KR102078252B1 - Bacillus velezensis ARRI17 strain having antifungal activity against Root Rot Pathogen of ginseng and Use Thereof - Google Patents

Abstract

The present invention relates to a new Bacillus velezensis strain having antifungal activity against root rots of ginseng, and a microbial agent for controlling root rots of ginseng comprising the strain, a culture medium thereof, a supernatant of the culture medium, or a mixture thereof as an active ingredient. The Bacillus velezensis strain of the present invention and/or the microbial agent for controlling the root rots of ginseng has antifungal activity against various pathogens of the root rots of ginseng, exhibits excellent antifungal activity, and thus can effectively prevent and treat the root rots of ginseng.

Description

Bacillus velezensis ARRI17 strain having antifungal activity against Root Rot Pathogen of ginseng and Use Thereof}

The present invention is a bacterium root rot disease using a microorganism for the control of ginseng root rot pathogens containing Bacillus velezensis ARRI17 strain having excellent antagonism against ginseng root rot disease and the culture medium as an active ingredient and the microbial agent The present invention relates to a method for controlling prokaryotic bacteria.

Recently, interest in eco-friendly agriculture is increasing, and demand for safe eco-friendly agricultural products is increasing. Due to these social demands, there is no residual risk of chemical pesticides, fertilizers, etc., and research on biological control using environmentally friendly microbial agents has been conducted in various fields.

Ginseng is Korea's unique natural resource and is Korea's representative herbal medicine that has been widely used for thousands of years. Ginseng has been reported to be effective in preventing cancer, inhibiting aging, protecting the liver, fatigue, and enhancing brain function. Ginseng is a plant that grows in an extremely limited environment. It has a longer growing period than other crops and a special and difficult growing method, which has been produced only in some countries of the world.

Since ginseng has been grown for four to six years in the same soil for a long time, it has a very long disturbance. Physiological and microbiological characteristics such as toxins in the soil, deficiency of trace elements, and increased density of soil pathogens are known as major causes of ginseng disturbance. Bacteria, fungi and nematodes have been reported as pathogens that rot the roots of ginseng, and fungal pathogens cause the most damage (Seifert et al., 2003).

The most problematic plant diseases in ginseng cultivation include ginseng root rot and gray mold. Fungal pathogens that damage ginseng include microorganisms from Cylindrocarpon , microorganisms from Fusarium , Ilyonectria mors-panacis , Fusarium solani , and boati Botrytis cinerea , Alternaria panax , Colletotrichum panacicola , and these pathogens invade ginseng roots as they inhabit the soil for a long time. It causes the disease that causes death.

In order to effectively control soil pathogens, chemical fungicides have been used for a long time, but there are also problems such as stability of agricultural products by residual pesticides and the appearance of fungicide-resistant pathogens. To address this problem, alternatives are needed to expand environmentally friendly biological control. In particular, it is necessary to present an eco-friendly way to control ginseng root rot, which is the most problematic in ginseng cultivation, and to develop microorganisms with strong antagonistic ability against ginseng root rot pathogens It is becoming. In addition, starting from 2019, it is necessary to present alternatives for organic materials with excellent functions that can be applied to all agricultural products by suggesting alternatives according to the implementation of the PLS.

The present invention provides a Bacillus velezensis strain having antibacterial activity against pathogens causing ginseng root rot.

The present invention also provides a microbial agent comprising the strain, the culture medium of the strain, a supernatant of the culture medium or a mixture thereof, and a method for controlling ginseng root rot pathogens using the microbial agent.

 The present invention has identified a new strain that can effectively control ginseng root rot causing pathogens to develop an environmentally friendly way to control ginseng root rot, and includes the strain, the culture of the strain, the supernatant of the culture, or a mixture thereof. The present invention was completed by confirming that the microbial agent has a superior antifungal activity in the ginseng root rot disease-induced pathogens, and that the inhibitory spectrum of the pathogens is wide and the control effect is excellent. In addition, the strain of the present invention can also promote the growth of plants by producing natural hormone metabolites, synthesizing and activating proteolytic enzymes, excellent proteolytic activity, nematicidal activity, ginseng in the soil It helps you grow healthier.

According to one embodiment of the present invention, the Bacillus vegetans strain of the present invention may be a strain comprising a gyrB gene consisting of the nucleotide sequence of SEQ ID NO: 1.

According to one embodiment, the Bacillus Velensis strain of the present invention is antibacterial activity against one or more pathogens selected from the group consisting of pathogens causing ginseng root rot disease, gray mold pathogens, anthrax pathogens, and spots pathogens It may be a Bacillus Velensis strain having, for example, it may be a Bacillus Velensis strain having an antimicrobial activity against a pathogen causing ginseng root rot.

The pathogen causing the ginseng root rot disease is Ilyonectria mors-panacis , Phytophthora cactorum , Fusarium solani , Alternaria panax , Botrytis sp., Rhizoctonia sp., And Colletotrichum panacicola may be one or more selected from the group consisting of. The strain Botrytis genus may be Botrytis cinerea , for example, and the strain Rhizoctonia sp. May be Rhizoctonia solani , for example. It is not limited. According to one embodiment, the Bacillus bellensis strain of the present invention has an excellent antagonistic ability in illonectria morspanasis.

