KR101781735B1 - Method for improving the resistance to the abiotic stresses using CaOSR1 in plants - Google Patents

Abstract

The present invention relates to novel CaOSR1 ( Capsicum annuum Osmotic Stress Resistance 1 ) gene / protein, and a method for promoting abiotic stress resistance of a plant using the same. In the present invention, it hayeotneun determine the resistance promoting effect on abiotic stress such as Ca OSR1 the transgenic plant sensitivity enhancement effect on Absecon seusan (ABA) of (Ca OSR1 -OX), and drying, osmosis, high salt Bar, Ca OSR1 It is expected that it will be useful for the improvement of crops and the like, which can be utilized by mankind through the regulation of expression, and especially the productivity of plants.

Description

[0001] The present invention relates to a method for enhancing abiotic stress resistance of a plant using CaOSR1,

The present invention relates to novel CaOSR1 ( Capsicum annuum Osmotic Stress Resistance 1 ) gene / protein, and a method for promoting abiotic stress resistance of a plant using the same.

Since plants are frequently exposed to a variety of environmental stresses such as drought, salt, cold, heat, and pests, they have developed physiological, biochemical, and molecular defense mechanisms to cope with the deleterious effects of stress. Especially abscisic acid : ABA) signal transduction regulation allows plants to overcome these stresses. It has been reported that plants pretreated with abscisic acid and stressed are resistant to stress compared to plants that do not produce stress, while mutant plants that fail to produce abscisic acid or fail to respond to abscisic acid are known to be stress-free. Therefore, using the proteins involved in the response of the abscisic acid, it will be possible to develop a plant with improved resistance to environmental stress.

ABA acts as a signaling molecule that responds to a variety of environmental factors, causing changes in various physiological and developmental processes, thereby adapting to biological and non-biological stress. In the stress situation, the ABA level increases and induces various reactions such as pore closure. In other words, the ion channels (K ⁺ channels and anion channels) targeted by ABA signaling regulate the flow of ions through the plasma membrane and tonoplast, thereby regulating the expansion of the guard cells.

Environmental stresses, such as drought and high salinity, directly affect grain growth and production. Especially, as the desertification progresses today, water shortages cause big problems in agriculture and the environment. Therefore, it is necessary to develop plants that can survive in a dry environment even when water is used less. When these techniques are developed and applied to crops, agricultural production is expected to increase greatly. Especially in dry areas, plants with improved resistance to dryness, that is, plants capable of lowering the transpiration rate, are favorable to survival, And may be useful for environmental purification in areas where the environment is very dry.

Thus far, extensive studies have been conducted on the dry stress of plants in the past, but the correlation between CaOSR1 and abiotic stress, its role in ABA signaling, specific physiological functions and definite molecular mechanisms have not yet been elucidated.

The present inventors have found that Ca OSR1, which is increased in expression by abscisic acid (ABA) treatment, ( Capsicum annuum Osmotic Stress Resistance 1 ) gene was identified, and the gene was expressed when pepper leaves were treated with ABA, NaCl, or dry stress, and CaOSR1 gene was detected in the abiotic stress resistance mechanism (positive regulator), thereby completing the present invention.

Accordingly, an object of the present invention is to provide a method for enhancing dry stress resistance of a plant by transforming and overexpressing a novel CaOSR1 gene / protein and a CaOSRl gene into a plant.

Another object of the present invention is to provide a transgenic plant improved in dry stress resistance by the above method.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to accomplish the object of the present invention, the present invention provides a method of encoding a protein that promotes resistance to abiotic stress, comprising the steps of: Ca OSR1 comprising the nucleotide sequence of SEQ ID NO: 1; ( Capsicum annuum Osmotic Stress Resistance 1 ) gene.

The present invention also provides a composition for enhancing the abiotic stress resistance of a plant, comprising the gene or a CaOSR1 protein comprising the amino acid sequence of SEQ ID NO: 2 as an active ingredient.

In addition, the present invention provides a method for enhancing the abiotic stress resistance of a plant, comprising the steps of:

(a) Ca OSR1 Transforming the gene of SEQ ID NO: 1 encoding the protein into a plant; And

(b) overexpressing the CaOSR1 protein in the transformed plant.

In addition, the present invention provides a transgenic plant improved in abiotic stress resistance by the above method.

In one embodiment of the invention, the transgenic plant may be a Arabidopsis thaliana (Arabidopsis).

Abiotic stress resistance enhancement method of the plant according to the invention Ca OSR1 (Capsicum annuum Osmotic Stress Resistance 1) comprises the steps of over-expressing the protein, Ca OSR1 the Absecon of the transgenic plants (Ca OSR1 -OX) seusan (ABA), and increased resistance to abiotic stresses such as dryness, osmosis, and high salinity. As a result, Ca OSR1 It is expected that it will be useful for the improvement of crops and the like, which can be utilized by mankind through the regulation of expression, and especially the productivity of plants.

