KR101777555B1 - Distilled liquor using Saccharomyces cerevisiae N9 and method for preparation thereof - Google Patents

Abstract

The present invention relates to the use of Sacharomyces The present invention relates to a distillable soju using N9 (KACC93234P) and a method for producing the same, and a novel strain of Saccharomyces cerevisiae N9 is isolated from Korean yeast, and the strain has a high acid resistance and alcohol resistance, And that the distillable soju produced by using the distillable soju has a different flavor from that of the conventional Japanese soju, the distillable soju using the above-mentioned Saccharomyces cerevisiae strain N9 and the preparation method thereof can be produced by using a proprietary distillable soju And can be usefully used for manufacturing.

Description

(Distilled liquor using Saccharomyces cerevisiae N9 and method for preparation thereof)

The present invention relates to a novel strain Saccharomyces cerevisiae N9 deposited with a deposit number (KACC93234P), a method for producing the same, a method for producing the same, a method for producing the same, will be.

Along with economic growth, consumer demand has diversified and tariff elimination and deregulation by the Free Trade Agreement have combined, mainstream imports have increased significantly from 10.2 thousand kL in 2009 to 12.5 thousand kL in 2011 and 17.3 thousand kL in 2013 . The amount of imports increased to 384, 470, 522 million dollars in the same year, and the share of spirits remained high at 58, 55 and 45%, respectively. This is because, after the opening of the mainstream import in 1991, the famous spirits market has been occupied by famous foreign whiskeys, Cognacs, and brandy companies, and since then, domestic mainstream companies have not been competitive. In 2012, domestic liquor production combined with whiskey and brandy is about 1 / 30th of 1.3 thousand kl. In recent years, imports of distillable soju have rapidly increased to 139.5 kL in 2013 compared with 83.2 kL in 2009, while popularity of Japanese oden bars has become popular. Since the distillation and distillation processes are variously changing, distillation and aging techniques are required in addition to fermentation.

The production method of Korean distillery shochu has been introduced in diverse literature from the period of Dongbokbo (1611) to Jibong (1613), food Dimibang (1670), and the main visit (end of 1600) to the mid 1800s. Since 1916, liquor production has been banned in main markets and restaurants, and as the breweries have been merged and dismantled, the yeast soju has disappeared. In 1965, the Grain Management Act was put into effect. After 1991, it became possible to produce distillable soju. However, domestic distillable soju, which has not been equipped with technology for 30 years, failed to meet consumers' expectation and showed a low consumption of 192 kL in 2012. As the society becomes more sophisticated, consumers will be exposed to more mainstream of the world. Therefore, without efforts to increase the competitiveness of liquor manufacturing, it is expected that the difficulties of the liquor and related industry will increase.

Aspergillus luchuensis and Aspergillus awamori , which have high citric acid production, have been used as the distillable soju. In the brandy production, Ugni with a total acidity of 0.8 ~ 1.0% blanc varieties have been used as raw materials. However, there are only two kinds of yeast for producing liquor in Korea, and it is difficult to manufacture soju because its resistance to acid is weak.

Korean Patent Laid-Open No. 10-2015-0055006 discloses a biosynthesis of an organic acid in a genetically modified microorganism as a prior art relating to a yeast for producing distillable soju, and Korean Patent No. 10-0708992 discloses a biosynthesis of a yeast new strain Saccharomyces The present inventors have disclosed a method for producing Saccharomyces cerevisiae KUBY-501 ( Saccharomyces cerevisiae KUBY-501) and a method for preparing bupivacaine using the same, and Hongmin et al. Disclose a gene capable of increasing alcohol tolerance in Saccharomyces cerevisiae However, the use of the new strain Saccharomyces cerevisiae N9 of the present invention and its distillative soju production has not been known to date.

Accordingly, the present inventors have made efforts to develop a yeast for producing distillable soju, and have succeeded in isolating Saccharomyces cerevisiae N9 (KACC93234P), a yeast strain from Korean nuruk, and found that the strain has strong acid tolerance and alcohol resistance And confirmed that it can be applied to the manufacture of soju, thereby completing the present invention.