 According to one embodiment of the invention, the strain can synthesize and secrete anti-ribosomal lipid peptides (nonribosomal lipopeptide) -based antibacterial material.

The ribosome-free lipid peptide may be at least one selected from the group consisting of iturin A and sulfactin. Iturin A is harmless to the human body, does not cause environmental pollution, and shows excellent control activity against various phytopathogenic bacteria.

In addition, the strain of the present invention may be one having nematicidal activity. According to one embodiment, it was confirmed that a gene region encoding a protease having homology with Bacillus B16 alkaline serine protease, which is reported to have nematicidal activity in the gene of the strain of the present invention. Thus, the strain of the present invention can kill various kinds of nematodes present in the soil, and can provide a suitable soil environment for the growth of ginseng.

 According to one embodiment of the invention, the strain may be a strain for synthesizing and secreting protease. According to one embodiment, when the strain is cultured in a medium containing a protein, protease is secreted from the strain to form a clear zone (clear zone). Therefore, the strain of the present invention can effectively decompose bacteria and the like having a protein coating, and by decomposing the protein nutrients in the soil to produce a low-molecular protein degradation product that allows ginseng to better absorb soil nutrients, Can promote the growth of ginseng.

The strain may be a strain having accession number KFCC11778P.

According to one embodiment of the present invention, the bacterium strains of the Bacillus strain, the culture medium, the supernatant of the culture medium, or a mixture thereof as an active ingredient, it can provide a microbial agent for controlling ginseng root rot disease. At this time, the strain should be in a viable state, which may be in the form of mycelial and spores.

The term 'culture medium' is obtained by inoculating a certain concentration of spores in a medium suitable for microbial growth to induce microorganisms for a certain period of time in the incubator, cells, substances secreted while the cells grow, and nutrients necessary for growth This means mixed liquid.

The microbial agent may be in a liquid, hydrated, granulated or encapsulated form, but is not limited thereto. According to one example, it may be in liquid form or hydrate form.

According to one embodiment, the microbial agent has a strain of the present invention 1 X 10 ⁸ to 1 X 10 ¹² , 1 X 10 ⁹ to 1 X 10 ¹¹ , 1 X 10 ^{10 To} 1 X 10 ¹¹ , It may be included in the content of 1 X 10 ¹⁰ to 9.9 X 10 ¹⁰ cfu / g, or 2 X 10 ¹⁰ to 9 X 10 ¹⁰ cfu / g.

The liquid-type microbial preparation refers to a liquid formulation comprising the polymer and the seaweed extract in the strain, the culture of the strain, the supernatant of the culture, or a mixture thereof. Hydrated formulation means a liquid formulation in which the powder formulation is dissolved in water to become a liquid state, and the natural extract, seed extract, silicic acid, and extender in the strain, culture of the strain, supernatant of the culture, or a mixture thereof. It may include. In addition, the formulation of the microbial preparation of the present invention can be carried out using seaweed extract, silicic acid, polymer polymer, seed extract, surfactant, fulvic acid, extender, nutrient, disintegrant.

The culture medium is the Bacillus Velensis strain LB (Luria Bertani), KB (King's medium B) medium, PDA medium (Potato Dextrose Agar), NB (nutrient broth) medium, BHI (brain heart infusion) medium, TSB ( It may be obtained by culturing in at least one medium selected from the group consisting of Tryptic Soy Broth, and TSA (Tryptic soy agar) medium.

The culture temperature may be 20 to 40 ℃, for example 25 to 35 ℃, 20 to 30 ℃, the culture period is 12 hours to 7 days, for example 12 hours to 5 days, 12 hours to 3 days, 18 Hours to 2 days, 1 to 2 days.

The supernatant of the culture means a supernatant obtained by centrifugation of the culture, and may be a culture supernatant obtained by centrifugation for 5 to 15 minutes at 10,000 to 15,000 rpm. The supernatant contains the metabolite of the strain of the present invention, the metabolite is a substance having antibacterial activity Altanaria Panax, Botrytis cinerea, Fusarium Solani, and the group of the genus Laytononia It may be a material having antimicrobial activity or antifungal activity against one or more strains selected from.

According to one embodiment, the antimicrobial or antifungal substance may be of a nonribosomal lipopeptide type, for example, iturin A, sulfactin, or mixtures thereof. Can be.

The microorganism preparation for ginseng root rot disease control may be 50 to 100% of the control value calculated by Equation 1 below. For example 50 to 100%, 50 to 99%, 50 to 98%, 50 to 90%, 50 to 80%, 50 to 70%, 50 to 60%, 50 to 55%, 50 to 53%, or 50 To 52%.