FIG. 1A shows the result of the phylogenetic analysis of CaOSR1, FIG. 1A shows the result of analysis of sequence alignment and phylogenetic analysis of the CaOSR1, FIG. 1B shows the results of analysis of phylogenetic trees of Solanum tuberosum, Solanum lycopersicum , Nicotiana tomentosiformis , Nicotiana sylvestris, Nicotiana tabacum , Arabidopsis lyrata , Arabidopsis thaliana , AtRD29B, Brassica rapa , Brassica napus , and Brassica oleracea ).
FIG. 2 shows results of analysis of the CaSR1 cold acclimation protein (CAP) 160 domain. As a result of analysis of other plant species ( Solanum tuberosum , Solanum lycopersicum , Nicotiana tomentosiformis, Nicotiana sylvestris , and Nicotiana tabacum ) of the CAP 160 domain.
FIG. 3 is a graph showing changes in CaOSR1 expression over time under (A) ABA, (B) drying and (C) high salt stress conditions, and (D) The fluorescence signal of the GFP fusion protein was observed by a confocal microscope.
Figure 4 shows the expression of CaOSR1, (B) phenotype, (C) survival rate, (D) CaOSRl expression in liver (Ca) ), (E) leaf temperature, and (F) pore opening.
FIG. 5 shows the results of comparing leaf temperatures of control plants and CaOSR1-silenced pepper plants.
FIG. 6 shows RT-PCR analysis results of CaOSR1 overexpressing plants and control (wild type, WT) plants.
FIG. 7 is a graph showing the germination rate, (B) / (C) green cotyledon ratio between CaOSR1-overexpressing plants (CaOSR1-OX, # 1, # 2) and control (wild type, WT) ) / (E) growth of roots
8 shows the germination rate, (C) / (D) green cotyledon ratio, and (E) germination rate between CaOSR1 overexpressing plant (CaOSR1-OX) and control (wild type, WT) / (D) root growth.
9 shows the germination rate, (C) / (D) green cotyledon ratio between CaOSR1 overexpressing plant (CaOSR1-OX) and the control (wild type, WT) plant (A) / (B) / (D) root growth.
FIG. 10 shows the expression patterns of CaOSR1-overexpressing plants (CaOSR1-OX, # 1, # 2) and control (wild type, WT) control plants (wild type, WT) C) temperature of leaves, and (D) pore opening
FIG. 11 shows the results of confirming NCED3, KIN2, COR15A and RD29B expression between CaOSR1-overexpressing plant (CaOSR1-OX) and control (wild type, WT) under dry stress treatment conditions.

The present inventors have found that abscisic acid (ABA), Ca OSR1 Determine the resistance increase of the ABA sensitivity increases, drying, osmotic and dry stress in (Capsicum annuum Osmotic Stress Resistance 1) increased gene expression, and Ca OSR1 the gene is over-expressing transgenic Arabidopsis thaliana, and have accomplished the present invention based thereon .

The present invention provides the CaOSR1 gene consisting of the nucleotide sequence of SEQ ID NO: 1, which encodes a positive regulator protein for abiotic stress.

As used herein, the term " abiotic stress " refers to stress induced by non-biological factors, preferably dry, osmotic, or high salt stress, but is not limited thereto.

The gene of the present invention, CaOSR1, was isolated from red pepper by differential hybridization analysis. The CaOSR1 The gene is preferably composed of the nucleotide sequence of SEQ ID NO: 1, and the peptide encoded by the CaOSR1 gene may preferably be SEQ ID NO: 2, but is not limited thereto.

As used herein, a "positive regulator protein" refers to a protein that acts in an increasing direction in the regulation of life events. That is, when the gene of the present invention, CaOSR1 gene, is overexpressed, resistance to increase in ABA sensitivity and resistance to dryness, osmosis and high salt stress may be increased.

The present inventors have found that the Ca OSR1 in response to abiotic stress While studying to discover new functions of genes, Ca OSR1 The gene was first identified (see Example 3), which was strongly induced in pepper leaves exposed to abscisic acid (ABA), dry and high salt (NaCl) stress. Based on these experimental results, the CaOSR1 gene And to investigate the association between resistance to abiotic stresses such as expression, drying, osmosis, and saltiness.

First, in one embodiment of the present invention, Ca OSR1 The gene was isolated and the homology of the CaOSR1 protein with the protein of other plant species was confirmed. It was confirmed that the CaOSR1 protein was located in the nucleus and cytoplasm using the 35S: CaOSR1- GFP fusion protein Examples 2 and 3).

In another embodiment of the present invention, in the case of a pepper plant in which the CaOSR1 gene is silenced by the Virus Induced Gene Silencing (VIGS) technique, the pore is opened by decreasing the sensitivity to ABA, It was confirmed that the resistance (resistance) was greatly reduced (see Example 4). In addition, the by identifying in Arabidopsis result of overexpression of the Ca OSR1 gene, as well as to increase the sensitivity to ABA in balahgi, oil feat step, Sikkim significantly increase the resistance to drying, osmosis, high salt stress, Ca OSR1 ABA < / RTI > signal transduction (see Examples 5-8).

Thus, by increasing the expression or activity of Ca OSR1 protein it can enhance the resistance (resistance) to abiotic stress in plants, and thus, as another aspect of the invention there is provided Ca OSR1 protein or a gene encoding the same As an active ingredient, a composition for promoting dryness resistance of a plant.

In the present invention, the plant (sieve) is a food crop including rice, wheat, barley, corn, soybean, potato, red bean, oats, sorghum; Vegetable crops including Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Special crops including ginseng, tobacco, cotton, sesame seed, sugar cane, beet, perilla, peanut, and rapeseed; Fruit trees including apple trees, pears, jujube trees, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots, and bananas; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies, tulips; And feed crops including rice, red clover, orchardgrass, alpha-alpha, tall fescue, perennialla grass, and the like, most preferably, but not limited to, Arabidopsis thaliana or red pepper.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Experimental Preparation and Experimental Method

1-1. Plant materials and growth conditions

Pepper (Capsicum annuum L., cv. Hanbyul) and tobacco ( Nicotiana benthamiana seeds were grown in steam sterilized blended soil (peat moss: perlite: vermiculite = 5: 3: 2, v / v / v), sand, and loam soil 1: 1: 1 (v / v / v). And white fluorescent intensity for 16 hours a day, 80 μmol photons m ^-2 s ^{- 1} was grown at 27 ± 1 ℃ room flashes the light. The tobacco plants were grown in a chamber set at a temperature of 25 +/- 1 DEG C for 16 hours day / 8 hour night cycle. Seeds of Arabidopsis thaliana (ecotype Col-0) were germinated in MS (Murashige and Skoog) salt supplemented with 1% sucrose and Microagar (Duchefa Biochemie) And grown in one chamber. The Arabidopsis seedlings were grown at 24 ° C temperature, 60% humidity, 16 hours / 8 hours in a steam sterilized blend soil (peat moss: perlite: vermiculite = 9: 1: 1, v / v / v) (130 μmol photons m ^-2 s ^-1 ) light under day / night cycle conditions. All seeds were vernalized at 4 ° C for 2 days before seeding into the chamber.

