CN107164251A - One Accharomyces cerevisiae and its purposes for improving grape wine Ester content - Google Patents

Abstract

Purposes the invention discloses an Accharomyces cerevisiae and its for improving grape wine Ester content.The bacterial strain for being used to improve esters content in grape wine in the present invention is saccharomyces cerevisiae (Saccharomyces cerevisiae) SW1009, the bacterial strain is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on March 20th, 2017, and preserving number is CGMCC No.13440.It is demonstrated experimentally that Wine brewing yeast strain SW1009 has the advantages such as fermenting power strong, better tolerance, Ester content height, grape wine is produced using the strain fermentation cabernet sauvignon grape, Ester total amount is promoted to 19.77mg/L, so as to improve the quality of grape wine.

Description

One Accharomyces cerevisiae and its purposes for improving grape wine Ester content

Technical field

The invention belongs to microorganism field, it is related to an Accharomyces cerevisiae and its for improving grape wine Ester content Purposes.

Background technology

Grape wine is, using fresh grape or grape juice as raw material, to ferment what is brewed through saccharomycete etc., alcoholic strength is not less than 7.0% alcoholic beverages.

Grape wine is the drink of great individual character, and the wine style and features of different producing area are different, and this otherness is also exactly Where the glamour of grape wine.It is few to represent the excellent of place of production characteristic and the wine product homogeneity of China at present is serious Matter product, wherein it is most prominent be exactly that aroma quality is poor, lack producing region feature, this also turns into restriction China's grape and grape wine production One of principal element of industry development.

Saccharomyces cerevisiae is as the leading bacterial strain in Fermentation of Grape Wine, to grape wine quality, particularly fragrant in its place of production Decisive role is played in the performance of gas feature.It is grape wine fruity to be wherein metabolized the ester type compound produced by saccharomyces cerevisiae Main source, and different Esters has additive effect in fragrance perception each other, therefore in certain threshold range The increase of ester type compound concentration can strengthen perception of the people to grape wine fruity, and then improve the characteristic perfume of grape wine.

Therefore, the flavored type wine yeast strain seed selection for pointedly carrying out place of production characteristic fundamentally lifts grape wine Aroma quality, the market competitiveness important in inhibiting to improving China wine product.

The content of the invention

The invention provides an Accharomyces cerevisiae, made grape wine using the bacterial strain, Ester therein can be improved Content, so as to improve the quality of grape wine.

The bacterial strain that the present invention is used to improve grape wine Ester content is saccharomyces cerevisiae (Saccharomyces Cerevisiae) SW1009, it belongs to Ascomycotina (Ascomycota), Hemiascomycetes (Hemiascomycetes), ferment Female mesh (Saccharomycetales), Saccharomycetaceae (Saccharomycetaceae).The bacterial strain is protected on March 20th, 2017 It is hidden in China Committee for Culture Collection of Microorganisms's common micro-organisms center (abbreviation CGMCC, address：Chaoyang District, Beijing City north The institute 3 of occasion West Road 1, Institute of Microorganism, Academia Sinica), preserving number is CGMCC No.13440.

The Wine brewing yeast strain SW1009 that the present invention is provided be grape epidermis screen 1 plant of tolerance preferably, can produce The saccharomycete of more Ester, clusters culture by WL culture mediums and obtains.When being cultivated in WL culture mediums, surrounding milky, Centre protrusion is larger, shows slightly green, and opaque, growth is vigorous, and bacterium colony is larger, and when being cultivated on YPD solid mediums, bacterial strain is in Existing rice white, the bacterial strain is in YPD fluid nutrient mediums during 28 DEG C of cultures, and 6h can start fermentation, and 11h can be full of handstand Du Shi Tubule.

Present invention also offers the method using Wine brewing yeast strain SW1009 fermenting and producing grape wine, it is characterized in that,

1) picking Saccharomyces Cerevisiae in S W1009 inoculations are in YPD fluid nutrient mediums, and 26~30 DEG C of constant-temperature shaking cultures 18~ 32 hours, obtain seed liquor；

2) and then by seed liquor it is inoculated in the grape juice of precooling (being cooled to 6~8 DEG C in advance) that (inoculum concentration is 0.5 × 10⁶~ 3×10⁶Cfu/ml), after being kept for 2-3 days at 6~8 DEG C, then it is persistently overheating to 17~19 DEG C to fermentation liquid；

3) by fermentation liquid in after ferment at constant temperature at 17~19 DEG C 5~6 days, then fermentation liquid is persistently overheating to 26~28 DEG C, in ferment at constant temperature at this temperature when karusen proportion is between 0.992-0.995, fermentation ends.