An object of the present invention is three Levy jiae N9 (Sacharomyces MRS to novel saccharide deposited by deposition No. (KACC93234P) cerevisiae N9), a strain or a culture thereof, and a distillable soju using the same, and a process for producing the same.

In order to achieve the above object, the present invention relates to a novel Sacharomyces N9 deposited with accession number (KACC93234P) cerevisiae N9) strain.

In addition, the present invention provides a biocidal composition comprising the strain or a culture thereof.

The present invention also provides a method for producing a fermented soybean, comprising: 1) fermenting cereals using the strain of claim 1; And

2) distilling the fermented product of step 1).

The present invention also provides a distillable soju produced by the above process.

In the present invention, a novel Sacharomyces cerevisiae N9 (KACC93234P) was isolated from Korean yeast and cultured at a pH of 3.0. As a result, turbidity was 8.6 times higher than that of a conventional strain of Kagoshima (C4) , The total number of bacteria was 13 times higher, and the acid tolerance was strong. When cultured at pH 4.0 containing 2.5% of alcohol, the turbidity was 1.4 times and the total number of bacteria was 1.3 times higher than that of alcohol, And the fermentation period can be shortened. In addition, the distillable soju prepared by using the strain can be useful for the production of distilled soju having a different flavor from Japanese soju using the existing strain of C4 .

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram showing a molecular system diagram representing SIID 15224-02, 26S rDNA - D1 / D2 nucleotide sequences.
Figure 2 is a graphical representation of the results of the present invention of Sacharomyces < RTI ID = 0.0 > cerevisiae N9, N9) (reference: 10 μm).
Fig. 3 is a graph showing the time course of cultivation of Saccharomyces cerevisiae N9 and Kagoshima Japan (C4) of the present invention at pH 3.0.
FIG. 4 is a graph showing the time course of N9 and C4 over time at pH 4.0 containing 2.5% alcohol. FIG.
FIG. 5 is a graph showing the degree of sour fermentation according to the fermentation period of N9 and C4. FIG.

Hereinafter, the present invention will be described in detail.

The present invention provides a novel strain of Sacharomyces cerevisiae N9 deposited with Accession No. KACC93234P.

Preferably, the strain has a nucleotide sequence of 26s rDNA of SEQ ID NO: 1, can ferment melibiose, can not magnetize ethanol, does not proliferate at 40 ° C or more, contains 50% glucose and 10% It is preferable that it can grow at a NaCl concentration, and also has a characteristic that there is no vitamin requirement.

Preferably, the strain is cultured in a nutrient medium or MRS medium for 3 to 7 days at 20 to 50 ° C, and preferably cultured under aerobic conditions, but not limited thereto, culturing a conventional bacterium . ≪ / RTI >

In a specific embodiment of the present invention, the present inventors have found that a novel yeast strain isolated from Korean yeast is a strain of Saccharomyces cerevisiae And it was identified as Sacharomyces N9 S. cerevisiae N9) (see Fig. 1), and deposited the above strain on the depositary of the National Institute of Agricultural Biotechnology (Deposit No .: KACC93234P) on July 6, 2015.

In addition, in order to confirm the growth characteristics of the yeast strains, when a comparison was made between Kagoshima 4 (C4), a widely used yeast for Japanese shochu in Japan, and when it was proliferated at pH 3.0 corresponding to the first soju , And turbidity was 8.6 times higher and the total number of bacteria was 13 times higher than that of C4 (Japanese yeast) after 48 hours of culture (see FIGS. 3 and 3). In addition, the pH and the alcohol concentration of 2.5% alcohol, which corresponds to the second soaking of soju, showed a turbidity of 1.4 times and a total bacterial count of 1.3 times higher than that of Japanese yeast C4 after 48 hours of incubation. And the resistance was 1.3 times or more (see Fig. 4 and Table 4).