[Equation 1]

% Control = {(Non-Treatment-Treatment-Incidence) / Treatment-Free Incidence} X 100

As an example, compared to ginseng (untreated group) grown in infected soils, the Cylindrocarpon distractance strains and / or the Puracium Solani strains were grown after treating the microbial agent of the present invention in the same diseased soils. Rotten area of ginseng (treatment group) was significantly reduced and the number of steady ginseng was high. This confirmed that the control effect is excellent.

One example of the present invention provides a method for controlling ginseng root rot disease, comprising applying the microorganism preparation for controlling the ginseng root rot disease of the present invention to one or more crops selected from the group consisting of ginseng and plant-cultivated crops.

The facility-cultivated crops may be eggplant crops, gourd crops. The eggplant fruit includes potatoes, eggplants, tomatoes, peppers, tobacco, petunier, and the like, and fruit crops include, but are not limited to, cucumbers, melons, watermelons, pumpkins, and the like.

The term 'control' generally includes preventing, reducing or eradicating a plant pathogen infection, wherein preventing or reducing an infection means that there is a statistically significant difference with respect to untreated host plants.

The applying step may be performed by spraying or immersing the microbial agent concentrated on the root of the ginseng or the soil adjacent thereto.

When using the microorganism preparations for the control of ginseng root disease of the present invention, it is possible to effectively control the disease occurring in ginseng by inhibiting the growth of the main pathogens, it is possible to activate the microorganism industry to stabilize the production of ginseng and improve farm household income.

Bacillus velezensis strain having an antimicrobial activity against the pathogen causing the ginseng root rot disease of the present invention has a broad pathogen suppression spectrum, it can effectively control the ginseng root rot disease because it has excellent antifungal activity. In addition, there is nematicidal activity can effectively kill the nematode.

Figure 1 shows a flexible relationship analysis table according to the identification results of the ARRI17 strain according to Example 2.
2 shows antagonistic test results against major ginseng pathogens of the ARRI17 strain, according to Example 3. FIG.
Figure 3 shows the experimental results confirming the antimicrobial activity of the metabolite of ARRI17 strain according to Example 4.
Figure 4 shows the experimental results confirming the protein degradation capacity of the ARRI17 strain according to Example 5.
Figure 5 shows the results of analyzing the antifungal material produced by the ARRI17 strain according to Example 6.
Figure 6 shows the results of confirming the cyclolipopeptide (Cyclolipopeptide) produced by the ARRI17 strain according to Example 7.
Figure 7 shows the experimental results confirming the control effect of ginseng root rot disease of ARRI17 strain in actual ginseng according to Example 8.
Figure 8 shows, according to Example 9, to confirm the nematicidal efficacy of ARRI17 strain, the presence or absence of the gene for synthesizing nematicidal active protease by PCR and electrophoresis.

Hereinafter, the present invention will be described in more detail. However, these examples are only for illustrating the present invention by way of example, the scope of the present invention is not limited to these examples.

Example 1.Isolation of antagonistic bacteria against ginseng root rot pathogen

In order to isolate the antagonists effective for the control of ginseng root rot pathogens, samples were collected from two-year-old ginseng collected at Jeokseong-myeon, Paju, and 33 bacteria were isolated therefrom.

First, the ginseng root was surface sterilized in 1% NaOCl for 10 minutes, washed twice with sterile distilled water, and the surface was sufficiently dried for 20 minutes on a sterile workbench. Ginseng roots were horizontally cut using a sterilized knife, and the pieces of ginseng were placed on King'B medium and incubated for 1 week at 25 ° C. in an incubator. Colonies that showed morphological differences in colonies that grew on King’B medium were isolated. Then, the morphological characteristics were confirmed by culturing in LB medium at 30 ° C. for 2 days. Purely isolated strains were inoculated in LB medium, incubated at 30 ° C. and 200 rpm for 1 day, and then sterilized 20% glycerol (glycerol) was added to the strain culture to prepare storage strains, which were then used in the experiment.

It was isolated strain of W in ginseng samples in the same way as the 33 species, through the selection process to form a low-lying the paper disk method, one ryonek triazol Morse wave or sheath to cause the ginseng root rot - for (Ilyonectria mors panacis) ARRI17, a Bacillus velezensis strain having antimicrobial activity, was selected.

Example 2. Identification of Selected ARRI17 Strains

ARRI17 strains selected in Example 1 were identified using molecular biological methods. First, the ARRI17 strain selected in Example 1 was inoculated in NA (nutrient agar) medium, incubated at 28 ° C. for 2 days, and the strain was purely separated. Colony PCR

In order to amplify the gyrB gene region, direct colony PCR was performed using US-1S and UP-2R primers shown in Table 1 below. PCR was denatured at 95 ° C. for 2 minutes, followed by denaturation of DNA and denatured DNA at 95 ° C. for 30 seconds, annealing at 61 ° C. for 30 seconds, and elongation at 72 ° C. for 40 seconds. This process was repeated 35 Cycle. 10 seconds at 72 ° C. followed by further stretching and then stored at 4 ° C.