1-2. Sequence alignment

The deduced amino acid sequence for CaOSRl and its homologous sequence were obtained using BLAST searches (http://www.ncbi.nlm.nih.gov/BLAST). Amino acid alignment was performed using CLUSTALW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2) and the results were analyzed using Genedoc software (http://www.nrbsc.org/gfx/genedoc) Respectively. The amino acid sequence alignment was adjusted manually to compare the clone of CaOSRl cDNA with that of other organisms. Based on data from multiple sequence alignments, the phylogenetic tree was created with MEGA software (version 5.2). Sequence alignments were performed using the EMBOSS Needle webtool (http://www.ebi.ac.uk/Tools/psa/emboss_needle) to determine the identity and similarity between the two proteins.

1-3. Virus-induced gene silencing and overexpression (VIGS & OX)

Tobacco rattle virus (TRV) -based VIGS system was used to knock down the Ca OSR1 gene in pepper. More particularly, it uses a 1598-1805 bp fragment of the cDNA Ca OSR1.

The CaOSR1-overexpressing (OX) transgenic Arabidopsis thaliana was inserted into the pK2GW7 binary vector by full-length CaOSR1 cDNA (702-bp) to induce normal expression of the CaOSR1 gene under the control of CaMV (cauliflower mosaic virus) 35S promoter in Arabidopsis thaliana . The CaOSR1 binary vector was introduced into Agrobacterium tumefaciens strain GV3101 by electroporation and the Agrobacterium-mediated transformation was carried out by the floral dip method on the Arabidopsis thaliana harboring the CaOSR1 gene. For the selection of CaOSRl-overexpressed (ox) transformants, seeds were obtained from plants presumed to be transformed and plated on MS agar plates containing 50 ug / ml Kanamycin.

1-4. ABA, dry stress and NaCl treatment

To determine the expression pattern of the CaOSR1 gene in pepper plants after ABA treatment, 100 μM ABA or control solution was sprayed onto six-leaf stage pepper plants. For NaCl and dry stress treatment, the pepper plants were irrigated with 200 mM NaCl solution, carefully separated from the soil to avoid scratching, and dehydrated by placing on 3 mm filter paper. The leaves were harvested at 0, 2, 6, 12 and 24 hours after each treatment, and RNA isolation and RT-PCT analysis were performed. To measure germination, root elongation and seeding rate, wild type and Ca OSR1 Overexpression (Ca OSR1 -OX) transgenic Arabidopsis seeds were stratified for 2 days at 4 ℃ and seeded on 0.5 × MS agar medium supplemented with a variety of ABA. The plants were grown under fluorescent light (130 μmol photons m ^-2 s ^-1 ) at 24 ° C and day / night cycle times of 16 hours / 8 hours.

Three-week-old wild-type and CaOSR1-OX transgenic Arabidopsis thaliana were randomly planted and then subjected to dry stress by discontinuing watering for 9 days. The plant was again watered for 2 days to recover and the survival rate of the plant was calculated.

In the case of pepper plants, dry stress was given by stopping the watering for 12 days on four-leaf stage pepper plants. Then, the plant was again given water for 2 days to recover, and the survival rate of the plant was calculated.

Drying resistance was quantitatively determined by measuring the amount of water loss that evaporated. For this, leaves collected from four-leaf stage pepper plants and three-week-old Arabidopsis leaves were placed in a petri dish. The Petri dish was placed in a growth chamber at 40% relative humidity, and the loss of fresh weight was measured at a fixed time, and the experiment was repeated three times.

1-6. Thermal imaging

For thermal image analysis, ABA 50 μM was applied to 4-week-old red pepper and 3-week-old Arabidopsis thaliana. Thermal images were taken using an infrared camera (FLIR systems, T420) and leaf temperature was calculated by FLIR Tools + ver 5.2 software.

1-7. Biological tests of stomatal aperture

For the bioassay, leaf husks were harvested from 3-week-old plant rosette leaves and stained with stomatal opening solution (SOS: 50 mM KCl, 10 mM MES-KOH, pH 6.15, 10 mM CaCl ₂ ). After incubation for 3 hours, the solution was replaced with an SOS solution containing 20 [mu] M ABA and incubated for a further 2 hours. The pores were then measured in each sample and the experiments were performed independently three times each.

1-8. RNA extraction and qRTPCR

Total RNA was dehydrated and extracted from Arabidopsis leaf tissues infected with bacterial pathogens using RNeasy Mini kit (Qiagen, Valencia, CA, USA). All RNA samples were digested with RNA-free DNase to remove genomic DNA. After quantification with a spectrophotometer, 1 μg of total RNA was used for cDNA synthesis using Transcript First Strand cDNA synthesis kit (Roche, Indianapolis, Ind., USA). At the same time, cDNAs were synthesized without reverse transcriptase and semi-quantitative RT-PCT was performed to exclude possible contamination of genomic DNA in cDNA samples.

For qRTPCR analysis, the synthesized cDNA was amplified using a CFX96 Touch ™ real-time PCR detection system (Bio-Rad, Hercules, Calif., USA) with iQ ™ SYBR Green Supermix and the specific primers shown in Table 1 below All reactions were carried out in triplicate and the PCR conditions were as follows: After heating at 95 ° C for 5 min, the reaction was terminated at 95 ° C for 20 sec., Then at 95 ° C for 20 sec. The reaction was terminated by incubation at 37 ° C. 60 ° C for 20 seconds, and 72 ° C for 20 seconds]. The relative expression level of each gene was calculated by the ΔΔCt method and the Arabidopsis actin 1 gene was used for normalization.