Therefore, it was confirmed that the strain of the present invention is a novel strain of Saccharomyces cerevisiae strain N9 (KACC93234P), which is characterized by strong acid resistance and alcohol resistance.

In addition, the present invention provides a biocidal composition comprising the strain or a culture thereof.

The biocide composition may further comprise conventional pharmaceutical carriers and excipients. The composition may be freeze-dried or heat-dried according to a conventional method for producing a biocidal composition, and may be in an encapsulated form or in a culture suspension or a dry powder form. .

The present invention also provides a method for producing a fermented soybean, comprising: 1) fermenting cereals using the strain of claim 1; And

2) distilling the fermented product of step 1).

In the above production method, the cereal in step 1) is preferably, but not limited to, rice, barley, wheat, or sweet potato.

The present invention also provides a distillable soju produced by the above process.

In a specific example of the present invention, in order to confirm the brewing characteristics of the yeast strain, the souring ability was confirmed. As a result, the fermentation on the 6th day when the first stage fermentation was terminated was 8.9% (See FIG. 5). As a result, it was found that the fermentation ability of the 1-stage fermentation was higher than that of C4, and the total bacterial count, alcohol concentration and volatile acid were higher The fermentation rate was faster than that of C4, and the alcohol content of the two - stage soaking was higher than that of C4, and the total sugar and reducing sugar contents were lower than that of C4. (Table 5 and Table 6). As a result, it was confirmed that the distilled water was used for the fermentation of alcohol and the distilled water was high.

As a result of sensory evaluation of three males and four females after the atmospheric distillation of the syrup produced by the above method using N9, the aroma of the distillation type rice soju prepared with N9 showed that the grain aroma It was confirmed that sweet flavor is strong, and some fruit flavor is also present, and it is possible to produce soju having flavor different from Japanese shochu (see Table 7).

Therefore, it was confirmed that distillable soju having a different flavor and aroma from conventional Japanese soju can be produced through the process of producing distilled soju using N9 yeast strain.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

< Example  1> Identification of yeast

The following experiment was carried out to confirm the strain strain of yeast isolated from Korean yeast.

Specifically, the isolated bacterium N9 was proliferated in a yeast-mold (YM) liquid medium, DNA was extracted, and NL1 primer (5'GCATATCAATAAGCGGAGGAAAAG3 ': SEQ ID NO: 2) and NL4 primer (5'GGTCCGTGTTTCAAGACGG3' ), And PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan). Subsequently, it was purified with ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems, CA, USA) and sequenced with ChromaPro l.5 (Technelysium Pty Ltd., Tewantin, Australia) program. The 26 rDNA-D1 / D2 nucleotide sequences of the isolates were screened for homology using Apollon DB-FU BLAST. As a result, a strain of the type strain Saccharomyces cerevisiae , ) NRRL Y-12632 (Accession No. U44806). In addition to Apollon DB-FU, the homology search results for the databases in GenBank / DDBJ / EMBL showed that the base sequence of the isolate was 100% homologous to a large number of databases registered as Saccharomyces cerevisiae Respectively. Based on the nucleotide sequence, the isolates were included in the clusters of the genus Saccharomyces and showed the same molecular phylogenetic position as that of Saccharomyces cerevisiae NRRL Y-12632. Thus, the isolate was named Sacharomyces cerevisiae N9 (KACC93234P) having 26S rDNA of SEQ ID NO: 1 described below (Fig. 1).

Sakaromisses Selivijia  N9 ( KACC93234P ) 26S rDNA  Base sequence

GCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTGAAACACGGACC (SEQ ID NO: 1)

In addition, as shown in Fig. 2, the isolate was in the form of smooth protuberance with no protrusions, glossiness, smooth surface, creamy white color (Fig. 2). One week after the initiation of culture in the YM plate medium, the nutrient cells changed from asphyx to egg-shaped long elliptical shape and were confirmed to multiply by multipotent embryo, confirming the morphological characteristics of typical saccharomyces cerevisiae. However, the formation of sexual reproductive organs did not appear in the reputation 1 to 2 months after the start of culture.

