KR101790664B1 - Tomato viruses specific primer sets and method for detecting said viruses using the same - Google Patents

Tomato viruses specific primer sets and method for detecting said viruses using the same Download PDF

Info

Publication number
KR101790664B1
KR101790664B1 KR1020150141597A KR20150141597A KR101790664B1 KR 101790664 B1 KR101790664 B1 KR 101790664B1 KR 1020150141597 A KR1020150141597 A KR 1020150141597A KR 20150141597 A KR20150141597 A KR 20150141597A KR 101790664 B1 KR101790664 B1 KR 101790664B1
Authority
KR
South Korea
Prior art keywords
seq
tomato
primer
primer set
virus
Prior art date
Application number
KR1020150141597A
Other languages
Korean (ko)
Other versions
KR20170042096A (en
Inventor
김정수
신유주
신준성
한정헌
Original Assignee
안동대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 안동대학교 산학협력단 filed Critical 안동대학교 산학협력단
Priority to KR1020150141597A priority Critical patent/KR101790664B1/en
Publication of KR20170042096A publication Critical patent/KR20170042096A/en
Application granted granted Critical
Publication of KR101790664B1 publication Critical patent/KR101790664B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

(Tomato chlorosis virus), Tomato spotted wilt virus (TSWV), PepMoV (Pepper virus) viruses, and the like. In particular, the present invention relates to a tomato virus specific primer set, ), CMV (cucumber mosaic virus), ToMV (tomato mosaic virus), TBSV (Tomato bushy stunt virus), or TyLCV (tomato yellow leaf curl bigeminivirus) and a specific detection method using the primer set Using combinations of primers specific to PepMoV, CMV, TSWV, TBSV, TyLCV, ToCV or ToMV, which infect tomatoes, minimizes the nonspecific amplification products and improves the accuracy of each virus diagnosis It has excellent effect.

Description

Tomato virus-specific primer sets and methods for detecting tomato viruses using the same [

(Tomato chlorosis virus), Tomato spotted wilt virus (TSWV), PepMoV (Pepper virus) viruses, and the like. In particular, the present invention relates to a tomato virus specific primer set, ), CMV (Cucumber mosaic virus), ToMV (Tomato mosaic virus), TBSV (Tomato bushy stunt virus) or TycoV (Tomato yellow leaf curl bigeminivirus) and specific detection methods using the primer sets will be.

Toxic viruses such as ToCV, TSWV, PepMoV, CMV, ToMV, TBSV and ToMV have been identified in tomatoes in more than 100 species, including ToCV, CMV and TyLCV. It is known as TyLCV. When infected by such viruses, damage to crops such as reduction in the yield of the tomatoes and deterioration of the quality of the commodities are caused, which causes economic damage to the farms.

ToCV is a ssRNA virus belonging to Closterviridae and Crinivirus genus. ToCV is a compound infection with TyLCV, which may continue to be a problem. Symptoms caused by PepMoV appear as yellow mosaic and gangrene in the leaves and necrotic symptoms in the stems. Symptoms caused by CMV are small on the leaves, many yellow spots and mosaic, sometimes accompanied by atrophy and deformity. Symptoms caused by ToMV are mosaic in the leaves and streaks in the stems, and necrotic spots on the surface of the fruit. TyLCV is a circular DNA virus belonging to the genus Geminiviridae and Begonovirus, and was first detected in Korea in 2008 in Tongyeong, Gyeongsangnam-do. TyLCV is one of the most damaging viruses in tomato crops in Korea. The hosts of TyLCV in its natural state are tomato, red pepper, and chickpea. TyLCV is a persistent infection caused by Bemisia tabaci but not juice or seed transmission.

In the past, electron microscopy and serologic methods (ELISA) were mainly used for virus diagnosis. Electron microscopy can detect the presence of the virus, but it is impossible to diagnose it as a morphological feature. Among the serologic methods, the ELISA method has a detection sensitivity about 1000 times lower than that of the most commonly used diagnostic method or the Fisher method, and often fails to diagnose due to the unexpected nonspecific reaction of the antibody and the test sample.

Currently, RT-PCR method, which has high detection sensitivity and convenience, is most commonly used for diagnosis of RNA viruses. The reverse-PCR (RT-PCR) method, which is often used for the precise diagnosis of plant viruses, determines the specificity and precision of the diagnostic primer used. Therefore, the development of species specific primers is most important Do. Until now, the primers used for the diagnosis of plant viruses have been designed based on only the specific gene sequence of the virus to be amplified, without considering the genome sequence of the plant to be assayed, and produce a nonspecific amplification product by the nucleic acid of the plant or another virus There have been many cases of inadequate reading of results. Therefore, for accurate diagnosis, not only must the virus-detecting primer work specifically for each virus, but also the nonspecific amplification products derived from the plant genome should be minimized.