Present invention also offers purposes of the Wine brewing yeast strain SW1009 in terms of Ester content is improved.

It is demonstrated experimentally that Wine brewing yeast strain SW1009 has, fermenting power is strong, better tolerance (ethanol tolerance and titanium dioxide Sulphur tolerance), the advantage such as Ester content height.Grape wine is produced using the strain fermentation cabernet sauvignon grape, production alcoholic strength is 12.79% (v/v), Ester total amount is 19.77mg/L (commercial yeast 71B and the D254 yeast point fermented under the same terms 15.68mg/L, 17.00mg/L are not produced), main ester type compound is ethyl acetate, acetic acid -2- phenethyl esters, ethyl hexanoate, pungent Acetoacetic ester, ethyl caprate and ethyl laurate, the fragrance of ripe berry can be increased through sensory evaluation to grape wine, therefore it can be with Improve the quality of grape wine.The zymotechnique of the present invention is simple simultaneously, need not add in addition for Production of Wine producer Plus new equipment, therefore had a good application prospect on Grape Wine Industry.

Brief description of the drawings

Fig. 1 is aspect graph of the bacterial strain on WL culture mediums；

Fig. 2 is the variation tendency of esters related gene (ATF1, FAA1, EHT1 and IAH1) expression quantity during strain fermentation Figure；

Fig. 3 is the GC-MS ion stream chromatograms that strain fermentation terminates rear grape wine.

Embodiment

Technical scheme is further described below in conjunction with the accompanying drawings, but is not limited thereto, it is every to this Inventive technique scheme is modified or equivalent substitution, without departing from the spirit and scope of technical solution of the present invention, all should be covered In protection scope of the present invention.

Embodiment 1：Wine brewing yeast strain SW1009 separation and identification

1. grape saccharomyces epidermica is enriched with

The complete grapes of about 20g (Yantai, cabernet sauvignon grape) are taken in 100ml sterilized waters, the enrichment of shaking table 170rpm room temperatures 30min。

2. saccharomycete is isolated and purified

Take 1ml to add in 9ml sterilized waters above-mentioned enriched liquid, carry out gradient dilution, 10 are diluted to respectively^-1To 10^-4No Same concentration, it is 10 to draw concentration gradient^-1To 10^-4Each 0.1mL of bacterium solution be coated on add chloramphenicol (100mg/L) WL culture Base flat board, 28h culture 7d, takes pictures, picking different shape feature single bacterium colony is inoculated in YPD solid mediums to flat-plate bacterial colony Inclined-plane, 28h cultures 1d is purified, 4 DEG C of preservations, and is sequenced.Yeast in the present invention is special in the form of WL culture mediums Levy and see Fig. 1.

3. the primary dcreening operation of high ester yield saccharomyces cerevisiae

By step 1) obtained by bacterial strain carry out fermenting power and tolerance (ethanol tolerance and sulfur dioxide tolerance) examination Test, Wine brewing yeast strain SW1009 fermenting power and tolerability results are shown in Table 1-2, the preferable bacterial strain of obtained tolerance makes Fermentation test is carried out with Cabernet Sauvignon, the higher bacterial strain of esters content is further chosen and is identified.Selected simultaneously in experimentation The commodity yeast strain D254 commonly used in the commodity yeast strain 71B and industrial production that take rich production ester is control.

3.1 strain fermentation power are analyzed

10ml YPD fluid nutrient mediums are taken to be sub-packed in test tube, being put into inverted Durham's fermentation tube (ensures hydraulically full culture Base and bubble-free), 121 DEG C of sterilizing 20min.After after culture medium cooling, 100mg/L chloramphenicol is added in culture medium, bamboo stick is used The a little yeast thalline of picking is accessed in above-mentioned sterilizing YPD fluid nutrient mediums, 28 DEG C of quiescent cultures, every 4h observations once, record The starting fermentation time of saccharomycete and gas are full of the time of Du Shi pipes.Experimental result is shown in Table 1.