< Example  2> Physiological specificity of strain N9

The physiological characteristics of the N9 strain of the present invention isolated in Example 1 are shown in Table 1 below. The fermentation can be carried out by using glucose, galactose, maltose or sucrose in the saccharides, but the fermentation can not be performed with the disaccharide trehalose as the standard strain CBS 1171 (NRRL Y-12632). However, unlike the comparative strains ( ¹ Kurtzman et al., ² Barnett et al.), It was found that melibiose could be fermented. In addition to the fermentation sugar, methyl-glucoside including trehalose and raffiinose was able to be magnetized in the carbon source magnetism, whereas sugar alcohol such as inositol, galactitol, etc., It was not saccharified. In particular, unlike the comparative strains, ethanol had the property that it could not magnetize. The nitrogen source did not magnetize all the nitrogen sources from the nitrate to the cadaverine just like the standard strain. In addition, N9 could not grow above 40 ℃, and was resistant to cycloheximide, a protein synthesis inhibitor, but could grow at 50% glucose and 10% NaCl concentration. The physiological-biochemical characteristics were also very similar to the standard strain CBS 1171 of CBS (Centraalbureau voor Schimmel cultures) in addition to the technical contents of ¹ Kurtzman et al. And ² Barnett et al. (Table 1 and Table 2) ).

N9 ¹ kurtzman etc. ² Barnett et al.
CBS 1171 Fermentation Glucose + + + + Galactose + V +/- + Maltose + + +/- + Sucrose + + +/- + Trehalose - - L / - ND Melibiose D - +/- - Raffinose + + +/- + C assimilation Glucose + + + + Galactose + V +/- + D-Glucosamine - - - - D-Ribose - - - - D-Xylose - - - - D-Arabinose - - - - Sucrose + + +/- + Maltose + + +/- + Trehalose + + +/- + alpha -Methyl-D-glucoside + V +/- D Salicin - - - - Melibiose L - +/- - Lactose - - - - Raffinose + + +/- + Glycerol - - +/- - Ribitol - - - - D-Mannitol - - L / - - Galactitol - - - - Inositol - - - - D-Gluconate - V - - DL-Lactate L V +/- D Succinate - - L / - - Ethanol - + +/- +

N9 ¹ kurtzman etc. ² Barnett et al. CBS 1171 N assimilation Nitrate - - - - Ethylamine - - - - L-Lysine - - - - Cadaverine - - - - Tolerance Growth at 37 캜 + V +/- ND Growth at 40 ° C - V +/- ND Growth at 45 ° C - ND - ND 0.1% Cycloheximide - - - - 50% Glucose + + +/- + 10% NaCl / 5% glucose + + +/- - Vitamin Vitamin-free + - +/- -

¹ Kurtzman CP, Fell JW, Boekhout T. The Yeasts, a taxonomic study. 5th ed. Amsterdam: Elsevier; 2011.

² Barnett JA, Payne RW, Yarrow D. Yeasts: Characteristics and identification. 3rd ed. Cambridge: Cambridge University Press; 2000.

³ CBS: Centraalbureau voor Schimmel cultures, Urecht, Netherlands

+, Positive; -, voice; W, weak; D, reaction delay (positive result after 1 week); L, delayed reaction (positive result after 2 weeks); V, various; ND, no data available.

< Example  3> Confirm the growth characteristics of yeast

The following experiments were carried out to confirm the growth characteristics of yeast on Saccharomyces cerevisiae N9 of the present invention and Kagoshima 4 (C4) which is widely used in Japan for Japanese shochu.

YPD medium for yeast culture was prepared by dissolving 1 g of yeast extract, 2 g of polypeptone, and 2 g of glucose in distilled water and adding 0.2 M sodium phosphate buffer) was used.

