CN106701519B - Method for improving content of total acid esters and reducing sugar in table vinegar by using high-ester-yield indigenous aroma-producing yeast enhanced Daqu - Google Patents

Abstract

The invention belongs to the technical field of biological materials and application, and provides a method for improving the content of total acid esters and reducing sugar in table vinegar by using high-ester-yield indigenous aroma-producing yeast to strengthen yeast, in order to solve the problem that the strengthening of yeast by exogenous non-indigenous yeast is difficult to achieve the effects of increasing yield and improving quality, but can cause the quality of the vinegar to be reduced. Comprises separating high-yield ester indigenous aroma-producing yeast, activating single strain, strengthening Daqu, and performing acetic fermentation. The strain is separated from the traditional Shanxi mature vinegar Daqu, has uniqueness, has ester production capacity which is remarkably higher than that of commercial Angel aroma-producing yeast, and shows extremely strong high temperature resistance, acid resistance, ethanol resistance and hyperosmolarity resistance; the yeast for strengthening the yeast for making the hard liquor by the method disclosed by the invention is used for overcoming the problem of incompatible strains in the brewing process, and the yeast for strengthening the hard liquor for making the hard liquor for.

Description

Method for improving content of total acid esters and reducing sugar in table vinegar by using high-ester-yield indigenous aroma-producing yeast enhanced Daqu

Technical Field

The invention belongs to the technical field of biological materials and application thereof, and particularly relates to a method for improving the content of total acid esters and reducing sugar in table vinegar by utilizing high-ester-yield indigenous aroma-producing yeast.

Background

Different areas in China all have their own vinegar types. The Shanxi mature vinegar is a representative product in Shanxi province, has a production history of more than 3000 years, and is praised as the first four major vinegars in China due to good and unique flavor and nutrition health-care function. The brewing process of Shanxi mature vinegar is very complicated and is listed as the national non-material cultural heritage. The unique quality of the yeast is closely related to local water, climate, soil, ecosystem and the like, because the factors determine the quality of the yeast, in the brewing process of the Shanxi mature vinegar, the yeast is not only a saccharifying agent, but also a vinification leavening agent, is a key factor determining the yield and the quality of the Shanxi mature vinegar, and is more and more concerned by researchers.

Daqu, also called brick koji, is prepared by using barley and pea as main raw materials, crushing, adding water, stirring, pressing into koji grains, and allowing various microorganisms to naturally compete for growth by a natural inoculation method. Through long-term natural domestication and the drive of unique process conditions of Shanxi mature vinegar, the mature vinegar Daqu forms a specific microbial community which is symbiotic with each other, and is sequentially consumed and metabolized complementarily. The yeast, one of the main functional microorganisms in the yeast for making hard liquor, plays an important role in the whole fermentation stage, and has the functions of alcoholization, esterification, providing aroma precursor substances, flavor substances and the like. Wine-producing yeasts and aroma-producing yeasts play a major role in the brewing process. The wine-producing yeast ferments the sugar to produce ethanol, and the fermentation strength of the alcohol-producing yeast determines the yield of Shanxi mature vinegar. In thatAlcohol fermentation stage of vinegar production, Saccharomyces cerevisiaeSaccharomyces cerevisiae) Is dominant yeast, accounting for 95% of total yeast. Although the quantity of aroma-producing yeast is very small, a variety of aromatic substances can be formed, and the flavor and quality of vinegar, alcoholic beverages and other fermented products are determined to a large extent.

Aroma-producing yeast, also known as ester-producing yeast, refers to yeast that catalyzes acids to react with alcohols to produce esters under the action of esterase in a narrow sense, and refers to yeast that can synthesize aromatic substances in a metabolic process in a broad sense. These aromas or particular flavors will positively affect the overall flavor of the brewed product, resulting in a significantly improved flavor profile of the product, and the types and amounts of flavors produced will vary from yeast species to yeast species. The aroma-producing yeast mainly belongs to Hansenula, Torulopsis, Candida, Pichia and Zygosaccharomyces rouxii. The potential of aroma-producing yeasts has attracted attention and has been exploited in recent years. The research on aroma-producing yeast in the brewing process of Shanxi mature vinegar is few, and many problems need to be solved.

Many researches show that the saccharifying power and the alcohol power of the yeast are lower, so that the using amount of the yeast is increased, the utilization rate of raw materials is reduced to a certain extent, and the production cost is increased. In the production process of Shanxi mature vinegar, the using amount of the Daqu is about 60 percent of the main material, and the substitution of the Daqu for the Liang is also one of the process characteristics. Nowadays, many vinegar factories in Shanxi province solve the problem by adding pure-breed bran koji and active dry yeast, and the content of amino nitrogen is reduced, which affects the quality of mature vinegar. The active dry yeasts added are often commercial Saccharomyces cerevisiae and aroma-producing yeasts, and the desired effect is not achieved due to the incompatibility of these exogenous yeasts with the indigenous microflora of the yeast. Studies have shown that many yeasts include Saccharomyces cerevisiae (S. cerevisiae)S.cerevisiae) And Pichia genus (Pichia spp.) Extracellular lethal toxic proteins (Killer toxin proteins) are produced and secreted. Yeasts producing a particular toxic protein may kill not only many types of yeast that do not produce toxic proteins, but also yeasts producing other toxic proteins. Along with the history of production of Shanxi mature vinegar, over 3000 years of selective evolution is carried out, Daqu microorganisms are compatible with each other, and a stable district system and ecology are formed. The introduction of exogenous non-indigenous yeast can be inhibited and even killed by the yeast inhabiting the yeast, and worse, the indigenous microorganisms of the yeast can be even killed by the yeast introduced from the exogenous sources. Therefore, it is naturally difficult to achieve the effects of increasing the yield and improving the quality of commercial exogenous yeast enhanced koji, and instead their introduction sometimes causes the quality of vinegar to be degraded. Therefore, considering the compatibility among microorganisms, the indigenous aroma-producing yeast with high ester production capacity is separated from the Daqu, and the Daqu is used for strengthening the esterification capacity of the Daqu on the premise of not generating negative influence on the saccharification and the alcoholization capacity of the Daqu, so that the method is a feasible way for improving the quality of Shanxi mature vinegar. The work can play an immeasurable role in improving the traditional process of Shanxi mature vinegar, promoting regional economic development and developing the international market of local products.

Disclosure of Invention

The invention provides a method for improving the content of total acid esters and reducing sugar in table vinegar by using high-ester-yield indigenous aroma-producing yeast, aiming at solving the problem that the exogenous non-indigenous yeast reinforced yeast is difficult to achieve the effects of increasing the yield and improving the quality and can cause the quality of the vinegar to be reduced.

The invention is realized by the following technical scheme: a method for improving the content of total acid esters and reducing sugar in vinegar by using high-ester-yield indigenous aroma-producing yeast reinforced Daqu comprises the following steps:

(1) separation of high ester-yielding indigenous aroma-producing yeast: collecting fermented grains fermented on the third day and the sixth day by the traditional Shanxi mature vinegar process, respectively separating yeasts by using a Bengal selective culture medium through a 10-fold decreasing gradient dilution method, coating 100uL of each gradient dilution sample liquid on a flat plate of the Bengal selective culture medium, performing inverted culture at 28 ℃ for 48 hours, further performing streak purification culture on a single colony with obvious colony characteristics on the Bengal selective culture medium for 2-3 times, purifying, transferring to a YEPD solid inclined plane, and storing at 4 ℃ for later use; two batches of separation and purification experiments are carried out to obtain the yeast, and the yeast is subjected to microscopic examination, colony morphology observation and physicochemical characteristicsThe method comprises the following steps of sign detection, sequence analysis and identification of a rRNA gene D1/D2 region, detection of wine production, ester production performance and environmental tolerance, and finally obtaining the high-ester-yield native aroma-producing yeast: pichia genus (Pichia manshurica) Y14, Candida ethanolica (C.) (Candida ethanolica)Y18；

(2) Activating a single strain of the high-ester-yield indigenous aroma-producing yeast: inoculating Y14 and Y18 at 2% inoculum size in YEPD medium at 30 deg.C for 20 hr, and diluting the bacterial suspension with sterile water cooled to room temperature to 10%⁷/ml；

(3) The high-yield ester indigenous aroma-producing microzyme reinforced yeast is subjected to acetic fermentation: by diluting to 10⁷The method comprises the steps of performing acetic fermentation on a single strain Y18 or a combined double-strain reinforced Daqu of Y14 and Y18 of the high-ester-yield indigenous aroma-producing yeast for each ml, wherein the total ml of the bacterial liquid of the high-ester-yield indigenous aroma-producing yeast for reinforcement is equal to the total g of the using amount of the Daqu, and the using amounts of Y14 and Y18 respectively account for 50% of the total ml of the bacterial liquid of the high-ester-yield indigenous aroma-producing yeast for reinforcement by the combined double-strain.

