KR101629097B1 - Novel SNP marker for the levels of lauric acid in pig meats and method for determination of the levels of lauric acid using the same - Google Patents

Abstract

The present invention relates to a SNP marker for determining the content of lauric acid in pork, a primer set capable of detecting or amplifying the SNP marker, and a method for determining the content of lauric acid in pork using the same. The method for determining the content of lauric acid using the SNP marker and the primer set for determining the content of lauric acid in pork according to the present invention can select a parent having a high content of lauric acid in pork, It can help to raise the natural antimicrobial ability of the human being as well as to nurture the pig containing the acid.

Description

[0002] SNP markers for determining the content of lauric acid in pork and methods for determining the content of lauric acid in pork using the same [0002]

The present invention relates to a SNP marker for determining the content of lauric acid in pork, a primer set capable of detecting or amplifying the SNP marker, and a method for determining the content of lauric acid in pork using the same.

Medium chain fatty acids (MCFA) refers to fatty acids of 6-12 carbon atoms. It is a fatty acid with both fatty and alcoholic properties. It has the ability to permeate the biomembrane and the bactericidal properties to inhibit the growth of bacteria through induction of energy consumption. It is also used as detergent, surface active agent, food packaging . Especially, it is being developed as a feed additive for various animals due to the antibacterial and antifungal ability of MCFA, which is in a state of being able to eat.

Lauric acid (CH ₃ (CH ₂ ) 10 COOH), a type of saturated fatty acid, is a saturated fatty acid with 12 carbon atoms, also called dodecanoic acid, mainly contained in coconut oil and palm oil.

Korean Patent Laid-Open Publication No. 2013-0118650 relates to a SNP marker for predicting fatty acid composition of a hybrid pig. Correlation between the SNP found in the sequence of the SCD gene, which is a key element for converting the fatty acid chain into unsaturated fatty acid, To analyze the fatty acid composition of swine individuals. However, the correlation between SNP and the content of total unsaturated fatty acids in pigs is mainly suggested, and SNP analysis is an analysis system using restriction fragment length polymorphism (RFLP) After the amplification, two-step analysis including restriction enzyme treatment and electrophoresis reading and a time of at least 3 hours (based on 96 samples) are required. Thus, there has been no report on the genetic diagnostic technology that can determine the level of lauric acid in saturated fatty acids.

Accordingly, the present inventors have discovered SNP markers for determining the content of lauric acid in pork, developed a technique for determining the content of lauric acid in pork using the same, and have successfully used the pyrosequencing analysis to quickly determine the content of lauric acid The present invention has been completed.

Korean Patent Publication No. 2013-0118650

It is an object of the present invention to provide a SNP marker for determining the lauric acid content of pork.

It is another object of the present invention to provide a primer set for determining the content of lauric acid in pork.

It is another object of the present invention to provide a composition for determining the content of lauric acid in pork.

It is another object of the present invention to provide a kit for determining the content of lauric acid in pork.

It is another object of the present invention to provide a method for determining the lauric acid content of pork.

The present invention provides a single nucleotide polymorphism (SNP) marker for determining the lauric acid content of pork.

The SNP marker may be all or some of the polynucleotides including the SNP associated with the lauric acid content of the pork, more preferably all or some polynucleotides of the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, Most preferably, the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 is G or A at position 143, and a polynucleotide consisting of 5 to 100 consecutive bases comprising the 143 < th > base, or a complementary polynucleotide thereof Lt; RTI ID = 0.0 > SNP < / RTI > marker for determining the content of lauric acid in the pork.

As used herein, the term "single nucleotide polymorphism " (SNP) is also referred to as a single nucleotide polymorphism, and refers to a genetic change or mutation that shows a difference in one nucleotide sequence (A, T, G, C) .

In one embodiment of the present invention, SEQ ID NO: 1 refers to a base sequence of 206 bp of the product obtained by PCR amplification using a primer set consisting of primers consisting of the nucleotide sequences of SEQ ID NO: 2 and SEQ ID NO: 3 of the present invention 2).