The yeast strain ferments power experimental result of table 1

3.2 bacterial strain ethanol tolerances are analyzed

10mLYPD fluid nutrient mediums are taken to be sub-packed in test tube, being put into inverted Durham's fermentation tube (ensures hydraulically full culture medium And bubble-free), 121 DEG C of sterilizing 20min.After after culture medium cooling, in superclean bench, add 100mg/L's with liquid-transfering gun Chloramphenicol, and absolute ethyl alcohol is added, it is respectively 12% (v/v) to make volume fraction of ethanol in culture medium, a little with bamboo stick picking Yeast thalline is accessed in above-mentioned sterilizing YPD fluid nutrient mediums, 28 DEG C of quiescent culture 7d, records Yeast Growth developmental state, will The yeast of 12% (v/v) alcoholic strength is resistant to, continues to be inoculated in 14% (v/v) YPD fluid nutrient mediums and cultivates, then enter successively Row 16% (v/v), 18% (v/v), the analysis of 20% (v/v) saccharomycete tolerance.Experimental result is shown in Table 2.

The yeast strain tolerance test result of table 2

3.3 bacterial strain sulfur dioxide tolerances are analyzed

10ml YPD fluid nutrient mediums are taken to be sub-packed in test tube, being put into inverted Durham's fermentation tube (ensures hydraulically full culture Base and bubble-free), 121 DEG C of sterilizing 20min.After after culture medium cooling, in superclean bench, 100mg/L is added with liquid-transfering gun Chloramphenicol, and add the potassium metabisulfite aqueous solution (its concentration be 50% SO₂Solution), make SO in culture medium₂Concentration is 300mg/L, is accessed in above-mentioned sterilizing YPD fluid nutrient mediums, 28 DEG C of quiescent culture 7d with a little yeast thalline of bamboo stick picking, record Yeast Growth developmental state, will be resistant to 300mg/L SO₂Yeast, continue to be inoculated in 400m g/L SO₂YPD Liquid Cultures Cultivated in base, the analysis of 500mg/L and 600mg/L saccharomycete tolerance is then carried out successively.Experimental result is shown in Table 2.

By the preferable bacterial strain of obtained tolerance, fermentation test is carried out using Cabernet Sauvignon, further choose esters content compared with High bacterial strain SW1009 is identified.

4. bacterial strain SW1009 is identified

4.1 Microbiological Characteristics：When being cultivated in WL culture mediums, surrounding milky, centre protrusion is larger, shows slightly green, Opaque, growth is vigorous, and bacterium colony is larger, when being cultivated on YPD solid mediums, and rice white is presented in bacterial strain.

4.2 molecular biology identification

26S sequencings are carried out to bacterial strain SW1009, following result (SEQ No.1) is obtained：GAGGAAAAGAAACCAACCGGGA TTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTT GGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTG GCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAA TTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAA AAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTC CTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGC TTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTG GCATAATGGTTATATGCAGCCCGTCT。

Then its SW1009 bacterial strain 26S sequence is compared with other bacterial strains, comparison result is as shown in table 3.

The SW1009 bacterial strain 26S sequence alignment results of table 3

As can be seen from Table 3：The 26S sequences of the SW1009 bacterial strains of the present invention, with include 13 plants of wine brewing in Genbank Yeast Saccharomyces cerevisiae similarity is 99%, and its microbiologic properties meets retouching for saccharomyces cerevisiae kind State.In view of result above, Saccharomyces Cerevisiae in S accharomyces cerevisiae are accredited as by SW1009 bacterial strains.The bacterial strain is China Committee for Culture Collection of Microorganisms's common micro-organisms center (abbreviation CGMCC, ground are preserved on March 20th, 2017 Location：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica), preserving number is CGMCC No.13440。

Embodiment 2：

1. cabernet sauvignon grape fermentation test

1) YPD fluid nutrient mediums, composition (g/L) are prepared：Yeast extract (or yeast extract) 10, peptone 20, glucose 20, It is water that remaining, which is,；pH6.5±0.2；The YPD fluid nutrient mediums of preparation are sub-packed in 100ml triangular flasks, every bottle of 50ml, 121 DEG C go out Bacterium 20min.