Primer Name Primer sequence (5 '> 3') SEQ ID NO: UP-1S GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA 2 UP-2R AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT 3

PCR products were purified using a PCR product purification kit (Qiagen), and then analyzed for sequencing. The strains were identified through a blast search at the National Center for Biotechnology Information (NCBI). . As a result of analyzing the gyrB gene for identification of the selected strain, it was confirmed that the DNA of the gyrB gene of the ARRI17 strain had the nucleotide sequence of SEQ ID NO: 1.

Sequence name Sequence (5 '> 3') order
number ARRI17
gyrB CATCTGTCGTAAACGCCTTGTCGACCACTCTTGACGTTACGGTTCATCGTGACGGAAAAATCCACTATCAGGCGTACGAGCGCGGTGTACCTGTGGCCGATCTTGAAGTGATCGGTGATACTGATAAGACCGGAACGATTACCCACTTCGTTCCGGATCCGGAAATCTTCAAAGAAACAACCGTATACGACTATGATCTGCTTTCAAACCGTGTCCGGGAATTGGCCTTCCTGACAAAAGGCGTAAACATCACGATTGAAGACAAACGTGAAGGACAAGAACGGAAAAACGAGTACCACTACGAAGGCGGAATCAAAAGCTATGTTGAGTACTTAAACCGTTCCAAAGAAGTCGTTCATGAAGAGCCGATTTATATCGAAGGCGAGAAAGACGGCATAACGGTTGAAGTTGCATTGCAATACAACGACAGCTATACAAGCAATATTTATTCTTTCACGAATAATATCAACACATACGAAGGCGGCACGCACGAGGCCGGATTTAAAACCGGTCTGACCCGTGTCATAAACGACTATGCAAGAAGAAAAGGGATTTTCAAAGAAAATGATCCGAATTTAAGCGGGGATGATGTGAGAGAAGGGCTGACTGCCATTATTTCAATTAAGCACCCTGATCCGCAATTCGAAGGGCAGACGAAAACGAAGCTCGGCAACTCCGAAGCGAGAACGATCACTGATACGCTGTTTTCTTCTGCGCTGGAAACATTCCTTCTTGAAAATCCGGACTCAGCCCGCAAAATCGTTGAAAAAGGTTTAATGGCCGCAAGAGCGCGGATGGCAGCGAAAAAAGCACGGGAATTGACCCGGCGCAAAAGTGCGCTTGAGATTTCCAATCTGCCGGGCAAACTGGCGGACTGTTCTTCTAAAGATCCGAGCATTTCCGAGCTGTATATCGTAGAGGGTGACTCTGCGGGCGGATCAGCGAAACAGGGACGGGACCGTCATTTCCAAGCTATTCTGCCGCTGCGCGGTAAGATTCT GAACGTTGAGAAAGCCAGACTTGATAAGATTCTCTCAAACAATGAGGTCAGATCAATGATCACGGCCCTCGGAACAGGAATCGGAGAAGATTTT One

As a result of homology analysis on the NCBI web, it was confirmed that the homology of Bacillus velezensis BCRC 17467 ^T (DQ903176) was 98.7%. Thus, it was confirmed that the ARRI17 strain of the present invention corresponds to Bacillus bellensis species. In the present invention, the ARRI17 strain was named Bacillus Velensis ARRI17 (hereinafter referred to as 'ARRI17 strain'), and was deposited with the Korean Culture Center of Microorganisms and received the accession number KFCC11778P.

Example 3. Antagonistic test against major ginseng pathogens

An experiment was conducted to confirm the antagonistic ability against the fungus bacteria causing the ginseng root rot of the ARRI17 strain of the present invention.

For the experiment, Ilyonectria mors-panacis strain was used in the Ginseng Herb Research Institute of Chungnam Agricultural Research and Development Institute, Phytophthora cactorum strain was used in the herb kingking, and Fusa Fusarium solani , Botrytis cinerea , Alternaria panax , and Colletotrichum panacicola are used separately from the Dosinri Doshinri Test Pack. It was.

ARRI17 strains were cultured against 6 kinds of ginseng root rot pathogens ( I.mors-panacis , F.solani , B.cinerea , A.panax , C.panacicola , P.cactorum ) to investigate the mycelial growth. Specifically, ARRI17 strains were inoculated in 20 mL of LB medium and cultured in PDA (Potato Dextrose Agar; Difco) medium at 30 ° C. and 150 rpm for 1 day to prepare a culture solution. Subsequently, 10 µl of the culture solution was dropped on a paper disk, and the surface was dried for 10 minutes, and then cultured in PDA medium for 4-5 days at the optimum growth temperature of each pathogen. Ilyonecria Morspanasis and Botrytis cinerea strains were incubated for 5 days at 20 ° C. in PDA medium, and Fusarium Solani, Altanaria Panax, Colletotricum Panay Coli, and Phytopora Cactorum strains Incubated for 25 days at 25 ℃ in PDA medium. Next, each pathogen flora was cut using an 8mm cork borer and then wound in the center of PDA medium, and then incubated with the ARRI17 strain of the present invention at 25 ° C. After 5 days from the start of the culture was confirmed the growth of pathogens, the results are shown in Figure 2 and Table 3. Table 3 is a result of measuring the diameter of the clear zone formed when the antagonist microorganisms ARRI17 strain and replacement culture.