In one embodiment of the present invention, a genome-scale association of the content of lauric acid in pork loin using a large SNP chip for the offspring obtained by crossing Jeju native pig and land race pig study, GWAS) showed that SNPs related to the content of lauric acid in pork loin were present on chromosome 12 (SSC12) (Fig. 1). Of the 64,000 SNPs analyzed, the highest SNP associated with the content of lauric acid in pork loin was found to be MARC0030345. The SNP (g.143G> A) The acid content level was changed. As a result of genotyping analysis using pyrosequencing, it was confirmed that the content of lauric acid was different according to the G / G genotype, G / A genotype and A / A genotype, which are SNP (g.143G> A) (FIG. 4), and it was confirmed that the lauric acid content level was significantly increased as the A copy number increased in the SNP (Table 4).

The SNP marker of the present invention can be determined that, when the polymorphic site of the SNP marker is an A / A or G / A genotype, the pig containing the SNP marker has a higher level of lauric acid than the general pig.

In addition, the present invention provides a primer set capable of detecting or amplifying SNP markers for determining the lauric acid content of pork.

The primer set may be a primer set consisting of primers consisting of the nucleotide sequences of SEQ ID NO: 2 and SEQ ID NO: 3.

In one embodiment of the present invention, the 5'-terminus of the primer consisting of the nucleotide sequence of SEQ ID NO: 3 is prepared in a form in which biotin is bound for pyrosequencing.

As used herein, the term " pyrosequencing "is a next-generation DNA sequencing technique, which is capable of analyzing a plurality of nucleotide sequences in a single analysis. Pyrosequencing techniques are well known to those of ordinary skill in the art.

As used herein, the term "primer" is a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming a base pair with a template of a complementary nucleic acid, Refers to a short nucleic acid sequence that serves as a starting point for strand duplication. The primer can initiate DNA synthesis in the presence of a reagent for polymerization reaction (i. E., DNA polymerase) at a suitable buffer solution and temperature.

The present invention also provides a composition for determining the content of lauric acid in pork, which comprises the primer set.

The composition for determining the lauric acid content of pork may further comprise a sequence primer.

The sequence primer may be a primer that can be used for pyrosequencing of the PCR product obtained using the primer set.

The sequence primer may be a primer consisting of the nucleotide sequence of SEQ ID NO: 4.

The composition may be a composition for use in PCR amplification, and may further comprise a PCR reaction mixture. The PCR reaction mixture may include any well-known in the art, for example, but not limited to, dNTPs, DNA polymerases, and buffers.

The present invention also provides a kit for determining the content of pork lauric acid comprising the composition for determining the content of pork lauric acid.

The kit may be a PCR kit, and may be a PCR kit including essential elements necessary for performing PCR.

The kit of the present invention can determine the level of lauric acid in pork by confirming the SNP marker, which is a marker for determining the level of lauric acid in pork, through amplification.

In addition,

1) isolating DNA from the pig;

2) preparing a primer set consisting of a primer consisting of the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 3;

3) performing PCR (polymerase chain reaction) amplification using the DNA isolated in step 1) as a template and using the primer set prepared in step 2); And

4) determining the SNP genotype of the PCR product of step 3).

The pig in step 1) means a pig to which the level of lauric acid is to be determined. By analyzing the genotype of the SNP marker using the DNA isolated from the pig, the level of lauric acid in the pig can be determined have.

The DNA of step 1) above may be DNA extracted from all tissues such as blood, hair follicle, and muscle of pig, but is not limited thereto.

The PCR reaction of step 3) above may be carried out at an annealing temperature of preferably 60-64 ° C, most preferably 62 ° C.

The SNP genotype of the above step 4) can be determined by a conventional method for determining the nucleotide sequence, and pyrosequencing is preferably used, but not limited thereto. Specifically, the genotype can be determined by annealing the PCR product and the sequence primer and performing pyrosequencing.

In one embodiment of the present invention, "pyrosequencing" is performed by subjecting the PCR product to a specific treatment to obtain single-stranded DNA, annealing the single-stranded DNA with a sequence primer and then using a pyrosequencing device . At this time, dNTPs were sequentially added to extend the sequence primer, the remaining nucleotides were removed by apyrase, and the DNA sequence was determined by detecting fluorescent signals emitted from the bound nucleotides.