<3-1> Identify tolerance to pH

The following experiment was conducted to confirm the resistance to pH of Saccharomyces cerevisiae N9 (N9) isolated in Example 1 above.

First, to confirm tolerance at pH 3.0, which corresponds to the first soju pre-soaking, 50 mL of buffer solution (pH 2.0 and 2.7) was mixed with 50 mL of YPD medium of double concentration to adjust final pH of the medium to 3.0 and 4.0 Respectively. Thereafter, the number of yeast cells pre-cultured for 24 hours in the YPD medium was measured, and inoculated to a total volume of 500 cells / mL in a pH-adjusted medium. Turbidity was measured while culturing at 30 ° C at 600 rpm.

As a result, as shown in Fig. 3 and Table 3, it was confirmed that the turbidity was 8.6 times and the total number of bacteria was 13 times higher than that of C4, which is Japanese yeast after 48 hours of cultivation (Fig. 3 and Table 3). Thus, rapid cell growth at a low pH can inhibit bacterial contamination such as bacteria in the initial stage of fermentation by forming a right germ cell in the cell membrane and producing alcohol, and as a result, Generation can be controlled.

N9 C4 Total number of bacteria (10 &lt; ⁸ &gt; cells / mL) 2.6 0.2

<3-2> Identification of alcohol resistance

In order to confirm the alcohol resistance of Saccharomyces cerevisiae N9 (N9) isolated in Example 1, the proliferation at pH 4.0 containing 2.5% alcohol, which is the pH and alcohol concentration corresponding to the second soju, Was confirmed in the same manner as in Example <2-1>.

As a result, as shown in Fig. 4 and Table 3, it was confirmed that the turbidity was 1.4 times higher and the total number of bacteria was 1.3 times higher and the alcohol tolerance was 1.3 times higher than that of Japanese yeast C4 after 48 hours of culture Table 4). The fermentation period can be more stable without the risk of pollution and the fermentation period can be shortened because the growth rate is also higher than that of C4.

N9 C4 Total number of bacteria (10 &lt; ⁸ &gt; cells / mL) 1.7 1.3

< Example  4> Confirm yeast brewing characteristics

<4-1> Syrup  Identification of fermentation characteristics

The following experiment was conducted to confirm the brewing characteristics of Saccharomyces cerevisiae N9 (N9) isolated in Example 1 above.

Specifically, 5 mL of the preculture was added to 245 mL of distilled water, 250 g of rice nori prepared in white rice was added, and the mixture was fermented in a constant temperature water bath at 30 ° C. for 5 days. 900 mL of distilled water and 500 g of rice bran were added thereto ℃, and fermentation was followed by daily measurement of the weight of the fermentation broth. This is because the yeast has when alcoholic fermentation CO ₂ is behind, the volatilization occurs reducing the weight of the mash, by measuring the weight of the daily mash and confirmed the amount of reduction of mash from the day before, so by considering the amount of reduction of the mash to the CO ₂ emission , And the higher the emission amount, the better the fermentation progresses. After distillation, 900 g of fermentation was distilled in a glass distiller at atmospheric distillation. Distillation was carried out until the alcohol content in the emulsion was 10%, and the obtained circumference was adjusted by adjusting the alcohol content to 25% after membrane filtration.

As a result, as shown in Fig. 5, fermentation on the 6th day of fermentation at the end of the first fermentation was 8.9% higher than that of the fermented yeast C4, 12.4% higher at 13th fermentation, and 6.2% higher at 18th (Fig. 5).

As shown in the following Tables 4 and 5, the total number of bacteria, alcohol concentration, and volatile acidity of the soup of the single-stage soaking was higher than that of the C4, and fermentation And the alcohol content of C4 was higher than that of C4 and the total sugar and reducing sugar content was lower than that of C4. Therefore, the amount of added raw material (rice) was higher than that of C4 and used for alcohol fermentation (Table 5 and Table 6), and it is possible to produce a unique distillable soju because of the high amount of dissipation.