Primer name Primer sequence (5'-3 ') For cloning CaOSR1 Forward
(SEQ ID NO: 3) ATGGAGGCACAACTGCACCGTC Reverse
(SEQ ID NO: 4) TTATTCAACCCTTCCCCCAACA For RT-PCR CaOSR1 Forward
(SEQ ID NO: 5) CTCGAGCTATCAGAGCAAAGTC Reverse
(SEQ ID NO: 6) TCTAGAGATCCTGTGTATTGACCAT CaACT1 Forward
(SEQ ID NO: 7) GACGTGACCTAACTGATAACCTGAT Reverse
(SEQ ID NO: 8) CTCTCAGCACCAATGGTAATAACTT Actin8 Forward
(SEQ ID NO: 9) CAACTATGTTCTCAGGTATTGCAGA Reverse
(SEQ ID NO: 10) GTCATGGAAACGATGTCTCTTTAGT NCED3 Forward
(SEQ ID NO: 11) ACATGGAAATCGGAGTTACAGATAG Reverse
(SEQ ID NO: 12) AGAAACAACAAACAAGAAACAGAGC KIN2 Forward
(SEQ ID NO: 13) TGTTAACTTCGTGAAGGACAAGAC Reverse
(SEQ ID NO: 14) ACAACAACAAGTACGATGAGTACGA COR15A Forward
(SEQ ID NO: 15) GATACATTGGGTAAAGAAGCTGAGA Reverse
(SEQ ID NO: 16) ACATGAAGAGAGAGGATATGGATCA RD29B Forward
(SEQ ID NO: 17) GTTGAAGAGTCTCCACAATCACTTG Reverse
(SEQ ID NO: 18) ATACAAATCCCCAAAACTGAATAACA

Example 2. Isolation and sequencing of CaOSR1 gene

From a cDNA library obtained from a Differential hybridization analysis handle Absecon seusan (abscisic acid, hereinafter ABA) in pepper leaves were extracted for cDNA Ca OSR1 (accession no.KT693385). In the pepper leaves treated with ABA, the expression of CaOSR1 gene was increased.

Ca OSR1 cDNA is, 2643bp ORF comprises (open reading frame), and comprises a 880 amino acid residues, all of which are estimated to have an isoelectric point of the 93,865 Da molecular weight, and 5.65 (FIG. 1).

Sequence alignment analysis and results showed that CaOSR1 was clustered into a family of 5 low temperature-induced 65 kDa (LTI65) proteins from Solanaceae family (Figure 1A), Solanum tuberosum (accession no. XP_006353392.1) with 60% indentity and 64.3% similarity with LTI65 protein. Although the sequence homology is less than 35%, CaOSRl has sequence homology with Arabidopsis proteins such as rd29B, lti65, rd29A, and cor78. In particular, RD29B has an indentity of 26.4% and a similarity of 34.3%.

The results of the domain analysis show that CaOSR1 has two conserved regions with acidic region (72 to 88 aa) and CAP160 domain (653 to 679 aa) (Fig. 1B and Fig. 2) It is known to be induced by dry stress as well as low temperature exposure.

Thus, it can be seen that CaOSR1 works in plant responses to dehydration-related stress.

Example 3: Ca by ABA, drying, and high salt treatment OSR1  Induction of gene

In order to investigate the role of the Ca OSR1 gene in response to the dry stress, the expression of Ca OSR1 in the pepper leaves was observed after the treatment with ABA, drying, and high salt (NaCl), respectively (Fig.

As a result, as shown in Fig. 3, accumulation of CaOSR1 transcripts was found after 6 hours of ABA treatment, and the maximum value was shown after 24 hours (see Fig. 3A). It was detected after 12 hours in the case of the dry treatment, and reached a maximum at 24 hours (see FIG. 3B). It was confirmed that the expression was upregulated in the high salt treatment (see FIG. 3C). From the above results, it was found that Ca OSR1 was involved in the response to abiotic stress.

In order to confirm the position of the Ca OSR1 protein in plant cells, the fluorescent protein Green flourescent protein (GFP) was fused to the C-terminus of the CaOSR1 full-length cDNA under the control of the 35S promoter. It was confirmed that the expression of 35S: CaOSRl-GFP fusion protein in the epidermal cell of Nicotiana benthamiana produces GFP signal in the nucleus (Fig. 3D).

From the above results, it was found that the CaOSR1 protein targets the nucleus and functions at the corresponding position.

Example  4. CaOSR1 - Silent ( slienced ) Drying from pepper plants Increased susceptibility to stress  Confirm

In order to investigate the CaOSR1 gene involved in osmotic stress, first, virus-induced gene silencing (VIGS) -based gene function analysis using a TRV (tobacco rattle virus) vector according to Example 1-3 and overexpression asaay of Arabidopsis .

First, dry phenotypes were compared using a control plant (TRV: 00) inoculated with a CaOSR1 -silenced pepper plant (TRV: CaOSR1 ) and an empty vector. As a result, as shown in Figures 4a to 4c, Ca OSR1 - Expression of CaOSR1 in the silence pepper plants were as insignificant. However, when the control plants and the CaOSR1 -silenced red pepper plants were dehydrated for 12 days to undergo dry stress, the CaOSR1 -silenced pepper plants became more vigorous than the control plants (see FIG. 4b). In addition, after watering for recovery, each survival rate was measured. As a result, only 42.8% of the CaOSR1 -silenced pepper plants resumed growth while 85.7% of the control plants resumed growth (see FIG. 4C ). From the above results, it was found that the suppression of CaOSR1 gene expression greatly increased the susceptibility to dry stress.

