttaccattta cattcgtttc tcaca 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CBF3 Forward primer <400> 15 gcgtttcagg atgagatgtg tgatg 25 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CBF3 Reverse primer <400> 16 tgtacggacg gaagcggca 19 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RAB18 Forward primer <400> 17 ggaagaaggg aataacacaa aagat 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RAB18 Reverse primer <400> 18 gcgttacaaa ccctcattat tttta 25 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RD29A Forward primer <400> 19 cacaatcact tggctccact gttg 24 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD29A Reverse primer <400> 20 acctagtagc tggtatggag gaact 25 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD29B Forward primer <400> 21 gttgaagagt ctccacaatc acttg 25 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD29B Reverse primer <400> 22 atacaaatcc ccaaactgaa taaca 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD26 Forward primer <400> 23 aggtcttaat ccaattccag agcta 25 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD26 Reverse primer <400> 24 acccatcagt aacttcacat ctctc 25 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> KIN1 Forward primer <400> 25 tgttaacttc gtgaaggaca agac 24 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> KIN1 Reverse primer <400> 26 aagtttggct cgtctaataa ttttg 25 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> KIN2 Forward primer <400> 27 tgttaacttc gtgaaggaca agac 24 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> KIN2 Reverse primer <400> 28 acaacaacaa gtacgatgag tacga 25

Claims (5)

delete delete RCAR5 (Regulatory Components ABA Receptor 5) gene consisting of the nucleotide sequence of SEQ ID NO: 1 or RCAR5 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient, a composition for improving the resistance to low temperature stress of a plant.
Method for improving the resistance to low temperature stress of plants, comprising the following steps:
(a) transforming the gene of SEQ ID NO: 1 encoding the RCAR5 (Regulatory Components ABA Receptor 5) protein into a plant; And
(b) overexpressing the RCAR5 protein in the transformed plant.
Transgenic plants with improved resistance to low temperature stress by the method of claim 4.

Images