The genus Pichia (A)Pichia manshurica) Y14 is cultured in wort liquid culture medium at 25 deg.C for 3 days, the cells are spherical and egg-shaped, and have size of 4.6-6.5 × 3.8-6.5mm, and cultured on wort agar slant at 25 deg.C for 1 month, the colony is cheese-shaped, light white gray, smooth surface, no reflection, and regular edge; culturing corn flour agar Dalmau on a flat plate without producing pseudo hypha; sequence detection and identification of rRNA gene D1/D2 region, and sequencing primers are as follows: NL1: GCA TAT CAA TAA GCG GAG GAA AAG; NL 4: GGT CCG TGT TTC AAG ACG G, respectively; the Genbank sequence accession number of the 26s rDNA D1/D2 region is KP 027538; activating a Y14 strain, inoculating the strain on a sodium acetate spore-forming culture medium plate, culturing for 4-5 days at 25 ℃, dyeing by a spore dyeing method, observing the shape and the spore number of ascospores by a high-power microscope, forming ascospores by Y14, dyeing the ascospores by malachite green, wherein the ascospores are blue, green or colorless, and the preservation number of the Pichia (Pichia manshurica) Y14 is as follows: CGMCC No.12407, the preservation unit is China general microbiological culture Collection center, the address is No. 3 of No.1 Xilu on North Chen of the south-oriented region in Beijing, and the preservation date is 2016, 4 and 28 days.

The ethanol isCandida (C.A.)Candida ethanolica) Y18 is cultured in wort liquid culture medium at 25 deg.C for 3 days, the cells are egg-shaped, sausage-shaped, and have a size of 4.0-7.2 × 3.0-5.2mm, and the malt agar is cultured at 25 deg.C for 1 month, and the colony is cheese-shaped, light gray, smooth in surface, non-reflective, and neat in edge; culturing on corn flour agar Dalmau plate without producing false hypha; sequence detection and identification of rRNA gene D1/D2 region, and sequencing primers are as follows: NL1: GCA TAT CAA TAA GCG GAG GAAAAG; NL 4: GGT CCG TGT TTC AAG ACG G, respectively; the accession number of the Genbank sequence of the 26s rDNA D1/D2 region is KP 339953; activating the Y18 strain, inoculating the strain on a sodium acetate spore-forming culture medium plate, culturing for 4-5 days at 25 ℃, dyeing by a spore dyeing method, observing the shape and the number of the ascospores by a high power microscope, and enabling Y18 not to form ascospores and ascospores; the Candida ethanolica (C.) (Candida ethanolica) The Y18 deposit number is: CGMCC No. 12409, the preservation unit is China general microbiological culture Collection center, the address is No. 3 of West Lu No.1 of Shangyang district, Beijing, and the preservation date is 2016, 4 and 28 days.

The Y14 and Y18 bacterial strains are separated from the traditional Shanxi mature vinegar Daqu and identified as follows by the institute of microbiology of Chinese academy of sciences: pichia manghurica (Y14) andCandida ethanolica(Candida ethanolica, Y18).

Reference (bharskar b., Zareena b., sisinum s.,2008.pichiagarciniae sp. nov., isolated from a rotten mangosteen from a fruit, Garcinia mangostana l., Clusiaceae.) International Journal of Systematic and evolutionary microbiology.58, 2665-2669.); (peptide-Marie Daniel, Gino Vanken, Jemmy F. Takrama, Nichols Camu, Paul De Vos, Luc De Vuyst, 2009.Yeast diversity of Ghanaian coa bean fermentation, FEMS Yeast Res.9, 774-783.) in contrast to the above-mentioned documents already reported, Y14 and Y18, although identified as Pichia manghurica and Candida ethanolica, respectively, behave differently in many physiological properties than the same Yeast species reported,P. manshuricaNRRL Y-27978^T(BhaskarBhadra, et al 2008) cannot assimilate nitrate and nitrite, hydrolyze urea and ferment D-glucose, whereas Y14 has the above-mentioned ability. Separating fermented cocoa beansIs/are as followsPichia manshurica(Heide-Marie Daniel, et al 2009) assimilated sucrose whereas Y14 did not; these differences can be considered as intraspecific inter-plant differences.

Since the Y14 and Y18 strains are separated from the traditional Shanxi mature vinegar Daqu and are selected and evolved for 3000 years in the fermentation practice, the strain inevitably shows the corresponding characteristics of various raw and auxiliary materials and fermentation environments for Shanxi vinegar brewing, and has uniqueness. Research shows that the ester production capacity of the yeast is even remarkably higher than that of commercial Angel aroma-producing yeast, and the yeast has extremely strong high temperature resistance, acid resistance, ethanol resistance and high permeability resistance; more importantly, the yeast is strengthened by using indigenous microorganisms of the yeast, the problem of incompatible strains in the brewing process is solved, and if the exogenous commercial non-yeast microorganism is used for strengthening the yeast, the proper effect cannot be achieved, and even the quality of vinegar can be seriously influenced. In actual production, the method for strengthening the yeast for making hard liquor according to the invention can remarkably improve the contents of total acid, total ester and reducing sugar in vinegar liquid, and does not influence other two indexes of vinegar, namely, non-volatile acid and non-volatile amino nitrogen, no matter Y14+ Y18 double-strain strengthening or Y18 single-strain strengthening.

Drawings

FIG. 1 shows Y14 (Pichia manshurica) A result chart of the observation of the shape of the malt wort liquid after 3 days of culture; FIG. 2 shows Y18 (Candida ethanolica) A result chart of the observation of the shape of the malt wort liquid after 3 days of culture; FIG. 3 shows Y2 (Candida ethanolica) A result chart of the observation of the shape of the malt wort liquid after 3 days of culture; FIG. 4 shows Y2 and Y18 (C: (A))Candida ethanolica) Pseudohyphae formed by cell culture; FIG. 5 shows Y14 (Pichia manshurica) Microscopic images of the formed ascospores and ascospores; FIG. 6 is a graph showing the results of the ester production of yeast isolated from Shanxi mature vinegar Daqu; FIG. 7-FIG. 10 are the genus Pichia (Pichia)Pichia manshurica) Y14 and Candida ethanolica (C.) (B.)Candida ethanolica) And Y2 and Y18. FIG. 11 is a graph showing the results of alcoholic strength measurements of alcoholic fermentation liquors of Pichia pastoris Y14 and Candida ethanolica Y2, Y18 fortified Daqu(ii) a FIG. 12 is an HS-GC-MS 6-40min ionograph of Y2 enhanced alcoholic fermentation broth; FIG. 13 is an ion diagram of HS-GC-MS 6-40min of the strain Y14 fortified alcoholic fermentation broth; FIG. 14 is an ion diagram of HS-GC-MS 6-40min of the strain Y18 fortified alcoholic fermentation broth; FIG. 15 is an ion diagram of HS-GC-MS 6-40min of a control Daqu alcohol fermentation broth.