Next, in order to ascertain the correlation between the dry-sensitive phenotype and the moisture content, in other words, to determine whether the dry-sensitive phenotype of the CaOSR1 -silenced pepper plant was due to the reduced moisture retention, an empty vector was inoculated The fresh weight of rosette leaves removed from a control plant and CaOSR1 -silenced pepper plants was measured to compare the transpiration water loss. As a result, as shown in Fig. 4 (d), the moisture loss of the leaf tissues was relatively higher in the CaOSR1 -silenced pepper plants than in the control plants.

Next, to determine the dry-sensitive phenotype, leaf temperatures of control plants and CaOSR1 -silenced pepper plants were measured and compared. As a result, the leaf temperature did not change significantly before ABA treatment (FIG. 5), but after ABA treatment, the CaOSR1 -silenced pepper plants showed significantly lower leaf temperature than the control plants due to the high rate of proliferation 4E).

On the other hand, the amount of water loss that is evaporated is controlled by stomatal movement, and high sensitivity to ABA also reduces pore size.

In order to determine whether the increased rate of CaOSR1 -silenced pepper plants was due to the increase in stomatal aperture, it was suggested that pore motion, which plays an important role in stomatal closure after treatment with ABA (20 μM) Were measured. At this time, the preliminary disclosure indicates the degree of opening of the pores in the plant. As shown in Figure 4f, no difference in pore motion was observed between CaOSR1 -silenced pepper plants and control plants when ABA was not treated. However, in the case of ABA treatment, it was confirmed that the pore size was decreased in both plants, while the CaOSR1 - silenced pepper plants had larger pores than the control plants. From the above results, it can be seen that the high rate of proliferation in CaOSR1 -silenced pepper plants is due to the decrease of ABA-induced pore blockage.

Example  5. CaOSR1  Overexpression CaOSR1 -OX) < / RTI > At the stunt Sensitivity change to ABA  Confirm

To investigate the physiological role of the CaOSR1 gene, a transgenic Arabidopsis thaliana overexpressing the CaOSR1 gene was first prepared under the control of the strong all-expression CaMV 35S promoter according to Example 1-3, and two independent T3 isotype lines (CaOSR1- OX # 1 and CaOSR1-OX # 2) were obtained (Figure 6) and used for phenotypic analysis.

The germination rates of CaOSR1-OX plants and wild-type plant seeds were sown and germinated on MS plates supplemented with various concentrations (0, 0.5 and 1.0 μM) of ABA, respectively. As a result, as shown in Fig. 7A, no difference was observed in the germination rate between wild-type plants and seeds of CaOSR1-OX plants until the fifth day after sowing when ABA was not treated. However, when 0.5 μM and 1.0 μM of ABA were treated, the germination rate of CaOSR1-OX plants was decreased compared with that of wild type seeds at 2-5 days after sowing. As a result, the seeds of CaOSR1- The sensitivity to ABA was low.

On the other hand, the difference between CaOSR1-overexpressing (CaOSR1-OX) plants and wild-type was more prominent in the seedling stage when compared to the response to ABA in germination.

More specifically, seeds of CaOSR1-OX plants and wild-type plants were seeded on MS plates supplemented with 0.0, 0.5, or 1.0 [mu] M of ABA and grown for 5 days. As a result, cotyledons (Fig. 7B and Fig. 7C), and as shown in Fig. 7D, the number of seedlings with a root length in the aOSR1 overexpressing (CaOSR1-OX) plant was lower than that in the wild type (Figs. 7D and 7E).

These results indicate that overexpression of the CaOSR1 gene in Arabidopsis gives ABA sensitivity during germination and mamorization.

Example  6. Ca OSR1  Overexpression Ca OSR1 -OX) of plant High salt  About stress Reduced  Confirm sensitivity change

As in Example 5 above, two independent T3 isoform lines (CaOSR1-OX) with high expression of the CaOSR1 gene were used and treated with NaCl at various concentrations (100 nM and 150 nM) in the CaOSR1 overexpressed and wild type plants The germination rate, root length and green cotyledon ratio were compared.

As a result, as shown in Fig. 8A, seeds showed higher germination percentage and green cotyledon on seed medium supplemented with 100 nM or 150 nM of NaCl.

In addition, when treated with NaCl, root length and green cotyledon ratio decreased in both plants, and root lengths of CaOSR1 overexpressing plants were longer than wild-type plants (see Figs. 8B and 8C) (See Figs. 8D and 8E). From the above results, it was found that CaOSR1 was involved in the defense reaction of the plant against the high salt in the germination stage and the mammary stage.

Example  7. Ca OSR1  Overexpression Ca OSR1 -OX) for osmotic stress of plants Reduced  Confirm sensitivity change

As in Example 5 above, two independent T3 isoform lines (CaOSR1-OX) with high expression of the CaOSR1 gene were used.

First, mannitol of various concentrations (0, 300 nM, and 400 nM) was treated with CaOSR1 overexpressing plants and wild type plants to compare osmotic stress and germination ratio. As a result, as shown in FIG. 9B, when 300 μM or 400 μM of mannitol was treated, the seeds of the CaOSR1-overexpressing plants germinated faster than the wild-type plants and showed a high germination rate (FIG. 9A).

Next, in order to examine the effect of CaOSR1 expression on green cotyledon formation and root growth when osmotic stress was applied, CaOSR1 overexpressed plants and wild type plants were cultured in medium supplemented with mannitol at various concentrations (300 nM, and 400 nM) 5 days (green cotyledonary measurement) and 8 days (roots growth measurement), and their green cotyledon percentage and root length were compared. As a result, the green cotyledon ratio (FIG. 9C) and the root length (FIG. 9E) of CaOSR1 overexpressing plants and wild-type plants did not show much difference when mannitol was not treated, In both plants, the percentage of green cotyledons and root length decreased, but the percentage of green cotyledons of CaOSR1 overexpressing plants was higher than that of wild type plants, and the root length was longer than that of wild type plants.