2) picking Saccharomyces Cerevisiae in S W1009 inoculations are positioned over constant temperature culture oscillator, 28 in YPD fluid nutrient mediums DEG C, 170r/min culture 24h take 100 μ L thallus suspension liquids to dilute 200 times, take the μ L of dilution 10 in blood counting chamber, microscope Lower to count, each thalline is counted three times.

3) count after terminating according to 1 × 10⁶Cfu/ml inoculum concentration is inoculated in broken cabernet sauvignon grape juice (commercial yeast 71B and D254 are operated to specifications), inoculation is positioned over keeping temperature 2 days at 8 DEG C after terminating, then fermentation liquid is persistently risen Temperature is to 18 DEG C, in after ferment at constant temperature at 18 DEG C 5 days, then by persistently overheating to 26 DEG C of fermentation liquid, in ferment at constant temperature at this temperature.

The proportion of fermentation process monitor fermentation wine with dregs, treats karusen proportion (proportion of the water relative to 20 DEG C) between 0.992- When between 0.995, fermentation ends.After testing, it is 71B under 12.79% (v/v), same fermentation condition that SW1009, which produces alcoholic strength, Produce alcoholic strength 12.5% (v/v), D254 production alcoholic strengthes 12.84% (v/v).

2. the collection of Cabernet Sauvignon Grape Wine fragrance component

The volatile compound that above-mentioned fermentation is produced using CTC automatic samplers carry out pre-treatment, take 8ml grape wine in 2g sodium chloride is put into 20ml headspace sampling bottle, ml headspace bottle in advance, ml headspace bottle preheats 10min in Agitator, rear logical DVB/CAR/PDMS extracting heads extraction 50min is crossed, aroma substance is drawn, Agilent of finally entering 7890B gas chromatographic sample introductions mouthful, Parse 10min.

3.GC-MS analysis conditions

Analyzed using 5977A mass spectrographs, not shunt mode sample introduction, constant current mode, column flow 0.8mL/min, program Heating, 40 DEG C of initial temperature is raised to 45 DEG C with 1 DEG C of min, keeps 2min, and 84 DEG C are raised to 3 DEG C/min, keeps 2min, with 3 DEG C/ Min is raised to 120 DEG C, keeps 3min, is raised to 200 DEG C with 3 DEG C/min, 230 DEG C, run time are raised to 5 DEG C/min 250 DEG C of 71.667min, MSD transmission line, mass spectrum selection SCAN patterns are scanned.

The GC-MS ion streams chromatic graph of the flavor component of Cabernet Sauvignon Grape Wine is composed as shown in figure 3, the fragrance of Cabernet Sauvignon Grape Wine The analysis result of composition is shown in Table 4.It is compared with commercial yeast 71B and D254 fragrance component content is shown in Table 5.

The SW1009 of table 4 fermentation Cabernet Sauvignon Grape Wine Esters

The different yeast fermentation Cabernet Sauvignon Grape Wine Esters of table 5 compare

It can be seen that from table 1-2：Compared to existing commercial yeast 71B and D254, Wine brewing yeast strain of the invention SW1009 fermenting power and sulfur dioxide tolerance slightly has raising；Ethanol tolerance is obviously improved, and is improved than commercial yeast 71B 6%, 4% is improved than commercial yeast D254, increase rate is respectively 42.8% and 25%.

As can be seen from Table 5：Compared to existing commercial yeast 71B and D254, Wine brewing yeast strain SW1009 of the invention The total content of Ester composition be obviously improved, improve 4.09% than commercial yeast 71B, improved than commercial yeast D254 2.77%；Increase rate is respectively 26.08% and 16.29%.As can also be seen from Table 5：Detected altogether in the grape wine of the present invention Go out 18 kinds of Esters, main Ester composition is：Ethyl acetate, ethyl hexanoate, ethyl caprilate, ethyl caprate and acetic acid- 2- phenethyl esters.Compared to commercial yeast 71B and D254, the sad second for the grape wine that Wine brewing yeast strain SW1009 of the invention is brewageed Ester, ethyl hexanoate and acetic acid -2- phenethyl ester contents are significantly improved, and the content of especially ethyl caprilate is higher, is respectively increased 3.8% and 2.92%.Ethyl caprilate has like the fragrance of brandy and pleasantly sweet, and ethyl hexanoate is with Qu Xiang, pineapple odor type Fragrance, phenethyl acetate is a kind of rose fragrance with close sweet tea bottom note, and three has important work to the fragrance for improving grape wine With, therefore the present invention improves the quality of grape wine.