Detailed Description

A method for improving the content of total acid ester and reducing sugar in vinegar by utilizing high-ester-yield indigenous aroma-producing yeast comprises the following steps:

1. separation of high ester-yielding indigenous aroma-producing yeast: collecting fermented grains fermented on the third day and the sixth day by the traditional Shanxi mature vinegar process, respectively separating saccharomycetes in the fermented grains by a 10-fold descending gradient dilution method by using a Bombara red selective culture medium, coating 100uL of each gradient dilution sample liquid on a flat plate of the Bombara red selective culture medium, performing inverted culture at 28 ℃ for 48 hours, further performing streak purification culture on a single colony with obvious colony characteristics on the Bombara red selective culture medium for 2-3 times, purifying, transferring to a YEPD solid inclined plane, and storing at 4 ℃ for later use; the results show that: in the sample of the third day, mould hyphae are fully distributed on the flat plate, and simultaneously, a large number of yeast colonies can be seen, but the characteristics of the yeast colonies are very similar;

after two batches of separation and purification experiments, 15 strains of yeast are obtained, and the obtained yeast is finally reserved and combined into 6 strains through colony morphology observation and microscopic examination; in the sample on the sixth day, the flat plate is completely free of mould, the number of yeasts is increased rapidly, and the types of the yeasts are richer than those of the sample on the 3 rd day; the absolute dominant yeast existing in the sample on the third day is also dominant in the sample on the sixth day; through two batches of experiments, 29 yeasts are separated and purified, and are finally reserved and combined into 19 yeasts which are respectively numbered as Y1-Y19; through physicochemical characteristic detection, sequence detection and identification of rRNA gene D1/D2 region, detection of wine production, ester production performance and environmental tolerance, the high-ester-yield native aroma-producing yeast is finally obtained, and the yeast is identified by the research of microorganisms in Chinese academy of sciences according to comprehensive analysis of experimental data such as culture characteristics, cell microscopic morphological characteristics, physiological and biochemical characteristics, 26s rRNA D1/D2 region sequence and the like of each strain:pichia (Pichia manshurica) Y14, Candida ethanolica (C. sp.) (C. ethanolica)Candida ethanolica) Y2 and Y18;

1.1 identification of Pichia (Pichia manshurica) Y14:

(1) micro-morphological characteristics of Pichia (Pichia manshurica) Y14:

culturing in malt liquid culture medium at 25 deg.C for three days, and microscopic morphology is shown in FIG. 1, and cells are spherical and oval, and have size of (4.6-6.5) × (3.8-6.5) mm. After the wort agar is cultured for 1 month at 25 ℃, the colony is cheese-shaped, light white gray, smooth in surface, not reflective and neat in edge. Corn flour agar Dalmau plate culture, no pseudo hypha.

(2) The results of the physiological and biochemical tests of Pichia (Pichia manshurica) Y14 are shown in Table 1:

table 1: physical and chemical characteristics of Y14 (Pichia manshurica)

(3) Sequence determination result of rRNA gene D1/D2 region of Pichia (Pichia manshurica) Y14

The sequencing primer is as follows: NL1: GCA TAT CAA TAA GCG GAG GAA AAG; NL 4: GGT CCG TGT TTCAAG ACG G are provided. The results of the measurement were as follows: genbank sequence accession number is KP027538, and the base sequence is shown in SEQ ID NO: 1, namely:

5¢-AAATCGTGTTTCGGCACGAGTTGTAGAGTGTAGGCGGGAGTCTCTGTGGAGCGCGGTGTCCAAGTCCCTTGGAACAGGGTGCCTGAGAGGGTGAGAGCCCCGTAGGGTGCTGCGCGAAGCTTTTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAGCGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCTCGACATGGGGGGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCCCTCTGGGCCAGCATCGGTTCCTGCTGCGGGAGAAGGGGCTCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGGGCCAGATGCCGCGTGTGGGGACCGAGGACTGCGGCTTCTGTCTCGGATGCTGGCATAACGGCGCAATACCGCCCGTCTTGAA-3¢。

1.2 Candida ethanolica (C.), (Candida ethanolica) Identification of Y18:

(1) candida ethanolica (C.) (Candida ethanolica) Microscopic morphological characteristics of Y18:

culturing in malt wort liquid culture medium at 25 deg.C for three days, and microscopic morphology is shown in FIG. 2, cell is egg-shaped and sausage-shaped, and size is (4.0-7.2) × (3.0-5.2) mm. After the wort agar is cultured for 1 month at 25 ℃, the colony is cheese-shaped, light gray, smooth in surface, not reflective and neat in edge. Corn flour agar Dalmau plate culture, no pseudo hypha.

(2) Candida ethanolica (C.) (Candida ethanolica) The results of the physiological and biochemical detection of Y18 are shown in Table 2:

TABLE 2Y 18Candida ethanolica) Physical and chemical characteristics

(3) Candida ethanolica (C.) (Candida ethanolica) rRNA gene D1/D2 region sequence determination of Y18:

the sequencing primer is as follows: NL1: GCA TAT CAA TAA GCG GAG GAA AAG; NL 4: GGT CCG TGT TTCAAG ACG G are provided. The results of the measurement were as follows: the Genbank sequence accession number is KP339953, and the base sequence is shown in SEQ ID NO: 2, namely:

5¢-AAGCGGCAAGAGCTCAGATTTGAAATCGTGTTTCGGCACGAGTTGTAGAGTGTAGGCTGGAGTCTCTGTGGAGCGCGGTGTCCAAGTCCCTTGGAACAGGGTGCCTGAGAGGGTGAGAGCCCCGTGGGGTGCTGCGCGAAGCTTTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGGAGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCTCTCTGGGCCAGCATCGGTTCTTGCTGCGAGAGAAGTGGCGCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGTGCCGGATGTCGCGTGCGGGGACCGAGGGCTGCGACATCTGTCTCGGATGCTGGCACAACGGCGCAATACCGCCCGTCTTGA-3¢。

1.3 Candida ethanolica (C.), (Candida ethanolica) Identification of Y2:

(1) candida ethanolica (C.) (Candida ethanolica) Microscopic morphological characteristics of Y2:

culturing in wort liquid culture medium at 25 deg.C for three days, wherein the microscopic morphology is shown in figure 3, the cell is egg-shaped and sausage-shaped, and the size is (4.5-12) × (3.8-5.5) mm, and the malt agar slant is cultured at 25 deg.C for 1 month, and the colony is cheese-shaped, light gray, smooth in surface, non-reflective, and neat in edge. Corn flour agar Dalmau plate culture, no pseudo hypha. The cells were substantially the same as Y18 except that they were longer than Y18.

(2) Candida ethanolica (C.) (Candida ethanolica) The results of the physiological and biochemical detection of Y2 are shown in Table 3:

as is clear from tables 2 and 3, Y2 differs from Y18 in that Y18 can assimilate glycerol, but Y2 cannot.

TABLE 3Y 2 (Pichia manshurica) Physical and chemical characteristics

(3) Candida ethanolica (C.) (Candida ethanolica) Sequencing of the D1/D2 region of the 26s rRNA gene of Y2:

primers D1D2 region amplification primers were NL1: GCA TAT CAA TAA GCG GAG GAA AAG and NL 4: GGTCCG TGT TTC AAG ACG G are provided. The ITS amplification primers are ITS 4: TCC TCC GCT TAT TGA TAT GC and ITS 5: GGAAGT AAA AGT CGT AAC AAG C are provided.