Antagonist
microbe Clear zone diameter (mm) Iiyonectria mors-panacis Fusarium solani Botrytis cinerea Alternaria panax Collectotrichum panacicola Phytophthora cactorum ARRI17 10.85 3.97 4.23 4.23 6.09 1.85

As shown in Fig. 2, the ARRI17 strain (or culture of the strain) of the present invention is Illonecteria morspanasis, Fusarium solani, Botrytis cinerea, Altanaria panax, choletotricum panai coli It showed antimicrobial activity against, especially, the highest antimicrobial activity was formed by forming a growth support of 10.85mm against Ilurectria morspanasis. Thus, the ARRI17 strain (or culture of the strain) of the present invention was confirmed to have an excellent antagonistic ability against fungal bacteria causing ginseng root rot.

Example 4. Confirmation of antimicrobial activity of metabolites of ARRI17 strain

Experiments were carried out to confirm the antimicrobial activity of the metabolite of the ARRI17 strain of the present invention. First, ARRI17 strains were inoculated in 20 ml of LB medium and cultured in PDA medium at 30 ° C. and 150 rpm for 1 day. After incubation, the culture supernatant was prepared by centrifuging the ARRI17 strain containing 2Х10 ¹⁰ cfu / ml for 10 minutes at 13,000 rpm. 10 μl of the culture supernatant was dropped on a paper disk and then surface dried for 10 minutes, followed by alternaria panax , Botrytis sp., Fusarium solani, and lye in PDA medium. Rhizoctonia sp. Strains were cultured in PDA medium at 25 ° C. for 5 days. Next, each pathogen flora was made into mycelium fragments using 8mm cork borer, and then placed on PDA medium and incubated with ARRI17 strain at 25 ° C. After 5 days from the start of the culture was confirmed the growth of the pathogen, the results are shown in FIG.

Figure 3 shows the results confirming the antimicrobial activity of the ARRI17 strain metabolite contained in the culture supernatant of ARRI17 strain culture. Accordingly, compared with the control, the metabolite of the ARRI17 strain of the present invention inhibits the growth of Altanaria panax, Botrytis cinerea, Fusarium sorani, Lysatonia spp. It was confirmed to have.

Example 5 Confirmation of Protein Degradation Ability of ARRI17 Strains

Experiments were performed to confirm the proteolytic ability of the ARRI17 strain of the present invention. ARRI17 single colony was inoculated into skim milk agar, incubated at 30 ° C. for 2 days, and then the formation of a clear zone was observed around the colonies. The results are shown in FIG. 4. .

The skim milk agar medium was prepared by sterilizing the broth as a basic medium (0.1% bacto beef extract peptone, 0.05% NaCl, 1.2% agar, pH 7.5 ± 0.2) at 121 ° C. and 1 atm for 15 minutes. Sterilized and mixed skim milk medium (1.0% skim milk, 0.03% K ₂ HPO ₄ , 0.03% KH ₂ PO ₄ , 0.01% Na ₂ CO ₃ , pH7.5 ± 0.2) at 105 ° C and 1 atmosphere for 20 minutes After that, it was prepared and used as a plate medium.

As shown in Figure 4, ARRI17 strain after forming a colony on the medium, it was confirmed that the clear zone (clear zone) of 1.5cm or more diameter is formed by digesting the protein. Thus, the ARRI17 strain secreted proteolytic enzymes, it was found that the proteolytic ability is excellent.

Example 6 Analysis of Antifungal Substances Produced by ARRI17 Strain

To identify the antifungal substances produced by the ARRI17 strain, the ARRI17 strain was streaked in sterile Tryptic soy agar (TSA), and then cultured for 1 day at 30 ° C. Next, 5 ml of Tryptic soy broth (TSB) was placed in an Erlenmeyer flask, the inlet was closed in the face, and sterilized to prepare a sterile TSB. Next, one colony of the ARRI17 strain, which was cultured for 1 day, was scraped into a stripper and put into a sterile TSB, followed by shaking culture at 30 ° C., 150 rpm, and 20 to 24 hours under aerobic conditions. Thereafter, 200 mL of TSB was added to a 1 L Erlenmeyer flask, and the inlet was blocked and sterilized. Then, 1% of ARRI17 strain cultured in liquid was inoculated therein, followed by shaking culture at 30 ° C. and 150 rpm for 70 to 72 hours under aerobic conditions. Subsequently, centrifugation was performed for 20 minutes at 4000 rpm for ARRI17 culture medium cultured for 70 to 72 hours, and about 200 ml of supernatant culture filtrate was obtained. 140 mL butanol was added to a 200 ml culture filtrate, and the fractions were subjected to twice. The butanol layer was concentrated under reduced pressure, and 100 mg of the active fraction obtained was dissolved in 300 µl of methanol.