From the above results, it was found that CaOSRl is a positive regulator of osmotic stress signaling in the germination and mammary stage.

Example  8. Ca OSR1  Overexpression Ca OSR1 -OX) Increased resistance to drying stress in plants

It was confirmed that CaOSRl-overexpressing plants showed increased resistance to osmotic stress induced in mannitol and high salt in Examples 6 and 7 above. Thus, over-expression Ca OSR1 (OSR1 -OX Ca) to investigate the resistance to drought stress of the plant, and then a dehydration treatment in Ca OSR1 plants overexpressing the wild type plants, compared the fresh weight of the rosette leaves, whereby again the water The survival rate of each was evaluated.

As shown in Fig. 10A, the difference in phenotypic expression between the two plants was hardly observed under normal conditions, whereas when wild type plants were dehydrated for 9 days to undergo dry stress, the plants became worse than the CaOSR1 overexpressing plants. In addition, when water was given for 2 days for recovery, only 38% of the wild type plants resumed growth, but 75% and 56% of CaOSR1 overexpressing plants resumed growth respectively.

As a result of comparing the fresh weight of rosette leaves, the rate of transpiration was lower in the Ca OSR1 overexpressing plants than in the wild type (Fig. 10B), and the leaf temperature was higher in the CaOSR1 overexpressing plants (Fig. 10C) The size was confirmed to be smaller in CaOSR1 overexpressing plants.

Finally, qRT-PCR was performed on wild-type plants and CaOSR1 overexpressing plants while controlling the expression of stress-responsive genes under dry conditions. In normal dry stress conditions, the level of ABA is elevated in plant tissues, which leads to the expression of NCED3, KIN2, COR15A and RD29B. After drought stress treatment for 6 hours, the plants over-expressing Ca OSR1 was identified as compared with the wild type high expression of the NCED3, KIN2, COR15A and RD29B gene (Fig. 11).