On the other hand, in connection with primers for detecting pathogenic viruses on plants, Korean Patent No. 10-1382-8500000 discloses a primer set for detecting viruses on bacillus plants, and Korean Patent No. 10-1301-8650000 Discloses a set of primers for detecting viruses that infect stem and crop seeds.

A primer set capable of specifically detecting tomato viruses ToCV, TSWV, PepMoV, CMV, ToMV, TBSV, and TyLCV and a detection method using the primer set have not been known and it has been difficult to detect and diagnose the virus. In addition, when a primer is prepared based on only the nucleotide sequence of a virus, nonspecific amplification products are generated depending on the primers or target plants used, making it difficult to accurately detect and diagnose.

Thus, in the present invention, there is no region that is specific to tomato viruses and homologous to the entire base sequence of tomatoes, so that a primer set for the purpose of preventing nonspecific amplification products when detecting each of the seven viruses in tomatoes , The seven viral genomic sequences of the tomato viruses ToCV, TSWV, PepMoV, CMV, ToMV, TBSV and TyLCV are specific to each other and are homologous to the tomato full-length genomic sequence, tomato EST, and plant virus genome sequence (PVS) , So that a primer specific to each of the seven viruses was prepared and a detection method optimized for the detection of each virus was provided.

Using primers sets (combinations) specific to ToCV, TSWV, PepMoV, CMV, ToMV, TBSV and TyLCV, the viruses that infect tomatoes of the present invention minimizes nonspecific amplification products and optimizes RT- Therefore, there is an excellent effect that the accuracy of each virus diagnosis improves.

FIG. 1 is a schematic diagram showing standard virus isolate information and primer analysis procedures.
Figure 2 compares RT-PCR amplification patterns of candidate primer combinations for ToCV diagnosis without template.
Figure 3 compares amplification patterns of candidate primer combinations for ToCV diagnosis using healthy tomato RNA and tomato RNA infected with ToCV.
Figure 4 compares RT-PCR amplification patterns with three primer combinations for ToCV assays in the absence of template.
Figure 5 compares RT-PCR amplification patterns of three primer combinations for ToCV assays using healthy tomato RNA as a template.
Figure 6 compares the RT-PCR band amplification patterns using the PepMoV diagnostic primer combination:
M: 100bp ladder.
Figure 7 compares the RT-PCR band amplification patterns of the PepMoV diagnostic primer combinations (non-specific primer-free primer combinations)
M: 100bp ladder.
Figure 8 compares the RT-PCR band amplification patterns of PeMoV diagnostic primer combinations in healthy and untreated tomato RNA-based treatments:
M: 100bp ladder.
Figure 9 compares the PCR band amplification patterns of RT-PCR of a CMV diagnostic primer combination:
M: 100bp ladder.
FIG. 10 is a diagram showing PCR band amplification patterns of CMV diagnostic primer combinations in healthy and untreated tomato RNA-based treatments:
M: 100bp ladder.
Figure 11 shows the RT-PCR band amplification pattern of the ToMV diagnostic primer combination:
M: 100bp ladder.
FIG. 12 is a diagram for confirming the non-singular band amplification pattern according to the RT temperature change:
M: 100bp ladder.
FIG. 13 is a chart for confirming the non-singular band amplification pattern according to the change of RT time:
M: 100bp ladder.
FIG. 14 is a chart for confirming the non-singular band amplification pattern according to the change in the primer concentration.
FIG. 15 is a graph showing optimum conditions for RT-PCR and PCR kit for tomato viruses.
Fig. 16 is a diagram showing the detection sensitivity and specificity of a CMV diagnostic primer combination:
M: 100bp ladder
Lane 1: purified RNA (100 ng / l);
Lane 2 to 7: RNA obtained by serially diluting lane 1 purified RNA with DEPC-water 10-fold;
Left: healthy tomato; And
Right: Tomato Tomato.
Fig. 17 shows the detection sensitivity and specificity of the TSWV diagnostic primer combination. Fig.
M: 100bp ladder
Lane 1: purified RNA (100 ng / l);
Lane 2 to 7: RNA obtained by serially diluting lane 1 purified RNA with DEPC-water 10-fold;
Left: healthy tomato; And
Right: Tomato Tomato.
Figure 18 shows the detection sensitivity and specificity of the TBSV diagnostic primer combination:
M: 100bp ladder
Lane 1: purified RNA (100 ng / l);
Lane 2 to 7: RNA obtained by serially diluting lane 1 purified RNA with DEPC-water 10-fold;
Left: healthy tomato; And
Right: Tomato Tomato.
Fig. 19 shows the detection sensitivity and specificity of the TyLCV diagnostic primer combination. Fig.
M: 100bp ladder
Lane 1: purified RNA (100 ng / l);
Lane 2 to 7: RNA obtained by serially diluting lane 1 purified RNA with DEPC-water 10-fold;
Left: healthy tomato; And
Right: Tomato Tomato.
Figure 20 shows the detection sensitivity and specificity of the PepMoV diagnostic primer combination:
M: 100bp ladder
Lane 1: purified RNA (100 ng / l);
Lane 2 to 7: RNA obtained by serially diluting lane 1 purified RNA with DEPC-water 10-fold;
Left: healthy tomato; And
Right: Tomato Tomato.
Fig. 21 is a chart for confirming the detection sensitivity and specificity of the ToMV diagnostic primer combination:
M: 100bp ladder
Lane 1: purified RNA (100 ng / l);
Lane 2 to 7: RNA obtained by serially diluting lane 1 purified RNA with DEPC-water 10-fold;
Left: healthy tomato; And
Right: Tomato Tomato.
FIG. 22 is a chart for confirming detection sensitivity and specificity of the ToCV diagnostic primer combination:
M: 100bp ladder
Lane 1: purified RNA (100 ng / l);
Lane 2 to 7: RNA obtained by serially diluting lane 1 purified RNA with DEPC-water 10-fold;
Left: healthy tomato; And
Right: Tomato Tomato.