The sequence primer may be a primer consisting of the nucleotide sequence of SEQ ID NO: 4.

The polymorphism of the polymorphism comprising the nucleotide sequence of SEQ ID NO: 1 in step 4) is characterized in that when the allele of the 143th base at the SNP position is A / A or G / A in the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, It can be determined to be higher.

As used herein, the term "amplification reaction" refers to a reaction to amplify a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. (LCR) (see, for example, A Laboratory Manual, 3rd Ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822) 17,18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) 19 (WO 88/10315) (US Ser. No. 6,410, 276), self-sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence priming polymerase chain The consensus sequence primed polymerase chain reaction (CPPCR) (U.S. Patent No. 4,437,975), the random (US Pat. Nos. 5,413,909 and 5,861, 245), nucleic acid sequence based amplification (NASBA) (US Pat. No. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification (21,22), and loop mediated isothermal amplification. (LAMP) 23, but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

The method for determining the content of lauric acid using the SNP marker and the primer set for determining the content of lauric acid in pork of the present invention can select a parent species having a high content of lauric acid in the pork. At a time when the consumption pattern of pork is changing from a simple protein supply trend to a preference for higher quality meat, a younger generation with a genetic background capable of producing more pork containing the functional fatty acid lauric acid And the finishing pigs that will be produced in future generations to be created through the selection of the corresponding pigs may contain higher levels of lauric acid in the pork. Therefore, pigs containing lauric acid, which exhibits antibacterial activity, can be cultivated, and the natural antimicrobial activity of human beings can be improved.

1 is a graph showing the results of GWAS analysis of lauric acid content of offspring pigs using SNP chips.
Fig. 2 is a diagram showing the DNA sequence of MARC0030345 containing a SNP determining the content of porcine lauric acid and the binding position of the primer set according to the present invention. Fig.
3 is a diagram showing electrophoresis results of candidate SNP regions of SSC12 amplified using Lauric_F (SEQ ID NO: 2) and Lauric_R (SEQ ID NO: 3) primer sets:
Leftmost lane, 100 bp DNA ladder; And
The remaining 6 lanes, 6 different pigs each DNA.
FIG. 4 is a diagram showing pyrosequencing results of a PCR product amplified using a primer set according to the present invention. FIG.

Hereinafter, the present invention will be described in more detail in the following examples. It should be noted, however, that the following examples are illustrative only and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

Example 1 Identification of SNPs Associated with Lauric Acid Content in Pork

The content of lauric acid in pork loin was measured by using high capacity SNP chip (BeadChip Array Porcine SBP60v2, Illumina) for the offspring (F2 reference group, n = 1,025) obtained by crossing Jeju traditional pig and land race pig. Genome-scale association study (GWAS) was performed.

As a result of GWAS analysis, it was confirmed that SNPs related to the content of lauric acid in pork loin were present on chromosome 12 (SSC12) (FIG. 1).

In addition, the highest seven SNPs correlated with the content of lauric acid in the pork loin were calculated and the calculated P-value, -log (P-value). In Table 1, the P-value indicating the correlation between the SNP genotype and the lauric acid content showed a value of 3.46 x 10 ^-7 , which is much lower than 0.001, which is highly significant in MARC0030345, indicating a very high level of statistical significance , And among the 64,000 SNPs analyzed, the highest SNP associated with the content of lauric acid in pork loin was MARC0030345 (Table 1).

SNP location position P - log (P) MARC0030345 SSC 12 58934290 3.46 x 10 ^-7 6.488383979 MARC0017535 SSC 12 58604400 3.25 x 10 ^-7 6.461426266 ALGA0104820 SSC 12 57002739 1.10 x 10 ^-6 5.957030927 ASGA0055250 SSC 12 58093644 1.15 x 10 ^-6 5.938547521 DIAS0000861 SSC 12 58132333 1.32 x 10 ^-6 5.879097182 DIAS0002957 SSC 12 61898188 3.32 x 10 ^-6 5.478338985 ALGA0107813 SSC 12 62837875 3.72 x 10 ^-6 5.429924295