From the above results, it was found that overexpression of CaOSR1 promoted resistance to dry stress.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving the resistance to the abiotic stresses using          CaOSR1 in plants <130> MP16-224 <160> 18 <170> KoPatentin 3.0 <210> 1 <211> 2643 <212> DNA <213> Capsicum annuum ABA-Induced Protein 1_CaOSR1 <400> 1 atggaggcac aactgcaccg tccccaggat accggattac actctgggga gggacaaggt 60 caagttcatg atgaaggtga acatcatcat aagcaatcag tgttgaagaa ggttaaggca 120 aaggcaaaaa agatcaagga tcatttaaag catggtcttg gacatgagca cggccacgaa 180 catgagcaag agcaccatcg actccaaggt ggggaggaag aagaagaaga agaagaaacg 240 gatgatgaag aaatggagga aggtgcagaa gttcatggtg ggccatatgc tattaggagt 300 aaagatatta gaaaagagga cgttgtgcca atggccaatt tagagaatcc aactagccca 360 aaggaggatc gttacgattc taagatgaaa aatgaagaag tgcatagtcc agttttgcag 420 aggcaagacg aatttgcgag gcaacctttt accgagactc atgagactaa aggcggcact 480 gatcatctta cttccctagg aaaacatgaa gatcaaggac tgcagggaca tgaaaatatt 540 ggagcaccaa caggcctagt ggatcatcat gctgcccata gacaagttac tgctcccgag 600 actcatgagg ctaaaggctt tgatcatggt atttcccttg gagaacaagg tcatcaagga 660 ctgcagggac atgaaatat tggagcacca acaggccttc agggtcatca tgccgcccac 720 agacctgtta ctgctcccga gactcatgtg actaaggggt ttgatcatgg tatttccctt 780 ggagaacaag gtcatcaagg actgcaggga catgaaaata ttggagcacc aacaggcctt 840 cagggtcatc atgccgccca cagaccagtt actgctcccg aaactcatga ggctaaaggc 900 tttgatcatg gtatttccct tggagaacaa ggtcatcaag gactgcaggg acatgaaaat 960 attggagaac caacaggcct tcagggtcat catgccgccc acagacctgt tactgctccc 1020 caaggtcatg tgactaaggg gtttgatcat ggtatttccc ttggagaaca aggtcatcaa 1080 ggactgcagg gacatgaaaa tattggagca ccaacaggcc ttcagggtca tcatgccgcc 1140 cacagaccag ttactgctcc cgaaactcat gaggctaaag gctttgatca tggtatttcc 1200 cttggagaac aaggtcatca aggactgcag ggacatgaaa atattggaga accaacaggc 1260 cttcagggtc atcatgccgc ccacagacca gttactgctc ccgaggctca tgtgactaag 1320 gggtttgatc atggtactgc ccttggacta caggggcatg aagatattgg agcaccaaca 1380 ggtttgacaa atcagccagc ttcccacttc cgtgaacaga tgcatagacc acctactgct 1440 tctgagaccc atgaggctga aggctttgat catgttactg cccatgggga actgaaagat 1500 caaggacttc aggagcgcaa gttcaaagta ttaacaagtt tagaggagga tcctcacgtc 1560 cctaaagatc gtccagagat gaacccgcat ccggccaact atcagagcaa agtcactgat 1620 ccaacaggcg ccaacaatga gaaaccagga gttggtccac ttgttcaatc attcgagaaa 1680 atgggcgtca atgatgttcc agaaacaaca ggagaacaag ggatcgaagg aataagaaca 1740 gagacaagag cagcagggga catggaactt gatcaaggaa cagagcatgg tcaatacaca 1800 ggatcacatg atcaatttgc tccacaagag actcctacta atttcccctt agttcctgaa 1860 gacactgaat cagttccaaa gagtatggat ccaagaaatc cagaagattt acctcaggat 1920 acactaactg ggaaaccagg tagctataca gagaagattt catctgcaac atcagtaatt 1980 gctgataagg cagttgctgc taagaacgtt gtcgcctcaa aactcgggta cgctggaaca 2040 aatgaggaaa ctaaaaagac acaagcaaca gaagttgata aagattcaac aagaacaaac 2100 tcagcaactg gactagcaca gaaagctgcg agcacagttg cgggaaaact ggctccagtt 2160 tatgagaagg tggcgggtgc tggtagcaga gtcatggcaa aagttcaagg cactacgact 2220 ggagttgcag gacatgaagg gaatactaaa gaaactgata aaggggtgtc aatgaaggag 2280 tatttggcag agaaatttaa gcctggagag gaagacaagg cactttctga agttatttcg 2340 gggtcgcttt caagacagaa ggagaaaaca ggagaaacag gggaggcaaa gccaatggga 2400 aaggtgactg aatcagagga agtagagagg cgattgggtc ccattggaaa cacaatgaaa 2460 gaagaaaatg gtgcatctgg agaaacacaa gtcggtgaaa gcttcggaca gggtgtggtg 2520 gatagggtca aaggtgctgt aagtacatgg tttgggaaag ggggtgaagc acaaacggct 2580 tccggcatta caaaggattc tgctgtgggt ggaggtgctg ttgttggggg aagggttgaa 2640 taa 2643 <210> 2 <211> 880 <212> PRT <213> Capsicum annuum ABA-Induced Protein 1_CaOSR1 <400> 2 Met Glu Ala Gln Leu His Arg Pro Gln Asp Thr Gly Leu His Ser Gly   1 5 10 15 Glu Gly Gln Gly Gln Val His Asp Glu Gly Glu His His His Lys Gln              20 25 30 Ser Val Leu Lys Lys Val Lys Ala Lys Ala Lys Lys Ile Lys Asp His          35 40 45 Leu Lys His Gly Leu Gly His Glu His Gly His Glu His Glu Gln Glu      50 55 60 His His Arg Leu Gln Gly Gly Glu Glu Glu Glu Glu Glu Glu Glu Thr  65 70 75 80 Asp Asp Glu Glu Met Glu Glu Gly Ala Glu Val His Gly Gly Pro Tyr                  85 90 95 Ala Ile Arg Ser Lys Asp Ile Arg Lys Glu Asp Val Val Pro Met Ala             100 105 110 Asn Leu Glu Asn Pro Thr Ser Pro Lys Glu Asp Arg Tyr Asp Ser Lys         115 120 125 Met Lys Asn Glu Glu Val His Ser Pro Val Leu Gln Arg Gln Asp Glu     130 135 140 Phe Ala Arg Gln Pro Phe Thr Glu Thr His Glu Thr Lys Gly Gly Thr 145 150 155 160 Asp His Leu Thr Ser Leu Gly Lys His Glu Asp Gln Gly Leu Gln Gly                 165 170 175 His Glu Asn Ile Gly Ala Pro Thr Gly Leu Val Asp His His Ala Ala             180 185 190 His Arg Gln Val Thr Ala Pro Glu Thr His Glu Ala Lys Gly Phe Asp         195 200 205 His Gly Ile Ser Leu Gly Glu Gln Gly His Gln Gly Leu Gln Gly His     210 215 220 Glu Asn Ile Gly Ala Pro Thr Gly Leu Gln Gly His His Ala Ala His 225 230 235 240 Arg Pro Val Thr Ala Pro Glu Thr His Val Thr Lys Gly Phe Asp His                 245 250 255 Gly Ile Ser Leu Gly Glu Gln Gly His Gln Gly Leu Gln Gly His Glu             260 265 270 Asn Ile Gly Ala Pro Thr Gly Leu Gln Gly His His Ala Ala His Arg         275 280 285 Pro Val Thr Ala Pro Glu Thr His Glu Ala Lys Gly Phe Asp His Gly     290 295 300 Ile Ser Leu Gly Glu Gln Gly His Gln Gly Leu Gln Gly His Glu Asn 305 310 315 320 Ile Gly Glu Pro Thr Gly Leu Gln Gly His His Ala Ala His Arg Pro                 325 330 335 Val Thr Ala Pro Gln Gly His Val Thr Lys Gly Phe Asp His Gly Ile             340 345 350 Ser Leu Gly Glu Gln Gly His Gln Gly Leu Gln Gly His Glu Asn Ile         355 360 365 Gly Ala Pro Thr