Y2（Candida ethanolica) The 26s rDNA D1D2 region sequence is shown in SEQ ID NO: 3, namely:

5¢-AAATCGTGTTTCGGCACGAGTTGTAGAGTGTAGGCGGGAGTCTCTGTGGAGCGCGGTGTCCAAGTCCCTTGGAACAGGGTGCCTGAGAGGGTGAGAGCCCCGTGGGGTGCTGCGCGAAGCTTTGAGGCCCTGCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCCCGACATGGGGAGTGCGCACCGCTGTCTCTTGTAGGCGGCGCTCTGGGCGCTCTCTGGGCCAGCATCGGTTCTTGCTGCGAGAGAAGTGGCGCCGGAAAGTGGCTCTTCGGAGTGTTATAGCCGGTGCCGGATGTCGCGTGCGGGGACCGAGGGCTGCGACATCTGTCTCGGATGCTGGCACAACGGCGCAATACCGCCCGTCTTGAACC-3¢。

Y2（Candida ethanolica) The 26s rDNA ITS sequence is shown in SEQ ID NO: 4, namely:

5¢-ATCTGAGGTCGAGCTCATAGTGCTCGGAGACCCCAAGCGTCCTGTTCTAGTTCGCTCGTGGCCTCGTTTCTTTTCGGCGGGGCCGTGGCCGGGCCAGCTCTGCGCAACTCTCGTCTTGCAAGAAGGAAACGACGCTCAGACAGGCATGCCCGCCGGAATGCCGACGGGCGCAATGTGCGTTCAAGAACTCGATGATTCACGATGGCTGCAATTCACACTAGGTATCGCATTTCGCTGCGCTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGTGTTAAAATAAAAACTCCTGAACTAGTATACGTGTTTGTGTGTTGTGTGCGCTCACGCAGTGTGGAACAATAATCACAGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACtTTTTTACTTCCA-3¢。

1.4 pseudohyphal morphology observation and ascospore morphology observation:

some yeasts form false hyphae during propagation, and if the hyphae are broken by picking of an inoculating loop, the complete form of the false hyphae cannot be seen, so that a relatively independent environment is provided for growth and propagation of the yeasts by adopting small-chamber culture, so that the formation condition of the false hyphae of the yeasts can be observed at any time. Y2 and Y18 (Candida ethanolica) The pseudohyphae formed by the chamber culture are shown in FIG. 4; activating the strain to be observed, inoculating the strain to a sodium acetate spore-forming culture medium plate, culturing for 4-5 days at 25 ℃, dyeing by a spore dyeing method, and observing the shape and the spore number of ascospores under a high power microscope. The results showed that Candida ethanolica Y2 and Y18 did not form ascospores and ascospores. Although Y14 formed ascospores, as shown in FIG. 5, it was not easily stained with malachite green, and ascospores appeared blue, green or colorless.

1.5 Pichia genus (Pichia manshurica) Y14 and Candida ethanolica: (Candida ethanolica) Detecting the wine production and ester production performance of Y2/Y18:

(1) the wine production performance: the results of the gas production test of Duchenne tube by adopting YEPD culture medium show that Y14: (Pichia manshurica) And Y2/Y18 (Candida ethanolica) The strains cultured for 48 hours respectively still have no gas production phenomenon, which indicates that the fermentation capability is weaker. And the strain with strong fermentation capacity begins to produce gas after being cultured for 12 hours.

(2) Ester production performance: 19 strains of yeast (Y1-Y19) separated from Shanxi mature vinegar Daqu, control strains of Y20 (Angel high-activity dry saccharomyces cerevisiae) and Y21 (Angel aroma-producing dry yeast) are activated in a YEPD culture medium, inoculated into a 150mL triangular flask containing 80mL of ester-producing fermentation liquid by 3 percent of inoculation amount, subjected to static culture at 28 ℃ for 7 days, and subjected to determination of the total ester content in the fermentation liquid according to an alkali-night saponification method specified in GB 19777-2005. The results of the experiment are shown in FIG. 6. Compared with control Angel aroma-producing dry yeast Y21, strains Y2, Y5, Y6, Y9, Y10, Y11, Y12, Y13, Y14, Y15 and Y18 have stronger ester-producing capability, and the other strains have weaker ester-producing capability. The three strains with the highest ester production capability are Y14, Y2 and Y18, and the ester production amounts are 36.05g/L, 33.75g/L and 33.47g/L respectively. The result of the analysis of the difference significance is shown in table 4, the ester yield of the high-ester-production yeast of 11 strains is very significantly higher than that of Angel aroma-producing yeast, but the difference between Y2 and Y18 is not significant.

Table 4: differential analysis of saccharomycete ester yield

1.6 genus Pichia (Pichia manshurica) Y14 and Candida ethanolica: (Candida ethanolica) Relevant environmental tolerance analysis of Y2/Y18: the performance analysis of the yeast mainly comprises the tolerance of the yeast to factors such as temperature, pH, alcoholic strength, sugar degree and the like, inoculating 0.3mL of activated yeast suspension into a test tube containing 10mL of YEPD culture medium, culturing at 30 ℃ for 3d except for high temperature resistance measurement, centrifuging the culture solution at 4000r/min for 10min, pouring off the supernatant, and measuring the wet weight of the thallus. The results are shown in FIGS. 7-10.

It can be seen from the figure that Y14 and Y18 still grow well at the temperature of 40 ℃, but as the temperature continues to rise, the growth is obviously inhibited at 50 ℃, and the cell metabolism is weakened and the thallus grows slowly because the enzyme activity is inhibited when the temperature rises to a certain extent, while Y2 has a growth phenomenon at 40 ℃, but the growth condition is inferior to that of Y14 and Y18. The yeast grows strongly at a relatively low temperature, which is in direct relation with the long-term domestication of low-temperature alcohol fermentation environment in the actual production of Shanxi mature vinegar. The two ester-producing yeasts Y14 and Y18 can still grow at the temperature of 35 ℃ and 40 ℃, and can continue to act in the acetic acid fermentation stage to generate aroma components, thereby improving the quality of the vinegar.

When the pH was decreased from the initial value of 4 to 2, the amount of growth of Y18 increased, whereas the amounts of growth of Y2 and Y14 decreased only slightly, but the growth of the cells was greatly inhibited at pH 1.5. The ester-producing yeast can tolerate the acid environment in the acetic acid fermentation process, so that more ester substances can be generated by using various organic acids formed by the acetic acid fermentation, the flavor of the vinegar is improved, and the quality of the vinegar is improved.

Of all isolated yeast strains, Y18 was the most ethanol tolerant. The pH affects the growth of Y2 and Y14 in substantially the same manner. The 3 bacterial strains grow vigorously at the ethanol concentration of 8 percent and can tolerate the ethanol concentration of 10 percent, and the ethanol concentration of 12 percent can completely inhibit the growth.

The sugar concentration of 40% had no effect on the growth of Y14 and Y18, and the growth was inhibited at 50% for both strains, whereas the growth was maintained at 50% for Y14 at 60% and decreased rapidly for Y18. While sugar concentrations above 30% significantly inhibited the growth of the Y2 strain.

Research shows that the saccharomycetes with excellent physiological tolerance have excellent effects of improving the utilization rate of raw materials, reducing the production cost, improving the flavor of products and the like in actual production. Good yeasts generally have the following physiological tolerance:

high temperature resistance: the optimal fermentation temperature of the traditional strain is generally 28-35 ℃, and the fermentation capacity of the traditional strain is weakened when the environmental temperature is gradually increased. The high temperature resistant saccharomycete may be fermented normally at relatively high temperature, and has higher synthetic enzyme activity than that of suitable temperature saccharomycete. In the production of vinegar, the saccharification of raw materials needs high temperature, if the yeast is high temperature resistant, the fermentation can be carried out while the saccharification is carried out, the production speed is accelerated, and the fermentation period is shortened.