4. fermentation process esters related gene relative expression quantity analysis ethyl acetate, acetic acid -2- phenethyl esters, ethyl hexanoate, Ethyl caprilate, ethyl caprate and ethyl laurate.

Sampled in fermentation process, 6 points are taken altogether, saccharomyces cerevisiae RNA is extracted using Quan Shi King Companies kit, and And cDNA synthesis, and quantitative fluorescent PCR analysis are carried out, experimental result is shown in Fig. 2.Wherein ATF1 encoding Saccharomyces cerevisiaes 1 kind of alcohol acetyl transferase (AATase) in (Saccharomyces cerevisiae), this enzyme participates in the generation of acetic acid esters；IAH1 It is final esterase gene, the hypothesis active site sequence that is made up of Ala85-Cys86-Ser87-Ala88-Gly89, ginseng With acetic acid ester hydrolysis；The formation of ethyl ester is catalyzed by ethanol O-acyltransferase in yeast, and the enzyme is main by EHT1 and EEB1 Gene code；Ethyl ester biosynthesis is directly affected by its precursor substance medium chain fatty acid (MCFAs) concentration, while also long The concentration regulation and control of chain fatty acid acyl-CoA, FAA1 gene code acylCoA synthetases, regulation and control long acyl CoA synthesis.By Fig. 2 can be seen that in fermentation process, and Wine brewing yeast strain SW1009 4 gene expression amounts related to esters are in higher Expression quantity state.

SEQUENCE LISTING

<110>Agricultural Products Research Institute, Shandong Academy of Agricultural Sciences

<120>One Accharomyces cerevisiae and its purposes for improving grape wine Ester content

<130> 0

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 587

<212> DNA

<213>Saccharomyces cerevisiae（Saccharomyces cerevisiae）SW1009 26S sequences

<400> 1

gaggaaaaga aaccaaccgg gattgcctta gtaacggcga gtgaagcggc aaaagctcaa 60

atttgaaatc tggtaccttc ggtgcccgag ttgtaatttg gagagggcaa ctttggggcc 120

gttccttgtc tatgttcctt ggaacaggac gtcatagagg gtgagaatcc cgtgtggcga 180

ggagtgcggt tctttgtaaa gtgccttcga agagtcgagt tgtttgggaa tgcagctcta 240

agtgggtggt aaattccatc taaagctaaa tattggcgag agaccgatag cgaacaagta 300

cagtgatgga aagatgaaaa gaactttgaa aagagagtga aaaagtacgt gaaattgttg 360

aaagggaagg gcatttgatc agacatggtg ttttgtgccc tctgctcctt gtgggtaggg 420

gaatctcgca tttcactggg ccagcatcag ttttggtggc aggataaatc cataggaatg 480

tagcttgcct cggtaagtat tatagcctgt gggaatactg ccagctggga ctgaggactg 540

cgacgtaagt caaggatgct ggcataatgg ttatatgcag cccgtct 587

Claims (4)

1. Saccharomyces Cerevisiae in S accharomyces cerevisiae bacterial strains SW1009, the deposit number of the bacterial strain is CGMCCNo.13440。

2. the Wine brewing yeast strain SW1009 described in claim 1 is used to prepare grape wine, contain improving grape wine Ester Purposes in terms of amount.

3. a kind of method for preparing grape wine, it is characterized in that, fermented using Wine brewing yeast strain SW1009.

4. the method as claimed in claim 3 for preparing grape wine, it is characterized in that,

1) picking Saccharomyces Cerevisiae in S W1009 inoculations are in YPD fluid nutrient mediums, and 26~30 DEG C of constant-temperature shaking cultures 18~32 are small When, obtain seed liquor；

2) and then by seed liquor it is inoculated in the grape juice of precooling, continues after being kept for 2-3 days at 6~8 DEG C, then to fermentation liquid It is warming up to 17~19 DEG C；

3) by fermentation liquid in after ferment at constant temperature at 17~19 DEG C 5~6 days, then fermentation liquid is persistently overheating to 26~28 DEG C, In ferment at constant temperature at this temperature when karusen proportion is between 0.992-0.995, fermentation ends.