Gly Leu Gln Gly His His Ala Ala His Arg Pro Val     370 375 380 Thr Ala Pro Glu Thr His Glu Ala Lys Gly Phe Asp His Gly Ile Ser 385 390 395 400 Leu Gly Glu Gln Gly His Gln Gly Leu Gln Gly His Glu Asn Ile Gly                 405 410 415 Glu Pro Thr Gly Leu Gln Gly His His Ala Ala His Arg Pro Val Thr             420 425 430 Ala Pro Glu Ala His Val Thr Lys Gly Phe Asp His Gly Thr Ala Leu         435 440 445 Gly Leu Gln Gly His Glu Asp Ile Gly Ala Pro Thr Gly Leu Thr Asn     450 455 460 Gln Pro Ala Ser His Phe Arg Glu Gln Met His Arg Pro Thr Ala 465 470 475 480 Ser Glu Thr His Glu Ala Glu Gly Phe Asp His Val Thr Ala His Gly                 485 490 495 Glu Leu Lys Asp Gln Gly Leu Gln Glu Arg Lys Phe Lys Val Leu Thr             500 505 510 Ser Leu Glu Glu Asp Pro His Val Pro Lys Asp Arg Pro Glu Met Asn         515 520 525 Pro His Pro Ala Asn Tyr Gln Ser Lys Val Thr Asp Pro Thr Gly Ala     530 535 540 Asn Asn Glu Lys Pro Gly Val Gly Pro Leu Val Gln Ser Phe Glu Lys 545 550 555 560 Met Gly Val Asn Asp Val Pro Glu Thr Thr Gly Glu Gln Gly Ile Glu                 565 570 575 Gly Ile Arg Thr Glu Thr Arg Ala Ala Gly Asp Met Glu Leu Asp Gln             580 585 590 Gly Thr Glu His Gly Gln Tyr Thr Gly Ser His Asp Gln Phe Ala Pro         595 600 605 Gln Glu Thr Pro Thr Asn Phe Pro Leu Val Pro Glu Asp Thr Glu Ser     610 615 620 Val Pro Lys Ser Met Asp Pro Arg Asn Pro Glu Asp Leu Pro Gln Asp 625 630 635 640 Thr Leu Thr Gly Lys Pro Gly Ser Tyr Thr Glu Lys Ile Ser Ser Ala                 645 650 655 Thr Ser Val Ile Ala Asp Lys Ala Val Ala Ala Lys Asn Val Val Ala             660 665 670 Ser Lys Leu Gly Tyr Ala Gly Thr Asn Glu Glu Thr Lys Lys Thr Gln         675 680 685 Ala Thr Glu Val Asp Lys Asp Ser Thr Arg Thr Asn Ser Ala Thr Gly     690 695 700 Leu Ala Gln Lys Ala Ala Ser Thr Val Ala Gly Lys Leu Ala Pro Val 705 710 715 720 Tyr Glu Lys Val Ala Gly Ala Gly Ser Arg Val Met Ala Lys Val Gln                 725 730 735 Gly Thr Thr Thr Gly Val Ala Gly His Glu Gly Asn Thr Lys Glu Thr             740 745 750 Asp Lys Gly Val Ser Met Lys Glu Tyr Leu Ala Glu Lys Phe Lys Pro         755 760 765 Gly Glu Glu Asp Lys Ala Leu Ser Glu Val Ile Ser Gly Ser Leu Ser     770 775 780 Arg Gln Lys Glu Lys Thr Gly Glu Thr Gly Glu Ala Lys Pro Met Gly 785 790 795 800 Lys Val Thr Glu Ser Glu Glu Val Glu Arg Arg Leu Gly Pro Ile Gly                 805 810 815 Asn Thr Met Lys Glu Glu Asn Gly Ala Ser Gly Glu Thr Gln Val Gly             820 825 830 Glu Ser Phe Gly Gln Gly Val Val Asp Arg Val Lys Gly Ala Val Ser         835 840 845 Thr Trp Phe Gly Lys Gly Gly Gly Ala Gln Thr Ala Ser Gly Ile Thr     850 855 860 Lys Asp Ser Ala Val Gly Gly Gly Ala Val Val Gly Gly Arg Val Glu 865 870 875 880 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CaOSR1_Forward primer for Cloning <400> 3 atggaggcac aactgcaccg tc 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CaOSR1_Reverse primer for Cloning <400> 4 ttattcaacc cttcccccaa ca 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CaOSR1_Forward primer for RT-PCR <400> 5 ctcgagctat cagagcaaag tc 22 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CaOSR1_Reverse primer for RT-PCR <400> 6 tctagagatc ctgtgtattg accat 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CaACT1_Forward primer for RT-PCR <400> 7 gacgtgacct aactgataac ctgat 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > CaACT1_Reverse primer for RT-PCR <400> 8 ctctcagcac caatggtaat aactt 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Actin8_Forward primer for RT-PCR <400> 9 caactatgtt ctcaggtatt gcaga 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Actin8_Reverse primer for RT-PCR <400> 10 gtcatggaaa cgatgtctct ttagt 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> NCED3_Forward primer for RT-PCR <400> 11 acatggaaat cggagttaca gatag 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> NCED3_Reverse primer for RT-PCR <400> 12 agaaacaaca aacaagaaac agagc 25 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> KIN2_Forward primer for RT-PCR <400> 13 tgttaacttc gtgaaggaca agac 24 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> KIN2_Reverse primer for RT-PCR <400> 14 acaacaacaa gtacgatgag tacga 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> COR15A_Forward primer for RT-PCR <400> 15 gatacattgg gtaaagaagc tgaga 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> COR15A_Reverse primer for RT-PCR <400> 16 acatgaagag agaggatatg gatca 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > RD29B_Forward primer for RT-PCR <400> 17 gttgaagagt ctccacaatc acttg 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> RD29B_Reverse primer for RT-PCR <400> 18 atacaaatcc ccaaactgaa taaca 25

Claims (5)

Encodes a protein that promotes resistance to abiotic stress, and comprises Ca OSR1 consisting of the nucleotide sequence of SEQ ID NO: 1 ( Capsicum annuum Osmotic Stress Resistance 1 ) gene.
The gene of claim 1 or a CaOSR1 comprising the amino acid sequence of SEQ ID NO: 2 ( Capsicum annuum Osmotic Stress Resistance 1 ) protein as an active ingredient.
A method for enhancing the abiotic stress resistance of a plant, comprising the steps of:
(a) Ca OSR1 Transforming the gene of SEQ ID NO: 1 encoding a Capsicum annuum Osmotic Stress Resistance 1 protein into a plant; And
(b) overexpressing the CaOSR1 protein in the transformed plant.
The method of claim 3,
Wherein the CaOSR1 protein is comprised of the amino acid sequence of SEQ ID NO: 2.
A transgenic plant having enhanced abiotic stress resistance by the method of claim 3.

Images