Ethanol resistance: although ethanol is a product of anaerobic fermentation of yeast, its concentration is accumulated to some extent and has an inhibitory effect on itself. In the later stage of alcohol fermentation, the alcohol concentration in the fermented liquor is high, and if the ethanol resistance of the yeast is weak, the fermentation activity of the yeast is seriously influenced, so that the fermentable sugar in the raw materials cannot be converted into alcohol, and the wine yield is reduced. The yeast with good ethanol resistance can be thoroughly fermented, the utilization rate of raw materials is improved, and the yield is increased.

Acid resistance: auxiliary materials are added in the Shanxi mature vinegar in the process of converting alcohol fermentation into acetic acid fermentation after the alcohol fermentation, newly added reducing sugar can be generated in the vinegar culture, and under the condition that the acidity of the vinegar culture is not obviously improved, if the yeast has certain acid resistance, the newly added reducing sugar can be utilized to generate a certain amount of alcohol and ester substances, so that the yield and aroma components of the vinegar are increased.

High sugar resistance: the sugar content of the fermented mash is too high in the alcohol fermentation process, so that cells are dehydrated, the cell structure is damaged, the in-vivo enzyme activity is lost, and the growth and fermentation of the fermented mash are inhibited. Therefore, the yeast with certain hypertonic resistance is a necessary property for good fermentation performance.

Although both Y2 and Y18 were identified as candida ethanolica, they are significantly different in the environmental tolerance phenotype, and Y2 is significantly not resistant to high temperature and high sugar environments. The environmental tolerance of all the strains is integrated, so that the three strains can tolerate various environments in the actual production and fermentation process of vinegar, namely the three strains can play a role in the whole fermentation process of Shanxi mature vinegar, the bilateral and even multilateral fermentation process can be further promoted, and the fermentation period is shortened. Research theories show that the existence of organic acid in the fermentation process has a direct relation with the generation of corresponding esters, so that the ester-producing yeast continues to act in the acetic acid fermentation stage, the content of the esters can be increased, the types of the esters can be enriched, the flavor of the vinegar is improved, and the quality of the vinegar is improved.

2. Activating a single strain of the high-ester-yield indigenous aroma-producing yeast: inoculating Y14 and Y18 at 2% inoculum size in YEPD medium at 30 deg.C for 20 hr, respectively, diluting the strain with sterile water cooled to room temperature to 10%⁷/ml；

3.1 determination result of alcohol content of high-yield ester yeast enhanced alcoholic fermentation:

the alcohol fermentation of the high-yield ester-producing yeasts Y2, Y14 and Y18 and Daqu is carried out together, the alcohol content of the fermentation liquor is determined as shown in figure 11, and the alcohol content is respectively as follows: y2 (9.65%) > Y14 (9.59%) > Y18 (9.51%), while the alcohol content of the control group which is not fortified is 9.42%, therefore, the alcohol content of the fermentation liquor is improved to a certain extent by the 3 strains of high-ester-production yeast enhanced fermentation. The analysis result of the difference significance indicates that the differences of the three high-ester-production yeast reinforced groups and the three high-ester-production yeast reinforced groups are very significant compared with the contrast, and indicates that the high-ester-production yeast and the yeast for making hard liquor co-ferment can obviously improve the wine yield.

3.2 sensory evaluation of aroma of alcoholic fermentation liquor:

the results of the aroma evaluation of the fermentation broth of the high ester producing yeast enriched with ethanol by 10 evaluators (consisting of the present researchers and teachers) trained in the sensory evaluation of food are shown in Table 6. Through sensory evaluation and analysis, the enhanced fermentation liquor has pleasant fragrance compared with the Daqu fermentation liquor.

TABLE 5 sensory evaluation of aroma of high-yield ester-producing yeast-enhanced alcoholic fermentation broth

3.3, determination of volatile aroma components in the fermentation liquor: and (3) carrying out alcohol fermentation on the high-yield ester yeast and the Daqu together, carrying out semi-quantitative analysis on the fermentation liquor by using HS-GC-MS, and detecting main volatile aroma components in the fermentation liquor. Uniformly mixing the fermentation liquor which is repeatedly subjected to the three times, freezing and centrifuging for 15min at the temperature of 4000r/min at 4 ℃, reserving supernatant, uniformly mixing, sampling 10ml, placing in a 20ml headspace sample injection bottle, adding 3g NaCl for dissolving, automatically injecting sample by adopting the headspace, and measuring aroma components in the fermentation liquor by GC-MS. The HS-GC-MS determination conditions are as follows:

1) headspace injector conditions: the shaking temperature is 70 ℃, the shaking time is 30min, and the sample volume is 2 ml.

2) GC analysis conditions were as follows: the column was TR-5MS (30 m.times.0.25 mm, 0.25 um). The injection port temperature is 250 ℃, the carrier gas He flows at the flow rate of 1 mL/min. The sample volume is 2 mu L, and the sample introduction is not carried out by shunting. Temperature rising procedure: the initial temperature is 35 deg.C, and the temperature is maintained for 8min, and the temperature is increased to 230 deg.C at a speed of 5 deg.C/min, and maintained for 5 min.

3) MS conditions: electron Impact (EI) ion source, electron energy 70eV, ion source temperature 250 ℃, transport line temperature 280 ℃, mass scan range m/z: 30 to 350.

The detection results are shown in fig. 12-15, and as shown in the figure, the total ion flow diagrams of the four samples are approximately the same, mainly because the high-ester-production yeast is derived from the yeast and co-fermented with the yeast, the types of main components in the enhanced fermentation liquid are the same, and the ethanol content in the fermentation liquid is higher, so that other peaks are weaker; the peaks of trace components in the fermentation liquor can be seen from an ion flow diagram of 6-40min, the species of the substances are basically the same, but the components of the substances in the fermentation liquor are different.

The GC-MS analysis results of the ester components in the fermentation broth are shown in Table 6.

Table 6: GC-MS analysis result of ester component in fermentation liquor

As can be seen from table 6: the mass spectrometry analysis of the volatile aroma components in the Y2 strain fermentation liquor shows 34 substances, wherein 6 alcohols account for 62.12% of the area; 18 esters, accounting for 18.75 percent of the area; the aldehydes are 7, accounting for 0.43 percent of the area; 1 ketone, accounting for 0.01 percent of the area; 1 ether, accounting for 2.3% of the area; 1 kind of furan, accounting for 0.155% of the area; the other compounds accounted for 18.7% of the area.

Mass spectrometry is carried out on volatile aroma components in Y14 strain fermentation liquor to obtain 34 substances, wherein 6 alcohols account for 63.48% of the area; 16 esters accounting for 26.12 percent of the area; 9 aldehydes accounting for 0.48 percent of the area; 1 ketone accounting for 0.004 percent of the area, 1 ether accounting for 2.86 percent of the area; 1 kind of furan, accounting for 0.140% of the area; the other compounds accounted for 9.92% of the area.

The mass spectrometry analysis of volatile aroma components in the Y18 strain fermentation liquor shows 33 substances, wherein 7 alcohols account for 61.85% of the area; 18 esters, accounting for 18.31 percent of the area; the aldehydes are 7, accounting for 0.74 percent of the area; 1 furan species, accounting for 0.208% of the area; the other compounds accounted for 19.1% of the area.

The mass spectrometry of volatile aroma components in the original Daqu fermentation liquor can obtain 28 substances, wherein 5 alcohols account for 60.74% of the area; 15 esters accounting for 12.92 percent of the area; the aldehydes are 7, accounting for 0.62 percent of the area; furan 1, accounting for 0.168% of the area; the other compounds accounted for 25.72% of the area. The other compounds mainly include hydrocarbons, nitrogen-containing compounds, and the like.