N9 C4 Total number of bacteria (10 &lt; ⁸ &gt; cells / mL) 3.4 3.2 Viable cell count (10 &lt; ⁸ &gt; cells / mL) 1.9 2.3 Survival rate (%) 56 72 Alcohol(%) 13.7 13.3 Phosphoric Acid (mL) 7.9 3.8

N9 C4 Total number of bacteria (10 &lt; ⁸ &gt; cells / mL) 2.8 2.8 Viable cell count (10 &lt; ⁸ &gt; cells / mL) 0.9 0.4 Survival rate (%) 33 14 Sulphate acidity 11.7 11.7 Alcohol(%) 18.6 18.0 Phosphoric Acid (mL) 3.9 1.5 Reducing sugar (%) 0.6 1.0 Total (%) 1.1 2.7

<4-2> Sensory evaluation

After sterilization, the sensory evaluation was performed on 3 male and 4 female subjects.

As a result, as shown in Table 6, the flavor of rice distiller type shochu produced with N9 showed a strong flavor of grains and sweet, a little fruit flavor, and a strong tendency to taste sour taste (Table 7). It was confirmed that a soju having a flavor different from that of Japanese yeast can be produced.

leaven incense flavor N9 Grain, Sweet, Fruit Softness, sourness, sweetness C4 Sour, yogurt Light, stimulating flavor

Agricultural Biotechnology Research Institute KACC93234P 20150610

<110> KOREA RURAL DEVELOPMENT ADMINISTRATION <120> Distilled liquor using Saccharomyces cerevisiae N9 and method for          preparation thereof <130> 15p-06-020 <160> 3 <170> KoPatentin 3.0 <210> 1 <211> 615 <212> DNA <213> Saccharomyces cerevisiae <400> 1 gcatatcaat aagcggagga aaagaaacca accgggattg ccttagtaac ggcgagtgaa 60 gcggcaaaag ctcaaatttg aaatctggta ccttcggtgc ccgagttgta atttggagag 120 ggcaactttg gggccgttcc ttgtctatgt tccttggaac aggacgtcat agagggtgag 180 aatcccgtgt ggcgaggagt gcggttcttt gtaaagtgcc ttcgaagagt cgagttgttt 240 gggaatgcag ctctaagtgg gtggtaaatt ccatctaaag ctaaatattg gcgagagacc 300 gatagcgaac aagtacagtg atggaaagat gaaaagaact ttgaaaagag agtgaaaaag 360 tacgtgaaat tgttgaaagg gaagggcatt tgatcagaca tggtgttttg tgccctctgc 420 tccttgtggg taggggaatc tcgcatttca ctgggccagc atcagttttg gtggcaggat 480 aaatccatag gaatgtagct tgcctcggta agtattatag cctgtgggaa tactgccagc 540 tgggactgag gactgcgacg taagtcaagg atgctggcat aatggttata tgccgcccgt 600 cttgaaacac ggacc 615 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gcatatcaat aagcggagga aaag 24 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ggtccgtgtt tcaagacgg 19

Claims (7)

New Saccharomyces cerevisiae N9 deposited with accession number (KACC93234P) cerevisiae N9) strain, wherein said strain is not capable of magnetizing ethanol, is a strain of Saccharomyces cerevisiae N9.
The novel strain of Saccharomyces cerevisiae strain N9 according to claim 1, wherein the strain has the nucleotide sequence of 26s rDNA of SEQ ID NO: 1.
The method according to claim 1, wherein the strain is capable of fermenting melibiose, growing at a concentration of 50% glucose and 10% NaCl without growth at 40 ° C or higher, and having no vitamin requirement A new strain of Saccharomyces cerevisiae strain N9.
A prophylactic composition comprising the strain of claim 1 or a culture thereof.
1) fermenting cereals using the strain of claim 1; And
2) distilling the fermentation product of step 1).
6. The method according to claim 5, wherein the cereal in step (1) is rice, barley, wheat, or sweet potato.
A distillable soju produced by the method of claim 5.

Images