<Example 2> Analysis of SNP genotype by pyrosequencing analysis

<2-1> Preparation of primers for pyrosequencing analysis

Genotype analysis using pyrosequencing was performed to prepare a primer capable of detecting the SNP MARC0030345 mutation identified in Example 1, which is shown in Table 2.

division SEQ ID NO: primer  designation primer  direction The sequence (5 '- &gt; 3') Bonding temperature PCR  Length of product ( bp ) PCR primer 2 Lauric_F Forward GGCCCCCATTTATTGTTTCT 62 ° C 206 3 Lauric_R Reverse GAACTTGGATCACTTGCCAAA Pyrosequencing Primer 4 Lauric_seq GAGAGATGATTGTGGAGGT 54 ℃

As shown in Table 2, PCR primers Lauric_F (SEQ ID NO: 2) and Lauric_R (SEQ ID NO: 3) were constructed to amplify the gene sequence including the SNP MARC0030345 which is related to the content of lauric acid in pork. Among the above primers, the 5'-end of the Lauric R primer was prepared in a biotin-bound form for pyrosequencing. Sequence primer Lauric_seq (SEQ ID NO: 4) was also prepared for pyrosequencing.

The SNP MARC0030345 gene sequence containing the SNP and the binding position of the primers are shown in Fig. The underlined sequence represents the binding site of the primer, and the sequence within the square brackets represents the SNP base mutation corresponding to MARC0030345 (FIG. 2).

&Lt; 2-2 > PCR amplification test of the base sequence including SNP

Six whole pigs from the National Livestock Research Institute Nanji Livestock Experiment Station were prepared. The leukocytes were dissolved in a nuclei lysis solution (27% sucrose, 1X SSC, 1 mM EDTA, 1% SDS) and 200 μg / ml proteinase K in the prepared samples, Protein was removed by sedimentation using sodium acetate. The DNA was then recovered by adding an equal amount of iso-propanol and extracted by dissolving in TE buffer (10 mM Tris, pH 7.4; 1 mM EDTA). Each of the DNAs extracted from six pigs was subjected to PCR using Lauric_F and Lauric_R primers prepared in Example <2-1>.

Specifically, 100 ng of pig DNA extracted in primer sets (Lauric_F and Lauric_R) and 0.4 units of DNA polymerase were added to a 10X PCR buffer and amplified using PTC-200 (MJ Research, USA). 30 sec denaturation at 95 deg. C, 45 sec annealing at 62 deg. C, and 45 sec elongation at 72 deg. C for 35 times. The PCR amplification product was electrophoresed on a 1.5% agarose gel for 15 minutes with a 100 bp DNA ladder (Bioneer, Korea) and stained with EtBr.

As a result of the amplification, a 206 bp PCR product was amplified in all six samples (FIG. 3). FIG. 3 shows the results of PCR amplification of DNA isolated from six pigs using Lauric_F and Lauric_R primers. As a result of DNA sequencing, the PCR products obtained from six pig DNAs all had a length of 206 bp. From these results, it was found that the primers Lauric_F and Lauric_R of the present invention can specifically amplify the base sequence including the SNP of the present invention.

<2-3> Genotype analysis of SNP

A test was conducted to read out the genotype of the PCR product amplified in Example < 2-2 >. The 206 bp PCR product containing the amplified SNP MARC0030345 was combined with the Lauric_seq primer and subjected to pyrosequencing analysis.

Specifically, the amplified PCR product was heat-treated at 80 ° C for 2 minutes to obtain single-stranded DNA. 5 pmol of a Lauric_seq primer, which is a pyrosequencing primer, was annealed to the single-stranded DNA. Sequence primers can be added to the annealed DNA using exonuclease deficient (exo- Klenow DNA polymerase), apyrase, purified luciferase, recombinant ATP sulfurylase Recombinant ATP sulfurylase, substrate and dNTP were added and pirosequencing was performed using an automated pyrosequencing device (PyroMark Q96 ID, Qiagen). At this time, dNTPs were sequentially added to extend the sequence primer, and the remaining nucleotides were removed by apyrase. Fluorescence signals emitted from the coupled nucleotides were detected by a CCD camera mounted on the sequencing device.