Hereinafter, the present invention will be described in detail. However, it should be understood that the present invention may be embodied in many other specific forms without departing from the spirit or essential characteristics thereof.

In one aspect, the present invention provides a primer set for detecting tomato viruses.

In one embodiment, the tomato viruses are selected from the group consisting of Tomato chlorosis virus (TOCV), Tomato spotted wilt virus (TSWV), Peppermot virus (PepMoV), cucumber mosaic virus (CMV), tomato mosaic virus (ToMV), Tomato bushy stunt virus and tomato yellow leaf curl bigeminivirus (TyLCV).

In one embodiment, the primer set comprises a primer set of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set of SEQ ID NO: 5 and SEQ ID NO: 6, A primer set of SEQ ID NO: 9 and SEQ ID NO: 10, a primer set of SEQ ID NO: 11 and SEQ ID NO: 12, and a set of primers of SEQ ID NO: 13 and SEQ ID NO: 14 , Specifically the tomato virus specific primers are as follows:

Primer C032 / 348 for ToCV detection: primer set of SEQ ID NOS: 1 and 2;

Primers for TSWV detection C074 / 673: Primer sets of SEQ ID NOS: 3 and 4;

Primer set for PepMoV detection C048 / 461: Primer set of SEQ ID NOs: 5 and 6;

Primer set C070 / 876 for CMV detection: primer set of SEQ ID NOS: 7 and 8;

A primer set for ToMV detection C065 / 824: a primer set of SEQ ID NOs: 9 and 10;

TBSV detection primer set AF2C / 401: primer set of SEQ ID NOS: 11 and 12; And

Primer set for TyLCV detection C028 / 1,100: Primer set of SEQ ID NOS: 13 and 14.

In the present invention, the name of the primer is represented by the primer combination number / size of the expected amplification product (bp).

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

In one aspect, the present invention provides a composition for detecting tomato virus comprising a primer set for detecting tomato virus.

In one embodiment, the tomato virus may be any one or more selected from the group consisting of ToCV, TSWV, PepMoV, CMV, ToMV, TBSV and TyLCV.

In one embodiment, the primer set comprises a primer set of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set of SEQ ID NO: 5 and SEQ ID NO: 6, A primer set of SEQ ID NO: 9 and SEQ ID NO: 10, a primer set of SEQ ID NO: 11 and SEQ ID NO: 12, and a set of primers of SEQ ID NO: 13 and SEQ ID NO: 14 .

In one aspect, the present invention provides a method of producing RNA comprising: 1) extracting RNA from tomatoes; 2) RT-PCR or PCR is performed using the above-described RNA as a template and a primer set for detecting tomato virus of the present invention; 3) RT-PCR or PCR amplification products are identified to determine whether tomatoes are infected with viruses.