Subsequently, extracts were imprinted on TLC plates using capillaries in TLC plates [1 mm, 20 cm (horizontal) × 20 cm (vertical)] to separate actives. At this time, it developed under the solvent conditions of chloroform: methanol: water (14: 6: 4). Prep-TLC fractions were eluted with methanol to obtain eight fractions of F1 to F8, which are shown in FIG. 5.

As shown in FIG. 5, the F6 fraction of the eight fractions showed high antifungal activity. The F6 fraction, whose antifungal activity was confirmed, was prepared by dissolving in methanol at a concentration of 1 mg / mL, and using an X bridge C18 5 μm (4.6 × 25 mm) column and performing a solvent A 0.1% TFA H ₂ O for HPLC analysis. HPLC analysis was performed using solvent B 0.1% TFA ACN under the gradient conditions shown in Table 4. HPLC analysis results are shown in FIG. 5.

time Solvent A Solvent B 0.01 min 90% 10% 80 min 0% 100% 90 min 0% 100%

As shown in FIG. 5, HPLC chromatogram analysis revealed two major peaks between 34 and 38 minutes of retention time (RT). The two main peaks were purchased from Sigma Aldrich and dissolved in methanol with Iturin A material under HPLC under the conditions shown in Table 4 to confirm that the peak appears at the same RT as the peak shown in the chromatogram analysis. Accordingly, it was assumed that the antifungal active substance of the F6 fraction was iturin A.

Iturin A is harmless to the human body, does not cause environmental pollution, and shows excellent control activity against various phytopathogenic bacteria. Therefore, the ARRI17 strain of the present invention was found to have excellent control activity against the ginseng root rot disease-inducing strain.

Example 7. Confirmation of Cyclolipopeptide Production

In order to identify genes involved in the biosynthesis of secondary metabolites produced by the ARRI17 strain, experiments were performed using PCR detection of antibiotic biosynthesis genes.

Of bacillomycin D, fengycin, iturin A, sulfactin and zwittermicin A, which are commonly known to be produced by Bacillus strains For detection, PCR was performed using the primers of Table 5 below specific for the antibiotic biosynthesis genes bmyA (875bp), fend (964bp), ituA (647bp), srfA (441bp) and zwiA (779bp).

Antibiotic Amplification gene Primer Name Primer sequence (5 '> 3') SEQ ID NO: Bacillomycin D bmyA BACC1F GAAGGACACGGCAGAGAGTC 4 BACC1R CGCTGATGACTGTTCATGCT 5 Fengycin fend FEND1F TTTGGCAGCAGGAGAAGTTT 6 FEND1R GCTGTCCGTTCTGCTTTTTC 7 Iturin a ituA ITUD1F GATGCGATCTGGTTGGATGT 8 ITUD1R ATCGTCATGTGCTGCTTGAG 9 Surfactin a srfA SUR3F ACAGTATGGAGGCATGGTC 10 SUR3R TTCCGCCACTTTTTCAGTTT 11 Zwittermicin A zwiA ZWITF2 TTGGGAGAATATACAGCTCT 12 ZWITR1 GACCTTTTGAAATGGGCGTA 13

PCR reaction was carried out using a reaction volume (AccuPower PCR Premix, BIONEER Corp.) of 20μl total volume. 1μl genomic DNA (50ng) and 10pmol primers were added, and the PCR reaction temperature was reacted at initial denaturation temperature (95 ℃, 2 minutes) according to the manufacturer's instructions. , 95 ° C., 30 sec), annealing (annealing, 55 ° C., 45 sec), elongation (72 ° C., 1 min) was performed, and the final elongation reaction was performed at 72 ° C. for 5 minutes. The amplified PCR product was electrophoresed, and as a result, iturin A and sulfactin biosynthesis genes were detected in the ARRI17 strain of the present invention, but biosynthesis genes of bacillomycin D, pengicin, and zwittermycin A were not detected. Electrophoresis results of detecting iturin A and sulfactin biosynthesis gene are shown in FIG. 6.

Therefore, it was confirmed that the antagonism of ginseng root rot caused by the ARRI17 strain was caused by nonribosomal lipopeptide-based antibacterial substances such as iturin A or sulfactin.

Example 8. Confirmation Effect of Ginseng Root Disease on ARRI17 Strains

When the ARRI17 strain was actually treated in the ginseng root, an experiment was performed to determine whether the ginseng root rot disease control effect was obtained. First, the culture of the ARRI17 strain of the present invention was prepared in liquid and hydration formulations.

Liquid type is the strain ARRI17 2.2x10 ¹⁰ cfu / ㎖ and polymers, and is formulated in a liquid state containing seaweed extract, wettable powder type strain ARRI17 8.6 x ¹⁰ 10 cfu / g and natural extracts, seed extracts, silica, extender, and It is a powder form containing. Formulation was carried out using seaweed extract, silicic acid, polymer polymer, seed extract, fulvic acid and the like.

In addition, compost type (weak soil), humic acid, healthy soil, pathogenic soil was used as a control, pathogens were identified as Cylindrocarpon destructans CY8005 strain, and Fusarium Solani ( Fusarium solani ) strain was used purely isolated from the pathogens in the package of Income Resources Research Institute.