As a result of pyrosequencing, genotype of SNP (g.143G> A) locus was determined. The results of the genotyping were shown in FIG. 4, and it was confirmed that G / G, G / A, and A / A all appeared (FIG.

<Example 3> Relationship between the SNP genotype and the content of lauric acid in pork

Generation analysis of SNP genotypes of 1,025 offspring of two generations obtained by crossing Jeju traditional pig and land lace pigs with the above primers was performed and the content of lauric acid in pigs having each SNP genotype was compared.

The effect of genetic polymorphism on the measured lauric acid content was estimated using the general linear model (GLM) procedure of SAS ver 8.01 program package / PC. The statistical model used Y = μ + SNP + ε , where Y = phenotype, μ = total mean, SNP = effect of SNP marker, ε = random residual value, and no gender effect was considered. Differences in mean values were tested by Duncan's multiple range test.

As a result, the content of lauric acid in the pork loin having g.143A / A or g.143G / A was found to be 0.003% or more as compared with G / G (Table 3).

MARC0030345 Genotype of Of lauric acid (C12_0) LS mean Standard error G / G 0.0948 0.0013 G / A 0.0984 0.0014 A / A 0.0978 0.0018

Therefore, it was found that the content of lauric acid in pork was higher when the genotype of SNP MARC0030345 was A / A or G / A than when the genotype was G / G.

<110> Jeju National University Industry-Academic Cooperation Foundation <120> Novel SNP marker for the levels of lauric acid in pig meats and          method for determination of the levels of lauric acid using the          same <130> P14U19D1344 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 206 <212> DNA <213> Sus Scrofa <400> 1 ggcccccatt tattgtttct ctgagagatt ttgtgtctca ggaagcacct gttgttccca 60 atttacacac caattcaaat aatacagtgt ccccaaaaac gctatgtgta cccctgttgg 120 cgtgagagat gattgtggag gtrcagcaca ggtctgtcat aaaatgtgct aagggataac 180 ttttttttgg caagtgatcc aagttc 206 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lauric_F <400> 2 ggcccccatt tattgtttct 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Lauric_R <400> 3 gaacttggat cacttgccaa a 21 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Lauric_seq <400> 4 gagagatgat tgtggaggt 19

Claims (11)

delete As a primer set capable of detecting or amplifying a single nucleotide polymorphism (SNP) marker for determining the content of lauric acid in pork,
The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 is G or A in the 143th nucleotide, the polynucleotide is composed of 5 to 100 consecutive bases containing the 143th nucleotide, or a complementary polynucleotide thereof, and
Wherein the primer set is composed of a primer consisting of the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 3, wherein the primer set is a primer set for determining the content of lauric acid in pork.
A composition for determining the content of lauric acid in pork comprising the primer set of claim 2.
The method of claim 3,
A composition for determining the content of lauric acid in pork, which further comprises a sequence primer that can be used for pyrosequencing of the PCR product obtained using the primer set.
5. The method of claim 4,
Wherein the sequence primer is a primer consisting of the nucleotide sequence of SEQ ID NO: 4. 2. A composition for determining the content of lauric acid in pork,
A kit for determining the content of pork lauric acid comprising the composition of any one of claims 3 to 5.
1) isolating DNA from the pig;
2) preparing a primer set consisting of a primer consisting of the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 3;
3) performing a PCR reaction using the DNA isolated in step 1) as a template and using the primer set prepared in step 2); And
4) determining the SNP genotype of the PCR product of step 3), comprising the steps of:
The polymorphism of the polymorphism comprising the nucleotide sequence of SEQ ID NO: 1 in step 4) is characterized in that when the allele of the 143th base at the SNP position is A / A or G / A in the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, &Lt; / RTI &gt;
8. The method of claim 7,
Wherein the PCR reaction of step 3) is characterized in that the annealing temperature is 60-64 占 폚.
8. The method of claim 7,
Wherein the determination of the SNP genotype in step 4) comprises annealing the PCR product and the sequence primer and performing pyrosequencing.
10. The method of claim 9,
Wherein the sequence primer is a primer comprising the nucleotide sequence of SEQ ID NO: 4. delete

Images