In one embodiment, the temperature of the reverse transcription of RT-PCR may be between 45 ° C and 56 ° C, with 48 ° C being most preferred, but not limited thereto.

In one embodiment, the amplification time of the reverse transcription of RT-PCR may be less than 10 minutes, with less than 5 minutes being more preferred, but not limited thereto.

In one embodiment, the RT-PCR or PCR method is preferably a hotstart method in which the activity of the Taq-polymerase is inhibited by using an antibody and the polymerase is reactivated by heating at 95 ° C for 5 minutes. It is not limited.

In one embodiment, the Tm value of the primers for detecting tomato viruses of the present invention can be 55 ° C to 65 ° C, with 60 ° C being most preferred, but not limited thereto. The concentration of the primer may be less than 1.0 ng / μl, more preferably 0.5 ng / μl, but is not limited thereto.

The amplified product (amplified target sequence) may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be a fluorescent, phosphorescent, or radioactive material, including, but not limited to, Cy-5 or Cy-3, -Terminal Cy-5 or Cy-3 is labeled and amplification is carried out, the target sequence may be labeled with a detectable fluorescent labeling substance. When radioactive isotopes such as 32 P or 35 S are added to the amplification reaction solution, amplification products may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The primer set used to amplify the target sequence is as described above.

The detection of the amplification product can be performed by DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In the fluorescence measurement method, when Cy-5 or Cy-3 is labeled at the 5'-end of the primer and amplification is performed, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In the radioactive measurement method, a radioactive isotope such as 32 P or 35 S is added to the amplification reaction solution to amplify the product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation The radioactivity can be measured using a liquid scintillation counter.

In addition, in one aspect, the present invention provides a tomato virus diagnostic kit comprising the composition for detecting tomato virus according to the present invention.

In addition to the composition for detecting tomato virus of the present invention, the above kit may further include identification elements for identifying components of a known variety or a component necessary for performing electrophoresis in order to confirm amplification of a PCR product, in addition to the kit of the present invention.

The present invention will be described in more detail with reference to the following examples. However, the following examples are only for the purpose of illustrating the present invention, and thus the present invention is not limited thereto.

[Example]

1. Species of seven tomato viruses primer  design

Homology analysis of viral genomic sequences, tomato full-length genomic sequences, tomato EST, and all plant virus genome sequence data (PVS data) registered with the NCBI until September 2014 led to the identification of seven virus-specific sequences Were selected. Thereafter, the primer was designed to have a Tm value of 60 ° C using the Primer3 program, and the sequences entered into the primer and the PVS data through a search of the homology between the designed primer sequence and the PVS data revealed that 65 primer combinations (Fig. 1).

2. Virus-specific through specificity and detection sensitivity primer  Selection

To determine the primer combinations suitable for the production of tomato virus specific diagnostic kits, non - specific band amplification (specificity) and detectable maximum dilution limit (detection sensitivity) were compared. Materials and PCR conditions used in the specific experiments are shown in Tables 1 and 2 below.

Materials and Conditions Way DEPC-water Purchase Bio-World Products Healthy tomato RNA BCS RNA purification kit was used to isolate from the tomato and gem tomatoes. Diseased Tomato RNA ToCV, TBSV are naturally infected tomatoes, and the remaining viruses are isolated by artificial inoculation using the same kit for goksu and gem tomatoes Healthy tomato DNA BCS DNA purification kit was used to isolate the germline from the gem tomato. Disease tomato DNA Isolation from tomatoes naturally infected with the same kit How to perform RT-PCR A hotstart method in which the activity of Taq-polymerase is inhibited by using an antibody and the polymerase is reactivated by heating at 95 ° C for 5 minutes

Materials and Conditions Way Nano-drop spectrophotometer RNA and DNA concentrations were measured, and the concentration of the material was adjusted to 100 ng / μl to 600 ng / RT-PCR conditions (95 ° C / 1 min, 60 ° C / 1 min, 72 ° C / 1 min) at a temperature of 42 ° C / 20 min and PCR amplification at 95 ° C / PCR conditions (95 ° C / 1 min, 60 ° C / 1 min, 72 ° C / 1 min) after 95 ° C /

2-1. ToCV  Detection specific primer  Selection

High specificity primer  Selection

(Left to right 51.0, 52.2, 53.9, 56.0, 58.5, 60.7 and 62.4 ° C) with a Tm value gradient of 51 to 63.8 ° C with water alone without a template to obtain amplification patterns and nonspecific bands Was observed.

As a result, nonspecific amplification products were generated depending on the combination of primers, which was judged to be a reaction occurring between the plasmid DNA and the primer combination contained in RT-PCR or PCR premix (FIG. 2).