First, in order to prepare soil that develops ginseng root disease, Cylindrocarpon distractance CY8005 strain was grown at 20 ° C. in Rose-bengal agar medium for 2 weeks. Next, sections of the grown mycelium were prepared, and the sections of the prepared mycelium were inoculated at oat inoculation. Next, the oats inoculated with the Cylindrocarpon distractance CY8005 strain were grown in a flask at 20 ° C. for 30 days, so that the mycelia were spread evenly throughout the oat inoculum. After completion of the incubation, the oat inoculum was dried in the shade and pulverized with a grinder to extract DNA. Bacterial density was quantified using real-time PCR.

By putting the oat crushed into the soil to produce a pathogen-prone soil, by knowing the density of bacteria contained in the oat crushed, it was possible to control the amount of the strain contained in the onset soil.

Next, in order to test the antimicrobial effect against ginseng root rot, two-year-old seedlings were transplanted into soil with pathogens at 10 ² cfu / g, and antagonist microorganisms containing liquid or hydration or mixed with them were 1,000 times. After dilution, the 200ml dose was treated four times for 10 days, and the control effect was investigated after about 60 days of treatment with the microbial agent. As a result, in the case of Cylindrocarpon distractance, the disease level was severe in the diseased soil having a density of 10 ² cfu / g, and the control effect was not shown.

Therefore, by further testing, two-year-old seedlings were transplanted into endemic soils with a density of 10 ¹ cfu / g of cylindrocarpon distractance and treated four times for 10 days with liquid or hydrated antagonist preparations. After that, the control effect after 60 days was investigated, and the results are shown in FIG. 7. Subsequently, the control value was measured using Equation 1 below, and the control value was 51.6%.

[Equation 1]

% Control = {(Non-Treatment-Treatment-Incidence) / Treatment-Free Incidence} X 100

The untreated incidence of Equation 1 refers to the incidence of ginseng root disease in ginseng grown in the onset soil not treated with the ARRI17 strain of the present invention or its culture. Treatment incidence refers to the incidence of ginseng root disease in ginseng grown in endemic soil treated with ARRI17 strains or cultures thereof.

As shown in Fig. 7, the ginseng (treatment) when the ARRI17 strain was treated to the diseased soil was significantly more rotten area of the ginseng than the ginseng without the ARRI17 strain, the number of ginseng in the steady state was less. Therefore, it was confirmed that the ARRI17 strain of the present invention is excellent in controlling ginseng root rot disease.

Example 9 Identification of Nematode Active Protease

In order to confirm the nematicidal activity of the ARRI17 strain of the present invention, conserved of the proteases included in the ARRI17 strain showing homology with Bacillus B16 alkaline serine protease (AY708655) reported to have nematicidal activity By comparing the regions, the forward and reverse primers in Table 6 were prepared.

Primer Name Primer sequence (5 '> 3') SEQ ID NO: SPB16_F GTGAGAGGCAAAAAGGTA 14 SPB16_R CTGAGCTGCCGCCTGTAC 15

Next, the genomic DNA of ARRI17 strain was purified and PCR was performed using the primers. PCR was performed for 5 minutes at 94 ° C., and then 30 times at 98 ° C., 30 seconds at 55 ° C., and 1 minute at 72 ° C. was repeated 30 times. Finally, the mixture was reacted at 72 ° C. for 2 minutes to obtain a PCR amplification product. Subsequently, the amplified product was purified and electrophoresed, and the results are shown in FIG. 6.

Both lanes 1 and 2 of FIG. 6 show the results of amplifying the DNA of the ARRI17 strain using SPB16_F and SPB16_R primers. As shown in FIG. 6, it was confirmed that the amplified product of the expected size was produced from the DNA of the ARRI17 strain, and a gene encoding a protease showing homology with the Bacillus B16 alkaline serine protease was included in the DNA of the ARRI17 strain. It is estimated that the ARRI17 strain of the present invention has nematicidal activity.

Depositary Name: Korea Microbial Conservation Center (Domestic)