The fermentation liquid of the three strains respectively has 8, 7 and 6 substances which are slightly more than the reference substance. The main volatile aroma components are basically the same in type, alcohols mainly comprise ethanol, isoamyl alcohol and the like, esters mainly comprise ethyl acetate, ethyl hexanoate, ethyl palmitate and the like, and the main components are probably basically the same in type because the three high-yield ester strains are all derived from the Daqu and are co-fermented with the Daqu.

Fusel oil is a general name of monohydric alcohol substances with more than three carbons, and although the fusel oil has an aroma generating effect, if the content of the fusel oil in the white spirit is too high, the fusel oil has an effect on a toxic cellar of a human body, the poisoning and anesthetic effects on the human body are stronger than that of ethanol, the nervous system can be congested, and people can feel headache. The main components of the fusel oil are isoamyl alcohol and isobutanol which have high toxicity, so that the fusel oil is not only harmful to human bodies, but also brings evil and smell to the flavor of the wine. Fusel oil is one of the main sources of bitter taste or astringent taste of Chinese white spirit, and is also one of the reasons for white turbidity of Chinese white spirit. The wine contains the largest content of fusel oil such as isoamyl alcohol, isobutyl alcohol, normal propyl alcohol and the like. Isoamyl alcohol is usually the most abundant component in fusel oil, and is generally more than 45% and even more than 65% of the total fusel oil. When the content of isoamyl alcohol in the alcoholic beverage is too high, eyes and respiratory tracts of drinkers can be stimulated, and people can feel congested, headache, dizziness, nausea, vomiting and diarrhea on the head, which is one of the main reasons for getting drunk. The content of fusel oil in the white spirit is not more than 0.20g/100ml (calculated by isobutanol and isoamylol) according to the national standard. In the research, the daqu is strengthened by Y2, Y14 and Y18, so that the ethanol content in the alcohol fermentation liquor is obviously increased, and the isoamylol content is obviously reduced.

It can be further known from the table that the contents of ethanol and ethyl acetate in the fermentation liquor of the enhanced Daqu are obviously higher than those of the fermented Daqu by using the Y2, the Y14 and the Y18, and the content of fusel oil with the largest content, namely isoamyl alcohol, is also obviously reduced. In the esters, except ethyl butyrate and isobutyl acetate, the contents of other esters are improved to different degrees. In the main ester component, compared with other strain enhanced fermentation liquor and a contrast, the content of ethyl acetate in the Y14 enhanced Daqu fermentation liquor is the most, and is at least 2.3 times of that of the contrast; the content of isoamyl acetate and the content of ethyl hexanoate in the fermentation liquor of Y18 are the maximum, which are respectively at least 1.48 times and 1.15 times of that of the control, while the content of ethyl octanoate and the content of isoamyl acetate in the fermentation liquor of the enhanced Daqu of Y2 are the maximum. Therefore, different strains strengthen the yeast for fermentation, and the proportion of various flavor substances in the alcohol fermentation liquor in the total flavor substances is changed, so that different sensory qualities are presented.

4. The high-yield ester indigenous aroma-producing microzyme reinforced yeast is subjected to acetic fermentation:

4.1 laboratory Scale:

by diluting to 10⁷And (2) strengthening Daqu by using high-ester-yield indigenous aroma-producing yeasts Y2, Y14 and Y18 per ml, and then fermenting, wherein the total ml of the high-ester-yield indigenous aroma-producing yeast liquid is equal to the total g of the using amount of the Daqu when strengthening is performed, wherein the using amounts of Y14 and Y18 in the combined double strains of Y14 and Y18 respectively account for 50% of the total ml of the high-ester-yield indigenous aroma-producing yeast liquid.

After the alcoholic fermentation is finished, rice hulls and bran serving as auxiliary materials are added, the fermented mash is stirred into a solid state, and the adding ratio of the raw materials, the rice hulls and the bran is 1:1.2: 1.6. The alcohol fermented mash is transferred into a plastic barrel, fillers (175 kg of fine bran and 50 kg of coarse bran are added to every 100 kg of main materials) according to the actual production proportion of Shanxi mature vinegar are added, the water content is controlled to be 57-58%, the materials are uniformly stirred, 6% of vinegar mash (the vinegar mash fermented in the next day of the vinegar factory) is added, a self-made straw mat with good air permeability is covered, the vinegar mash is placed in an incubator at 25 ℃ for acetic fermentation, the temperature of the center and the periphery of the vinegar mash is measured every day, and the progress of the acetic fermentation is mastered all the time. The two days before the fermentation starts are the stage of firing the vinegar culture, the culture turning is not needed, the culture turning is started after the temperature of the vinegar culture rises on the third day, oxygen is provided for acetic acid fermentation, the culture turning is performed once every day at regular time, and the acetic acid fermentation is finished by the 9 th day of the fermentation.

Pouring vinegar: adding salt (5% of the raw material) on the 9 th day of acetic fermentation to finish the acetic fermentation, adding water with the same mass as the fermented grains of vinegar, stirring uniformly, soaking for 24h, and spraying vinegar with 100 mesh sieve.

The basic five indexes of the brewed vinegar are measured, namely total acid GB/T5009.41-2003, non-volatile acid GB18187-2000, reducing sugar GB19777-2005, total ester GB19777-2005 and amino nitrogen GB/T5009.39-1996.

The method simulates the fermentation mode of the liquid before and solid after the Shanxi mature vinegar to brew the vinegar under the laboratory conditions, and 7 kinds of vinegar are brewed in total and respectively: the vinegar brewed by Shanxi mature vinegar Daqu (contrast), the vinegar brewed by Y2, Y14 and Y18 single strains of mature vinegar Daqu respectively and Daqu co-fermentation, the vinegar brewed by double-strain compound and Daqu co-fermentation, and the vinegar brewed by three-strain compound and Daqu co-fermentation, because Y2 and Y18 both belong to Candida ethanolica, the combination of Y2+ Y18 is not arranged in the double-strain combination test, and the combination is respectively combined with Y14 and Pichia manshurica, and the significance analysis results of five indexes are shown in Table 7.

Table 7: five indexes and difference analysis of vinegar

From the above table, it can be seen that the content of total acids and total esters in vinegar can be significantly increased at a level of 1% by using Y2, Y14 and Y18 single strain enhanced or compound enhanced Daqu. For improving the total ester content in the vinegar, the 3-strain composite strengthening is superior to the double-strain composite strengthening, and the double-strain composite strengthening is superior to the single-strain strengthening. For total acid, the double-strain composite strengthening is obviously better than the three-strain composite strengthening. The content of non-volatile acid in the vinegar liquid is reduced except for the strengthening of single strain Y18. The analysis of the difference significance shows that the difference between the Y14+ Y18 enhanced group and the Daqu single fermentation group and the Y2+ Y14 group is not significant, the non-volatile acid in the vinegar liquid of the Y2 and Y14 single strain enhanced and three-strain enhanced groups is obviously lower than that of the control group, and the content of the non-volatile acid in the three-strain enhanced groups is the lowest, so that the double-strain composite enhancement is better than the three-strain composite enhancement in terms of the non-volatile acid. For reducing sugar content in vinegar, the strengthening of Y14+ Y18 double strains can obviously increase the content, the strengthening of Y18 single strains and the strengthening of Y2+ Y14 double strains have no obvious difference with a control, and the strengthening of three strains and the strengthening of Y2 and Y14 single strains can obviously reduce the content. For the content of amino nitrogen, only Y2 single strain strengthening is obviously higher than that of a control group, Y2+ Y18 and Y14+ Y18 double strain strengthening groups have no obvious difference with the control group, and the three-strain strengthening can obviously reduce the content of amino nitrogen.