ToCV  Detection specific primer  Selection

Using the primer combinations C029 / 281, C030 / 198, C032 / 348, C041 / 527 and C044 / 518 (combination of red color in FIG. 2), which were judged to have relatively high specificity in the above example, The amplification pattern was further investigated using infected tomato RNA as a template.

As a result, in the case of C030 primer combination, a primer combination in which a nonspecific amplification product appeared in healthy tomato RNA was observed, such as competition between non-specific amplification product and target amplification product, (C029 / 281, C032 / 348, and C041 / 527) were firstly screened with a combination of three primers having high specificity (Fig. 3). These results suggest that primer combinations used for diagnosis and RT-PCR conditions are very important parameters.

ToCV  Specific Primer Non-specific  Confirm amplification

Amplification patterns were examined using the above-mentioned three primer combinations C029 / 281, C032 / 348 and C041 / 527 having high specificity. Specifically, RT-PCR of the primer without the template was carried out to confirm the production of non-specific amplification products.

As a result, the results were generally good (Fig. 4).

ToCV  Identification of detection specificity

RT-PCR was performed using a template of the healthy tomato, and as a result, there was almost no nonspecific amplification in the C032 primer combination (FIG. 5).

Based on the above results, the C032 primer combination was secondarily selected for ToCV diagnosis.

2-2. PepMoV  Detection specific primer  Selection

High specificity primer  Selection

As in Example 2-1, RT-PCR was performed at a Tm value gradient of 51 to 62.4 ° C (51.0, 52.2, 53.9, 56.0, 58.5 (from left to right) without nonspecific amplification according to 18 primer combinations , 60.7 and 62.4 占 폚).

As a result, it was possible to observe combinations (for example, primer C049) in which nonspecific amplification products were generated among the primer combinations (FIG. 6), but the C048, C054 and C055 primer combinations did not generate nonspecific amplification products (Fig. 7). Therefore, primer combinations of C048, C054 and C055 primers were firstly selected for PepMoV diagnosis.

PepMoV  Identification of detection specificity

RT-PCR (lanes 1 to 7: Tm value gradients 51.0, 52.2, 53.9, 56.0, 58.5, 60.7 and 62.4) were performed with the three primer combination C048, C054 and C055 primers selected above from the total RNA of this tomato. Lt; 0 > C).

As a result, the C048 primer combination showed the highest specificity and was finally selected (Fig. 8).

2-3. CMV  Detection specific primer  Selection

High specificity primer  Selection

The specificity of RT-PCR was confirmed with five sets of primers (lanes 1 to 7: Tm value slices 51.0, 52.2, 53.9, 56.0, 58.5, 60.7 and 62.4 ° C) / 876 and C71 / 959 primers were able to detect CMV most specifically (Fig. 9). Thus, the two primer combinations were firstly selected.

CMV  Identification of detection specificity

RT-PCR (lane 1 to 7: Tm value gradients 51.0, 52.2, 53.9, 56.0, 58.5, 60.7 (cf.) were used as primers for C70 / 876 and C71 / And 62.4 < 0 > C), the C070 primer combination was more specific than the C071 primer combination (Fig. 10).

2-4. ToMV  Detection specific primer  Selection

High specificity primer  Selection

As in Example 2-1, RT-PCR specificity was confirmed by using only three sets of ToMV-specific primer sets without a template (Tm value gradient: 51.0, 52.2, 53.9, 56.0, 58.5, 60.7 And 62.4 [deg.] C), no combination of producing a nonspecific amplification product was observed, and in particular, the C065 combination did not generate a nonspecific amplification product around the primer Tm value, and the C065 primer combination was selected for ToMV diagnosis (Fig. 11) .

3. PCR / RT- PCR  Establish condition

Reverse transcription (RT) temperature

In order to optimize the reverse transcription reaction conditions, which are considered to have the greatest influence on the diagnostic conditions in addition to the primer selected in Example 2, the temperature and time of the reverse transcription reaction, the Tm value and the primer using the ToCV diagnostic C041 primer combination among the selected primers Specificity and detection sensitivity were investigated by concentration. In this case, in order to lower the influence by the primer specificity, a C041 primer combination, which is a combination of primers having a low specificity, was used instead of the ToCV-specific primer C032 selected in Example 2 above. Specifically, non-specific band amplification patterns were confirmed by RT-temperature change (42 ° C, 45 ° C, 48 ° C, 51 ° C, or 56 ° C) with the C041 primer combination for ToCV diagnosis and the RT- (Tm value gradients: 51.0, 52.2, 53.9, 56.0, 58.5, 60.7 and 62.4 ° C).