Accession number: KFCC11778P

Deposit Date: 20180727

<110> GYEONGGI TECHNOPARK <120> Bacillus velezensis ARRI17 strain having antifungal activity          against Root Rot Pathogen of ginseng and Use Thereof <130> DPP20184820KR <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 1094 <212> DNA <213> Artificial Sequence <220> <223> ARRI17 gyrB <400> 1 catctgtcgt aaacgccttg tcgaccactc ttgacgttac ggttcatcgt gacggaaaaa 60 tccactatca ggcgtacgag cgcggtgtac ctgtggccga tcttgaagtg atcggtgata 120 ctgataagac cggaacgatt acccacttcg ttccggatcc ggaaatcttc aaagaaacaa 180 ccgtatacga ctatgatctg ctttcaaacc gtgtccggga attggccttc ctgacaaaag 240 gcgtaaacat cacgattgaa gacaaacgtg aaggacaaga acggaaaaac gagtaccact 300 acgaaggcgg aatcaaaagc tatgttgagt acttaaaccg ttccaaagaa gtcgttcatg 360 aagagccgat ttatatcgaa ggcgagaaag acggcataac ggttgaagtt gcattgcaat 420 acaacgacag ctatacaagc aatatttatt ctttcacgaa taatatcaac acatacgaag 480 gcggcacgca cgaggccgga tttaaaaccg gtctgacccg tgtcataaac gactatgcaa 540 gaagaaaagg gattttcaaa gaaaatgatc cgaatttaag cggggatgat gtgagagaag 600 ggctgactgc cattatttca attaagcacc ctgatccgca attcgaaggg cagacgaaaa 660 cgaagctcgg caactccgaa gcgagaacga tcactgatac gctgttttct tctgcgctgg 720 aaacattcct tcttgaaaat ccggactcag cccgcaaaat cgttgaaaaa ggtttaatgg 780 ccgcaagagc gcggatggca gcgaaaaaag cacgggaatt gacccggcgc aaaagtgcgc 840 ttgagatttc caatctgccg ggcaaactgg cggactgttc ttctaaagat ccgagcattt 900 ccgagctgta tatcgtagag ggtgactctg cgggcggatc agcgaaacag ggacgggacc 960 gtcatttcca agctattctg ccgctgcgcg gtaagattct gaacgttgag aaagccagac 1020 ttgataagat tctctcaaac aatgaggtca gatcaatgat cacggccctc ggaacaggaa 1080 tcggagaaga tttt 1094 <210> 2 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> UP-1S primer <400> 2 gaagtcatca tgaccgttct gcaygcnggn ggnaarttyg a 41 <210> 3 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> UP-2R primer <400> 3 agcagggtac ggatgtgcga gccrtcnacr tcngcrtcng tcat 44 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BACC1F primer <400> 4 gaaggacacg gcagagagtc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BACC1R primer <400> 5 cgctgatgac tgttcatgct 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FEND1F primer <400> 6 tttggcagca ggagaagttt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FEND1R primer <400> 7 gctgtccgtt ctgctttttc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITUD1F primer <400> 8 gatgcgatct ggttggatgt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITUD1R primer <400> 9 atcgtcatgt gctgcttgag 20 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SUR3F primer <400> 10 acagtatgga ggcatggtc 19 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SUR3R primer <400> 11 ttccgccact ttttcagttt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZWITF2 primer <400> 12 ttgggagaat atacagctct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZWITR1 primer <400> 13 gaccttttga aatgggcgta 20 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SPB16_F primer <400> 14 gtgagaggca aaaaggta 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SPB16_R primer <400> 15 ctgagctgcc gcctgtac 18

Claims (15)

Bacillus bellenosis strain comprising a gyrB gene consisting of the nucleotide sequence of SEQ ID NO: 1, has an antimicrobial activity to Ilyonectria mors-panacis , and deposited with the accession number KFCC11778P. The strain of claim 1, wherein the strain further has antibacterial activity against a pathogen causing ginseng root rot. The pathogen causing the ginseng root rot is phytophthora cactorum , Fusarium solani , Alternaria panax , Botrytis sp. sp.), Rhizoctonia sp., and Colletotrichum panacicola is one or more selected from the group consisting of. The strain of claim 1, wherein the strain synthesizes and secretes anti-ribosomal lipid peptides (nonribosomal lipopeptide). The strain according to claim 4, wherein the ribosome-free lipid peptide is one or more selected from the group consisting of Iturin A and sulfactin. The strain of claim 1, wherein the strain has nematicidal activity. The strain of claim 1, wherein the strain secretes protease. delete A microbial agent for controlling ginseng root rot disease, comprising the Bacillus bellensis strain of any one of claims 1 to 7, a culture solution thereof, a supernatant of the culture solution, or a mixture thereof as an active ingredient. The microorganism preparation of claim 9, wherein the microbial preparation is a liquid or hydrated preparation. The microbial preparation of claim 9, wherein the number of microorganisms included in the microbial preparation is 1 X 10 ⁸ to 1 X 10 ¹² cfu / g. 10. The method of claim 9, wherein the culture medium is Bacillus Velensis strain LB (Luria Bertani), KB (King's medium B) medium, PDA medium (Potato Dextrose Agar), NB (nutrient broth) medium, BHI (brain heart) An agent for controlling ginseng root rot disease, which is obtained by culturing in at least one medium selected from the group consisting of infusion medium, TSB (Tryptic Soy Broth), and TSA (Tryptic soy agar) medium. The method of claim 9, wherein the ginseng root rot disease control microbial agent
The control value calculated by the following formula (1) is 50 to 100%, ginseng root rot disease control formulation.
[Equation 1]
% Control = {(Non-Treatment-Treatment-Incidence) / Non-Treatment Incidence} X 100 A method for controlling ginseng root rot, comprising applying the microbial agent for controlling ginseng root rot of claim 9 to at least one crop selected from the group consisting of ginseng and plant-cultivated crops. The method of claim 14,
The applying step is performed by spraying or immersing the microbial agent to the root or the soil close to the ginseng, ginseng root rot control method.

Images