The five indexes of total acid, total ester, non-volatile acid, reducing sugar and amino nitrogen in the vinegar liquid are comprehensively considered, and the contents of the total acid and the total ester in the vinegar liquid can be obviously increased by three high-ester-production yeasts Y2, Y14 and Y18 separated from the Daqu whether single-strain strengthening, double-strain strengthening or triple-strain strengthening. The Y14+ Y18 double-strain strengthening and the Y18 single-strain strengthening can also obviously increase the content of reducing sugar in vinegar liquid, and have no obvious influence on the content of amino nitrogen and nonvolatile acid; y14+ Y2 has no obvious influence on the content of reducing sugar and amino nitrogen, and the amount of non-volatile acid is obviously reduced; y2+ Y14+ Y18, besides having no effect on the non-volatile acids, significantly reduced the content of reducing sugars and amino nitrogen. Comprehensively considered, the strengthening effect Y14+ Y18 is better than Y14+ Y2, and the strengthening of the two strains is better than the strengthening of the three strains; y18 has good single strain strengthening effect, but the strengthening effect on total ester is obviously lower than that of double strain strengthening, and the total ester is an important factor for determining the quality and taste of vinegar. Although the contents of total acid and total ester in the vinegar liquid can be obviously increased by independently strengthening Y2 and Y14, and the content of non-volatile acid and reducing sugar in the vinegar liquid can be obviously reduced, and the sensory quality of the vinegar body is influenced, although the content of the total acid and the total ester in the vinegar liquid can be obviously increased and the amino nitrogen content is not obviously influenced.

In conclusion, the quality of the vinegar was evaluated from the five indexes, namely Y14+ Y18 double strain enrichment and Y18 single strain enrichment, and the vinegar was fermented by Daqu alone, so that Y14+ Y18> Y18> Daqu > Y2+ Y14> Y2+ Y14+ Y18> Y2/Y14 as a whole.

4.2 practical Scale of Vinegar works:

on the basis of laboratory bench scale test results, the method has better strengthening effectPichia manshurica(Y14) andCandida ethanolica(Y2 and Y18) double-strain enhanced combination (Y14 + Y2, Y14+ Y18) and single strain enhancement of Y18 are used for fermentation production of the Shanxi brewed vinegar. When the strain is strengthened, the use amounts of the Daqu and the strengthening strain are still determined according to the use amount of the main material. Activating strain for strengthening, culturing in YEPD liquid culture medium at 30 deg.C for 20 hr, counting, and diluting with sterilized water cooled to room temperature to 10 deg.C⁷The volume is ready for use. The total ml of yeast strains is equal to the g of yeast strains, and the single strains respectively account for 50% of the total ml in the double-strain strengthening. Y14+ Y18 and Y14+ Y2 double-strain strong in actual production of front mash and after-solidification processThe results of the effects of single strain enrichment of Y18 on the 5 basic indexes (g/100 ml) of vinegar are shown in Table 8, and the results of the effects of double strain enrichment of Y14+ Y18 and Y14+ Y2 and single strain enrichment of Y18 on the 5 basic indexes (g/100 ml) of vinegar in the actual production of the all-solid-state fermentation process are shown in Table 9.

As can be seen from tables 8 and 9, either the pre-mash and post-solids process or the all-solid fermentation process; no matter sorghum or corn is used as a raw material, the data still presents the rule of laboratory bench scale, and because of raw material treatment and temperature control in laboratory scale tests, the operation method completely simulates the actual production scale. In conclusion, in actual production, the double strain strengthening effect of the combination of Y14+ Y18 is the best, and Y18 is the next, and the two kinds of strengthening can obviously improve the content of total acid, total ester and reducing sugar in vinegar liquid without obviously influencing the content of organic acid and amino nitrogen. However, the esterificative effect of Y18 was significantly lower than that of the two-strain enrichment. The combination of Y14+ Y2 still resulted in a significant reduction in the amount of non-volatile acids in actual production. Unlike the laboratory scale, in the all-solid fermentation process, the combination of Y14+ Y2 significantly increased the amino nitrogen content in vinegar, and in the fore mash and after-solid process, the amino nitrogen content also tended to increase.

Table 8: the influence of double-strain fortification of Y14+ Y18 and Y14+ Y2 and single-strain fortification of Y18 on 5 basic indexes (g/100 ml) of vinegar in the actual production of the pre-mash and post-solidification process

Note: indicates significant differences in the same column compared to daqu fermentation alone (P < 0.05); a shows that the total ester content is remarkably different (P <0.05) compared with the single strain reinforcement of Y18.

Table 9: the effects of Y14+ Y18, Y14+ Y2 double strain enrichment and Y18 single strain enrichment on 5 basic indexes (g/100 ml) of vinegar in the actual production of the all-solid-state fermentation process

Note: indicates significant differences in the same column compared to daqu fermentation alone (P < 0.05); a shows that the total ester content is remarkably different (P <0.05) compared with the single strain reinforcement of Y18.

Sequence listing

<110> Shanxi university of agriculture

<120> method for improving contents of total acid esters and reducing sugar in table vinegar by using high-ester-yield indigenous aroma-producing yeast enhanced Daqu

<160>4

<170>PaUentIn Version 3.5

<210>1

<211>514

<212>RNA

<213> Artificial sequence

<223> rRNA gene D1/D2 region sequence of Pichia (Pichia manshurica) Y14

<400>1

1 AAATCGTGTT TCGGCACGAG TTGTAGAGTG TAGGCGGGAG TCTCTGTGGA GCGCGGTGTC

61 CAAGTCCCTT GGAACAGGGT GCCTGAGAGG GTGAGAGCCC CGTAGGGTGC TGCGCGAAGC

121 TTTTGAGGCC CTGCTGACGA GTCGAGTTGT TTGGGAATGC AGCTCCAAGC GGGTGGTAAA

181 TTCCATCTAA GGCTAAATAT TGGCGAGAGA CCGATAGCGA ACAAGTACTG TGAAGGAAAG

241 ATGAAAAGCA CTTTGAAAAG AGAGTGAAAC AGCACGTGAA ATTGTTGAAA GGGAAGGGTA

301 TTGGGCTCGA CATGGGGGGT GCGCACCGCT GTCTCTTGTA GGCGGCGCTC TGGGCGCCCT

361 CTGGGCCAGC ATCGGTTCCT GCTGCGGGAG AAGGGGCTCC GGAAAGTGGC TCTTCGGAGT

421 GTTATAGCCG GGGCCAGATG CCGCGTGTGG GGACCGAGGA CTGCGGCTTC TGTCTCGGAT

481 GCTGGCATAA CGGCGCAATA CCGCCCGTCT TGAA

<210>2

<211>534

<212>RNA

<213> Artificial sequence

<223> rRNA gene D1/D2 region sequence of Candida ethanolica (Candida ethonolic) Y18

<400>2

1 AAGCGGCAAG AGCTCAGATT TGAAATCGTG TTTCGGCACG AGTTGTAGAG TGTAGGCTGG

61 AGTCTCTGTG GAGCGCGGTG TCCAAGTCCC TTGGAACAGG GTGCCTGAGA GGGTGAGAGC

121 CCCGTGGGGT GCTGCGCGAA GCTTTGAGGC CCTGCTGACG AGTCGAGTTG TTTGGGAATG

181 CAGCTCTAAG CGGGTGGTAA ATTCCATCTA AGGCTAAATA TTGGCGAGAG ACCGATAGCG

241 AACAAGTACT GTGAAGGAAA GATGAAAAGC ACTTTGAAAA GAGAGTGAAA CAGCACGTGA

301 AATTGTTGAA AGGGAAGGGT ATTGGGCCCG ACATGGGGAG TGCGCACCGC TGTCTCTTGT

361 AGGCGGCGCT CTGGGCGCTC TCTGGGCCAG CATCGGTTCT TGCTGCGAGA GAAGTGGCGC

421 CGGAAAGTGG CTCTTCGGAG TGTTATAGCC GGTGCCGGAT GTCGCGTGCG GGGACCGAGG

481 GCTGCGACAT CTGTCTCGGA TGCTGGCACA ACGGCGCAAT ACCGCCCGTC TTGA

<210>3

<211>516

<212>DNA

<213> Artificial sequence

<223> sequence of D1/D2 region of 26s rDNA gene of Candida ethanolica (Candida ethonolic) Y2