As a result, the amplification pattern of the non-specific band was slightly different according to the temperature change, and particularly, the non-specific reaction was severe at 42 ° C (FIG. 12).

Reverse transcription  Reaction (Amplification) Time

The amplification types according to the RT reaction amplification times (5 min, 10 min, 15 min and 20 min) were further investigated (Tm value gradient: 51.0, 52.2 , 53.9, 56.0, 58.5, 60.7 and 62.4 [deg.] C).

As a result, as the reverse transcription reaction time was longer, the amount of non-specific amplification product was increased, and it was judged that 5 minutes was suitable as the reverse transcription reaction time (FIG. 13).

primer  density

(0.5 μl, 1.0 μl, 1.5 μl, 2 μl or 3 μl) using the healthy tomato RNA (R60) and the ToCV-infected tomato RNA (R52) (Tm value gradients: 51.0, 52.2, 53.9, 56.0, 58.5, 60.7 and 62.4 ° C).

As a result, nonspecific amplification products tended to increase as the primer concentration increased, and no significant change was observed in the amount of amplification of the target product (FIG. 14).

The most important factor affecting the specificity of the RT-PCR reaction was the temperature and time of the reverse transcription reaction, and the Tm value indicates that the specificity of the selected primer was high It can be applied within a relatively wide range. Therefore, the RT-PCR optimal reverse transcription reaction temperature and time for ToCV detection were 48 ° C and 5 minutes. The Tm value was 60 ° C and the primer concentration was 0.5ng / μl. The PCR reaction conditions were 35 times (95 ° C / 1 min, 60 ° C / 1 min, 72 ° C / 1 min).

RT-PCR was performed on other viruses under the above-mentioned optimization conditions. As in the case of ToCV, the RT-PCR / PCR optimum conditions for the preparation of a kit with high specificity and detection sensitivity (Fig. 15).

4. Virus-specific Primers  Detection sensitivity check

4-1. CMV  Detection sensitivity check

The specificity and detection sensitivity of each primer combination were investigated under the optimal conditions for the RT-PCR and PCR kit of the above Example 3. For this, RT-PCR was performed using 100 ng / RNA of RNA from healthy or CMV-infected tomatoes and RNA samples obtained by serial dilution with DEPC-water 10 times as a template, using the primer combination C070 and C071DMF selected in the above example.

As a result, CMV was found to have lower detection sensitivity than C071 primer combination, considering that the Tm value of the primer in the healthy RNA treatment was 60 ° C. However, the C070 primer combination showed higher specificity than the C071 primer combination, (Figure 16). ≪ RTI ID = 0.0 > C070 < / RTI >

4-2. TSWV  Detection sensitivity check

In order to select the optimal primer combination suitable for diagnosis in the three primer combinations selected first, 100 ng / ㎕ of RNA of healthy or TSWV-infected tomato under optimal conditions for the RT-PCR and PCR diagnostic kit production described in Example 3 . The specificity and detection sensitivity of each primer combination were investigated using RNA samples which were serially diluted 10-fold with DEPC-water as a template.

As a result, it was judged that the combination of C074 primer was most suitable for kit production for TSWV detection (Fig. 17).

4-3. TBSV  Detection sensitivity check

In the case of TBSV, three primer combinations were firstly selected, but it was judged that there was no suitable primer in the final test, and a new primer combination was designed. Under the optimal condition for the RT-PCR and PCR diagnostic kit production confirmed in Example 3 100 ng / ㎕ of RNA from healthy or TBSV-infected tomatoes and RNA samples obtained by serial dilution with DEPC-water 10 times were used as a template to investigate the specificity and detection sensitivity of each primer combination.

As a result, it was confirmed that the TBSV diagnostic primer combination AF2C can specifically detect TBSV-infected tomato (FIG. 18).

4-4. TyLCV  Detection sensitivity check

TyLCV also confirmed the specificity and detection sensitivity of the primer combinations in the same manner as other viruses, indicating that the C028 primer combination is most suitable for detection and diagnosis of TyLCV-infected tomato (FIG. 19).

4-5. PepMoV  Detection sensitivity check

As a result of confirming the specificity and detection sensitivity of the C048 primer combination for PepMoV diagnosis by the above method, it was found that tomatoes infected with PepMoV could be detected specifically (FIG. 20).