<400>3

1 AAATCGTGTT TCGGCACGAG TTGTAGAGTG TAGGCGGGAG TCTCTGTGGA GCGCGGTGTC

61 CAAGTCCCTT GGAACAGGGT GCCTGAGAGG GTGAGAGCCC CGTGGGGTGC TGCGCGAAGC

121 TTTGAGGCCC TGCTGACGAG TCGAGTTGTT TGGGAATGCA GCTCTAAGCG GGTGGTAAAT

181 TCCATCTAAG GCTAAATACT GGCGAGAGAC CGATAGCGAA CAAGTACTGT GAAGGAAAGA

241 TGAAAAGCAC TTTGAAAAGA GAGTGAAACA GCACGTGAAA TTGTTGAAAG GGAAGGGTAT

301 TGGGCCCGAC ATGGGGAGTG CGCACCGCTG TCTCTTGTAG GCGGCGCTCT GGGCGCTCTC

361 TGGGCCAGCA TCGGTTCTTG CTGCGAGAGA AGTGGCGCCG GAAAGTGGCT CTTCGGAGTG

421 TTATAGCCGG TGCCGGATGT CGCGTGCGGG GACCGAGGGC TGCGACATCT GTCTCGGATG

481 CTGGCACAAC GGCGCAATAC CGCCCGTCTT GAACC

<210>4

<211>421

<212>DNA

<213> Artificial sequence

<223> Y2 (Candida ethonolic) 26s rDNA ITS sequence

<400>4

1 ATCTGAGGTC GAGCTCATAG TGCTCGGAGA CCCCAAGCGT CCTGTTCTAG TTCGCTCGTG

61 GCCTCGTTTC TTTTCGGCGG GGCCGTGGCC GGGCCAGCTC TGCGCAACTC TCGTCTTGCA

121 AGAAGGAAAC GACGCTCAGA CAGGCATGCC CGCCGGAATG CCGACGGGCG CAATGTGCGT

181 TCAAGAACTC GATGATTCAC GATGGCTGCA ATTCACACTA GGTATCGCAT TTCGCTGCGC

241 TCTTCATCGA TGCGAGAACC AAGAGATCCG TTGTTGAAAG TTTTGTGTTA AAATAAAAAC

301 TCCTGAACTA GTATACGTGT TTGTGTGTTG TGTGCGCTCA CGCAGTGTGG AACAATAATC

361 ACAGTAATGA TCCTTCCGCA GGTTCACCTA CGGAAACCTT GTTACGACtT TTTTACTTCCA

Claims (1)

1. A method for enhancing the content of total acid ester and reducing sugar in vinegar by utilizing high-ester-yield indigenous aroma-producing yeast is characterized by comprising the following steps: the method comprises the following steps:

separation of high ester-yielding indigenous aroma-producing yeast: collecting fermented grains fermented on the 3 rd day and the 6 th day by the traditional Shanxi mature vinegar process, respectively separating yeast by using a Bengal selective culture medium through a 10-fold decreasing gradient dilution method, coating 100uL of each gradient dilution sample liquid on a flat plate of the Bengal selective culture medium, performing inverted culture at 28 ℃ for 48h, further performing streak purification culture on a single colony with obvious colony characteristics on the Bengal selective culture medium for 2-3 times,transferring the purified product to a YEPD solid inclined plane, and storing the product at 4 ℃ for later use; two batches of separation and purification experiments are carried out to obtain the yeast, and the obtained yeast is subjected to colony morphology observation, microscopic examination, physicochemical characteristic detection, rRNA gene D1/D2 region sequence detection and identification, and wine production, ester production performance and environmental tolerance detection to finally obtain the high-ester-yield indigenous aroma-producing yeast: pichia (Pichia manshurica) Y14, Candida ethanolica (C. sp.) (C. ethanolica)Candida ethanolica)Y18；

Culturing a single strain of the indigenous aroma-producing yeast with high ester yield: inoculating Y14 and Y18 at 2% inoculum size in YEPD medium at 30 deg.C for 20 hr, respectively, diluting the strain with sterile water cooled to room temperature to 10%⁷/ml；

The high-yield ester indigenous aroma-producing microzyme reinforced yeast is subjected to acetic fermentation: by diluting to 10⁷Strengthening Daqu by using a single strain Y18 or a combined double strain Y14 and Y18 of high-ester-yield indigenous aroma-producing yeast per ml, and then performing acetic fermentation, wherein the total ml of the high-ester-yield indigenous aroma-producing yeast liquid is equal to the total g of the using amount of the Daqu during strengthening, and the using amounts of Y14 and Y18 respectively account for 50 percent of the total ml of the high-ester-yield indigenous aroma-producing yeast liquid during strengthening of the combined double strain;

the Pichia pastoris (Pichia manshurica) Y14 is cultured in wort liquid culture medium at 25 ℃ for three days, cells are spherical and oval, the size is 4.6-6.5 multiplied by 3.8-6.5mm, wort agar slant is cultured at 25 ℃ for 1 month, colony cheese is light white gray, the surface is smooth, the light reflection is avoided, and the edge is neat; culturing corn flour agar Dalmau on a flat plate without producing pseudo hypha; sequence detection and identification of rRNA gene D1/D2 region, and sequencing primers are as follows: NL1: GCA TAT CAA TAA GCG GAG GAA AAG; NL 4: GGTCCG TGT TTC AAG ACG G, respectively; the detection result is as follows: genbank sequence accession number is KP027538, and the base sequence is shown as SEQID NO: 1 is shown in the specification; activating the Y14 strain, inoculating the strain on a sodium acetate spore-forming culture medium plate, culturing for 4-5 days at 25 ℃, dyeing by using a spore dyeing method, observing the shape and the number of the ascospores by using a high power microscope, forming ascospores by Y14, and dyeing the ascospores by using malachite green to obtain blue, green or colorless ascospores; the preservation number of the Pichia (Pichia manshurica) Y14 is as follows: CGMCC NO.12407, the preservation unit is China general microbiological culture Collection center, the address is No. 3 of Xilu No.1 of Beijing Korean district, and the preservation date is 2016, 4 and 28 days;

the Candida ethanolica (C.) (Candida ethanolica) Y18 is cultured in wort liquid culture medium at 25 deg.C for three days, the cells are egg-shaped, sausage-shaped, and have a size of 4.0-7.2 × 3.0-5.2mm, and the malt agar is cultured at 25 deg.C for 1 month, the colony is cheese-shaped, light gray, smooth surface, non-reflective, and neat edge; culturing on corn flour agar Dalmau plate without producing false hypha; sequence detection and identification of rRNA gene D1/D2 region, and sequencing primers are as follows: NL1: GCA TAT CAA TAA GCG GAG GAA AAG; NL 4: GGT CCG TGT TTC AAG ACG G, respectively; the detection result is as follows: the Genbank sequence accession number is KP339953, and the base sequence is shown in SEQ ID NO: 2 is shown in the specification; activating the Y18 strain, inoculating the strain on a sodium acetate spore-forming culture medium plate, culturing for 4-5 days at 25 ℃, dyeing by a spore dyeing method, observing the shape and the number of the ascospores by a high power microscope, and enabling Y18 not to form ascospores and ascospores; the Candida ethanolica (C.) (Candida ethanolica) The Y18 deposit number is: CGMCC No. 12409, the preservation unit is China general microbiological culture Collection center, the address is No. 3 of West Lu No.1 of Shangyang district, Beijing, and the preservation date is 2016, 4 and 28 days.

Images