4-6. ToMV  Detection sensitivity check

As a result of confirming the specificity and detection sensitivity of the C065 primer combination for ToMV diagnosis as described above, it was found that tomatoes infected with ToMV could be specifically detected (Fig. 21).

4-7. ToCV  Detection sensitivity check

As a result of confirming the specificity and detection sensitivity of the C032 primer combination for ToCV diagnosis as described above, it was found that tomatoes infected with ToCV could be specifically detected (Fig. 22).

According to the above results, the combination of ToCV C032 / 348, TSWV C074 / 673, PepMoV C048 / 461, CMV C070 / 876, ToMV C065 / 824, TBSV AF2C / 401 and TyLCV C028 / (Table 3). ≪ tb > < TABLE > Thus, primer combination and RT-PCR conditions specific for each virus detection and diagnosis and having good detection sensitivity were finally established.

Virus Name of primer combination  5 '- > 3' SEQ ID NO: ToCV C032 Foward TATGTGTCAGGCCATTGTAA One Reverse TTCATAAGCAGGTTCGAGAT 2 TSWV C074 Foward GACAGCCTGGAACATAAAAG 3 Reverse GAAAATGTGGAACACAAGGT 4 PepMoV C048 Foward TGTTCACTAGGCTCAGGAGT 5 Reverse GACGACCCAAACACACTATT 6 CMV C070 Foward ACATCAATGAATTGGTAGCC 7 Reverse CTCGGTACGAATAAGTCTGG 8 ToMV C065 Foward TTCACACAGTCTGACAAGGA 9 Reverse GGAAGATCCACAAAATCAAA 10 TBSV AF2C Foward CTTCCTGACGAAAGTCCGAG 11 Reverse TCAGTACCTTCAGGGCATCC 12 TyLCV C028 Foward CTACACGCTTACGCCTTATT 13 Reverse ACACCGATTCATTTCAACAT 14

<110> andong national university industry-Academic cooperation foundation <120> Tomato viruses specific primer sets and method for detecting said          viruses using the same <130> IPDC55944 <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ToCV C032 foward primer <400> 1 tatgtgtcag gccattgtaa 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ToCV C032 reverse primer <400> 2 ttcataagca ggttcgagat 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TSWV C074 foward primer <400> 3 gacagcctgg aacataaaag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TSWV reverse primer <400> 4 gaaaatgtgg aacacaaggt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PepMoV C048 foward primer <400> 5 tgttcactag gctcaggagt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PepMoV C048 reverse primer <400> 6 gacgacccaa acacactatt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMV C070 foward primer <400> 7 acatcaatga attggtagcc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CMV C070 reverse primer <400> 8 ctcggtacga ataagtctgg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ToMV C065 foward primer <400> 9 ttcacacagt ctgacaagga 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ToMV C065 reverse primer <400> 10 ggaagatcca caaaatcaaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TBSV AF2C foward primer <400> 11 cttcctgacg aaagtccgag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TBSV AF2C reverse primer <400> 12 tcagtacctt cagggcatcc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TyLCV C028 foward primer <400> 13 ctacacgctt acgccttatt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TyLCV C028 reverse primer <400> 14 acaccgattc atttcaacat 20

Claims (7)

A primer set consisting of the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4,
A primer set consisting of the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6,
A primer set consisting of the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8,
A primer set consisting of the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10,
A primer set consisting of the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12, and
A primer set consisting of the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14,
The primer set of SEQ ID NO: 3 and SEQ ID NO: 4 is a primer set for Tomato spotted wilt virus (TSWV) detection,
The primer set of SEQ ID NO: 5 and SEQ ID NO: 6 is a primer set for PepMoV (Pepper mottle virus) detection,
The primer set of SEQ ID NO: 7 and SEQ ID NO: 8 is a primer set for CMV (cucumber mosaic virus) detection,
The primer set of SEQ ID NO: 9 and SEQ ID NO: 10 is a primer set for ToMV (tomato mosaic virus) detection,
The primer set of SEQ ID NO: 11 and SEQ ID NO: 12 is a primer set for detection of TBSV (Tomato bushy stunt virus)
Wherein the primer set of SEQ ID NO: 13 and SEQ ID NO: 14 is a primer set for TyroVL (tomato yellow leaf curl bigeminivirus) detection.
Primer set for detecting tomato viruses. delete delete A composition for detecting TSWV, PepMoV, CMV, ToMV, TBSV and TyLCV tomato viruses comprising all of the primer sets for detecting tomato viruses of claim 1. delete delete 1) extract RNA from tomatoes;
2) RT-PCR or PCR is carried out using all of the primers set for tomato virus detection according to the above 1 with the RNA as a template; And
3) A method for detecting TSWV, PepMoV, CMV, ToMV, TBSV and TyLCV tomato viruses, comprising determining RT-PCR or PCR amplification products to determine whether the tomatoes are infected with the virus.
KR1020150141597A 2015-10-08 2015-10-08 Tomato viruses specific primer sets and method for detecting said viruses using the same KR101790664B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020150141597A KR101790664B1 (en) 2015-10-08 2015-10-08 Tomato viruses specific primer sets and method for detecting said viruses using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150141597A KR101790664B1 (en) 2015-10-08 2015-10-08 Tomato viruses specific primer sets and method for detecting said viruses using the same

Publications (2)

Publication Number Publication Date
KR20170042096A KR20170042096A (en) 2017-04-18
KR101790664B1 true KR101790664B1 (en) 2017-10-27

Family

ID=58704103

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150141597A KR101790664B1 (en) 2015-10-08 2015-10-08 Tomato viruses specific primer sets and method for detecting said viruses using the same

Country Status (1)

Country Link
KR (1) KR101790664B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190053040A (en) * 2017-11-09 2019-05-17 대한민국(농촌진흥청장) Primer set for multiple detection tomato viruses, and method for detect multiple detection tomato viruses

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101546758B1 (en) * 2013-11-19 2015-08-24 대한민국 Primer set for multiple detection tomato viruses that transmitted by whiteflies, and method for detecting said viruses using the same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101546758B1 (en) * 2013-11-19 2015-08-24 대한민국 Primer set for multiple detection tomato viruses that transmitted by whiteflies, and method for detecting said viruses using the same

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190053040A (en) * 2017-11-09 2019-05-17 대한민국(농촌진흥청장) Primer set for multiple detection tomato viruses, and method for detect multiple detection tomato viruses
KR102114203B1 (en) * 2017-11-09 2020-05-22 대한민국 Primer set for multiple detection tomato viruses, and method for detect multiple detection tomato viruses

Also Published As

Publication number Publication date
KR20170042096A (en) 2017-04-18

Similar Documents

Publication Publication Date Title
KR20140039866A (en) Ssr primer sets for discrimination of oriental melon line or cultivar and uses thereof
KR101790664B1 (en) Tomato viruses specific primer sets and method for detecting said viruses using the same
KR101546758B1 (en) Primer set for multiple detection tomato viruses that transmitted by whiteflies, and method for detecting said viruses using the same
KR101678851B1 (en) Primer set for diagnosing or detecting Plantain mottle virus and uses thereof
KR101314168B1 (en) Method for developing gene specific molecular markers for discriminatinig soybean cultivars
KR102335806B1 (en) Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba &#39;SanJo&#39; cultivar and uses thereof
KR101766274B1 (en) A method for identifying blueberry varieties using microsatellites markers
CN108977570B (en) Method for identifying 28 good carrot varieties and special primer set thereof
KR102226176B1 (en) Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same
CN111808992A (en) Hot pepper vein mottle virus polygene joint detection and identification method
KR102409004B1 (en) Specific primer set for detecting Eggplant mottled dwarf virus and uses thereof
KR102279791B1 (en) Specific primer set for detecting TEV and uses thereof
Hasiów-Jaroszewska et al. Genetic diversity of the Cucumber green mottle mosaic virus and the development of RT-LAMP assay for its detection.
KR102279783B1 (en) Specific primer set for detecting American plum line pattern virus and uses thereof
KR101651815B1 (en) Primer set for diagnosing White clover mosaic virus and uses thereof
KR102279798B1 (en) Specific primer set for detecting Rice yellow mottle virus and uses thereof
KR20150050062A (en) Specific primers for detection of greenhouse whitefly and uses thereof
KR102421262B1 (en) Specific primer set for detecting Potato yellow dwarf virus and uses thereof
KR101479664B1 (en) Primer set for diagnosing Andean potato mottle virus and uses thereof
KR102119749B1 (en) Primer set for discrimination of Apple Chlorotic Leaf Spot Virus variant and uses thereof
KR102279787B1 (en) Specific primer set for detecting ChiVMV and uses thereof
KR102421257B1 (en) Specific primer set for detecting Lettuce big-vein associated virus and uses thereof
KR102279779B1 (en) Specific primer set for detecting Alstroemeria mosaic virus and uses thereof
KR101651812B1 (en) Primer set for diagnosing Pelargonium zonate spot virus and uses thereof
KR101457980B1 (en) Primer set for diagnosing Carnation ringspot virus and uses thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant