KR101472323B1 - SNP marker for the prediction of fatty acid composition of intercross pig population - Google Patents

SNP marker for the prediction of fatty acid composition of intercross pig population Download PDF

Info

Publication number
KR101472323B1
KR101472323B1 KR1020120041710A KR20120041710A KR101472323B1 KR 101472323 B1 KR101472323 B1 KR 101472323B1 KR 1020120041710 A KR1020120041710 A KR 1020120041710A KR 20120041710 A KR20120041710 A KR 20120041710A KR 101472323 B1 KR101472323 B1 KR 101472323B1
Authority
KR
South Korea
Prior art keywords
polynucleotide
seq
snp
nucleic acid
fatty acid
Prior art date
Application number
KR1020120041710A
Other languages
Korean (ko)
Other versions
KR20130118650A (en
Inventor
임현태
박희복
이재봉
유채경
정은지
이준헌
디아마하라니
정우영
Original Assignee
경상대학교산학협력단
충남대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경상대학교산학협력단, 충남대학교산학협력단 filed Critical 경상대학교산학협력단
Priority to KR1020120041710A priority Critical patent/KR101472323B1/en
Publication of KR20130118650A publication Critical patent/KR20130118650A/en
Application granted granted Critical
Publication of KR101472323B1 publication Critical patent/KR101472323B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/124Animal traits, i.e. production traits, including athletic performance or the like
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 건강한 교잡종 돼지 개체를 선별하기 위해, 서열번호 1의 핵산서열로부터 선택되며, 상기 서열번호 1의 1,817번째 또는 15,384번째 염기인 SNP를 포함하는 10개 이상의 연속적인 핵산으로 구성되는 교잡종 돼지의 지방산 조성 예측용 폴리뉴클레오티드 또는 그에 상보적인 폴리뉴클레오티드를 제공한다.The present invention relates to a method for screening a healthy crossbred pig, which comprises selecting from a nucleic acid sequence of SEQ ID NO: 1 and comprising 10 or more consecutive nucleic acids comprising a SNP that is the 1,817th or 15,384th base of SEQ ID NO: 1 A polynucleotide for predicting fatty acid composition or a polynucleotide complementary thereto is provided.

Description

교잡종 돼지의 지방산 조성 예측용 SNP 마커{SNP marker for the prediction of fatty acid composition of intercross pig population}SNP markers for predicting fatty acid composition of a crossed pig (SNP marker for the prediction of fatty acid composition of intercross pig population)

본 발명은 SNP 마커에 관한 것으로서, 더 상세하게는 교잡종 돼지의 지방산 조성 예측용 마커에 관한 것이다.The present invention relates to a SNP marker, and more particularly to a marker for predicting fatty acid composition of a hybrid pig.

육류에서의 식이 지방산(fatty acid, FA)은 인간 건강과 관련되어 있다. 막 유동성과 세포-세포 상호작용에서의 지방산(saturated FA, SFA)과 불포화지방산(unsaturated FA, UFA)의 비율은 암, 당뇨, 비만, 고혈압 및 신경질환과 같은 다양한 인간 질병과 밀접한 관련이 있다고 알려지고 있다(Ntambi, J. M., Prog. Lidpid Res., 34: 139-150, 1995). 포화지방산의 과도한 섭취는 혈중 콜레스테롤 농도의 상승을 야기하고, 이는 심혈관계 질환으로 발전한다. 라우르산(lauric acid, C12:0), 미리스트산(myristic acid, C14:0) 및 팔미트산(palmitic acid, C16:0)과 같은 포화지방산은 대부분 심혈관계 건강에 해로운 영향을 미친다(Keys, A., Am. J. Clin. Nutr., 27: 188-212, 1974). 반면, 단일 불포화지방산(monounsaturated FA, MUFA)와 다중 불포화지방산(polyunsaturated FA, PUFA)는 간의 LDL 수용체 활성을 증가시킴으로써 저밀도 리포프로테인(low density lipoprotein, LDL)-콜레스테롤의 순환 농도를 낮춘다(Woollett et al., J. Lipid Res., 33: 77-88, 1992).Fatty acid (FA) in meat is associated with human health. The ratio of fatty acids (saturated FA, SFA) to unsaturated fatty acids (unsaturated FA, UFA) in membrane fluidity and cell-cell interactions is closely related to various human diseases such as cancer, diabetes, obesity, hypertension and neurological diseases (Ntambi, JM, Prog. Lidpid Res ., 34: 139-150, 1995). Excessive intake of saturated fatty acids leads to elevated blood cholesterol levels, which develop into cardiovascular disease. Saturated fatty acids such as lauric acid (C12: 0), myristic acid (C14: 0) and palmitic acid (C16: 0) have a detrimental effect on cardiovascular health Keys, A., Am. J. Clin. Nutr ., 27: 188-212, 1974). On the other hand, monounsaturated FA (MUFA) and polyunsaturated FA (PUFA) decrease the circulating concentration of low density lipoprotein (LDL) -cholesterol by increasing LDL receptor activity in the liver (Woollett et al , J. Lipid Res ., 33: 77-88, 1992).

스테아르산대 올레산의 비율은 막 유동성의 균형에 영향을 미치는 가장 중요한 요소의 하나이다(Ntambi, J. M., Prog. Lidpid Res., 34: 139-150, 1995; Zulkifli et al., J. Anim. Sci., 88: 2565-2575, 2010). SCD(stearoyl-CoA desaturase) 유전자는 소포체와 세포막에 위치한 효소를 암호화하는데, 상기 효소는 UFA 합성에서 FA 기질의 9번째 델타 위치에서 시스 이중결합 하나를 삽입함으로써 상기 비율의 균형 유지에 기여하는 것으로 알려져 있다(Ren et al., Anim. Genet., 34: 471-473, 2003). 상기 SCD 유전자는 형광 원위치(in situ) 혼성화와 혼성 패널 매핑에 의해 돼지에서는 SSC 14 좌위에 위치하는 것으로 밝혀졌다(Ren et al., Anim. Genet., 34: 471-473, 2003). 소에서는 SCD 다형현상(polymorphism)과 FA 조성의 연관성에 대한 몇몇 연구가 보고된 바 있다(Ohsaki et al., Anim. Sci. J., 80: 225-232, 2009; Taniguchi et al., Mamm. Genome, 15: 142-148, 2004). 돼지에서는 듀록(Duroc) 순종(purebred)에 대한 연구에서는 SCD 유전자와 지방 관련 형질 사이의 관련성에 대하여 조사하였는데, 상기 유전자와 등지방의 두께 사이에는 아무런 상관관계가 없다고 보고하였다(Ren et al., Gene, 340: 19-30, 2004). 그러나, 최근 연구에 의하면 상기 SCD 유전자의 프로모터 부위에 위치하고 있는 SNP들이 지방산 조성과 녹는점에 대하여 강한 상관관계가 있다고 보고된 바 있다(Uemoto et al., Anim. Genet., 43(2): 225-228, 2012). 많은 인자들이 지방산 조성의 변화에 영향을 미치는데, 품종의 차이 역시 돼지에서의 변이의 주요 요소 중의 하나로 보고된 바 있다(Zhang et al., J. Anim. Breed Genet., 126: 259-268, 2009). The ratio of stearic acid to oleic acid is one of the most important factors affecting the balance of membrane fluidity (Ntambi, JM, Prog. Lidpid Res ., 34: 139-150, 1995; Zulkifli et al ., J. Anim. Sci . 88: 2565-2575, 2010). The SCD (stearoyl-CoA desaturase) gene encodes an enzyme located in the endoplasmic reticulum and in the cell membrane, which is known to contribute to the balance of the ratio by inserting a cis double bond at the 9th delta position of the FA substrate in UFA synthesis (Ren et al ., Anim. Genet. , 34: 471-473, 2003). The SCD gene was found to be located at the SSC 14 locus in the pig by in situ hybridization and hybrid panel mapping (Ren et al ., Anim. Genet. , 34: 471-473, 2003). Several studies have been reported on the association of SCD polymorphism with FA composition in cattle (Ohsaki et al ., Anim. Sci ., 80: 225-232, 2009; Taniguchi et al ., Mamm. Genome , 15: 142-148, 2004). In pig studies on Duroc purebred, the association between SCD gene and fat-related traits has been investigated, and there is no correlation between the gene and the thickness of the back room (Ren et al ., Gene , ≪ / RTI > 340: 19-30, 2004). However, recent studies have shown that SNPs located at the promoter region of the SCD gene have a strong correlation with the fatty acid composition and melting point (Uemoto et al ., Anim. Genet ., 43 (2): 225 -228, 2012). Many factors influence the changes in fatty acid composition, and varietal differences have also been reported as one of the major components of the mutation in pigs (Zhang et al ., J. Anim. Breed Genet ., 126: 259-268, 2009).

그러나 Uemoto 등에서 확인한 SNP 마커는 포화지방산(SFA), 불포화지방산(UFA) 및 단일불포화지방산(MUFA)와는 상관관계가 없기 때문에, 보다 효율적인 지방산 조성 예측 마커로 활용하기 어려운 점이 있다.However, since SNP markers identified by Uemoto et al. Have no correlation with saturated fatty acids (SFA), unsaturated fatty acids (UFA) and monounsaturated fatty acids (MUFA), they are difficult to be used as markers for predicting fatty acid composition more efficiently.

본 발명은 상기와 같은 문제점을 포함하여 여러 문제점들을 해결하기 위한 것으로서, 잡종 돼지의 고기에서, 스테아르산 뿐만 아니라 다른 지방산, 특히 포화지방산, 불포화지방산 및 단일불포화지방산의 함량을 예측할 수 있는 SNP 마커를 제공하는 것을 제공하는 것을 목적으로 한다. 그러나 이러한 과제는 예시적인 것으로, 이에 의해 본 발명의 범위가 한정되는 것은 아니다.DISCLOSURE OF THE INVENTION The present invention has been made to solve the above problems and to solve the above problems, and it is an object of the present invention to provide SNP markers capable of predicting the content of stearic acid as well as other fatty acids, especially saturated fatty acids, unsaturated fatty acids and monounsaturated fatty acids And the like. However, these problems are exemplary and do not limit the scope of the present invention.

본 발명의 일 관점에 따르면, 서열번호 1의 핵산서열로부터 선택되며, 상기 서열번호 1의 1,817번째 염기가 C 또는 T인 단일염기다형(SNP) 또는 15,384번째 염기가 A 또는 G인 SNP를 포함하는 10개 이상의 연속적인 핵산으로 구성되는 교잡종 돼지의 지방산 조성 예측용 폴리뉴클레오티드 또는 그에 상보적인 폴리뉴클레오티드.가 제공된다.According to one aspect of the present invention, a single nucleotide polymorphism (SNP) selected from the nucleotide sequence of SEQ ID NO: 1, wherein the 1,817th nucleotide of SEQ ID NO: 1 is C or T, or SNPs wherein the 15,384th nucleotide is A or G There is provided a polynucleotide or a complementary polynucleotide thereof for predicting fatty acid composition of a hybrid pig having 10 or more consecutive nucleic acids.

상기 폴리뉴클레오티드에 있어서, 상기 교잡종 돼지는 랜드레이스종과 한국재래종 사이의 교잡종일 수 있고, 상기 교잡종 돼지는 잡종 2세대(F2)일 수 있다.In the polynucleotide, the hybrid pig may be a hybrid between a land race species and a Korean native species, and the hybrid pig may be a hybrid second generation (F 2 ).

본 발명의 다른 일 관점에 따르면 상기 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드와 특이적으로 혼성화하는 폴리뉴클레오티드가 제공된다.According to another aspect of the present invention there is provided a polynucleotide that specifically hybridizes with the polynucleotide or a complementary polynucleotide thereof.

상기 폴리뉴클레오티드에 있어서, 상기 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드와 특이적으로 혼성화하는 폴리뉴클레오티드가 대립 유전자 특이적 프로브 또는 대립 유전자 특이적 프라이머일 수 있다.In the polynucleotide, a polynucleotide that specifically hybridizes with the polynucleotide or a complementary polynucleotide thereof may be an allele-specific probe or an allele-specific primer.

본 발명의 또 다른 일 관점에 따르면, 상기 중 어느 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 증폭할 수 있는 프라이머 쌍을 포함하는 교잡종 돼지 지방산 조성 예측용 키트가 제공된다.According to another aspect of the present invention, there is provided a kit for predicting the composition of a hybrid of pigs, which comprises any of the above polynucleotides or a pair of primers capable of amplifying the polynucleotide.

본 발명의 또 다른 일 관점에 따르면, 교잡종 돼지로부터 게놈 DNA를 추출하는 게놈 DNA 추출단계; 상기 추출된 게놈 DNA를 주형으로 서열번호 1의 핵산서열로부터 선택되며, 상기 서열번호 1의 1,817번째 염기가 C 또는 T인 단일염기다형(SNP) 또는 15,384번째 염기가 A 또는 G인 SNP를 포함하는 10개 이상의 연속적인 핵산으로 구성되는 폴리뉴클레오티드를 증폭할 수 있는 프라이머쌍으로 상기 폴리뉴클레오티드를 증폭하는 증폭단계; 상기 증폭된 폴리뉴클레오티드를 SNP 특이적 제한효소로 절단하는 폴리뉴클레오티드 절단단계; 및 상기 절단된 폴리뉴클레오티드를 전기영동하여 밴드 패턴을 분석하는 밴드 패턴 분석단계를 포함하는 교잡종 돼지의 지방산 조성 예측방법이 제공된다.According to another aspect of the present invention, there is provided a method for extracting genomic DNA comprising the steps of: extracting genomic DNA from a hybrid pig; Wherein the extracted genomic DNA is selected from the nucleic acid sequence of SEQ ID NO: 1 as the template and the single nucleotide polymorphism (SNP) in which the 1,817th nucleotide of SEQ ID NO: 1 is C or T or the SNP of 15,384th nucleotide is A or G An amplification step of amplifying the polynucleotide with a pair of primers capable of amplifying a polynucleotide consisting of 10 or more consecutive nucleic acids; A polynucleotide cleaving step of cleaving the amplified polynucleotide with an SNP-specific restriction enzyme; And a band pattern analysis step of analyzing the band pattern by electrophoresis of the cleaved polynucleotide.

상기 예측방법에 있어서, 상기 프라이머쌍은 서열번호 2 및 3 또는 서열번호 8 및 9의 핵산서열을 갖는 프라이머쌍일 수 있다.In the prediction method, the primer pair may be a primer pair having a nucleic acid sequence of SEQ ID NOs: 2 and 3 or SEQ ID NOs: 8 and 9.

상기 예측방법에 있어서, 상기 SNP 특이적 제한효소는 HpyCH4IV 또는 AciI일 수 있다.In the above prediction method, the SNP-specific restriction enzymes may be Hpy CH4IV or Aci I.

상기한 바와 같이 이루어진 본 발명의 일 실시예에 따르면, 돼지 특히 교잡종 돼지에서 지방산의 조성, 특히 스테아르산을 포함한 포화지방산 및 단일불포화지방산을 포함한 불포화지방산의 조성까지 예측할 수 있기 때문에, 건강한 돼지 개체의 선별에 활용할 수 있어, 인간 건강에도 도움이 되는 고부가가치 돈육 생산에 활용가능하다. 물론 이러한 효과에 의해 본 발명의 범위가 한정되는 것은 아니다.According to one embodiment of the present invention as described above, since it is possible to predict the composition of fatty acids in pigs, particularly, crossbred pigs, especially unsaturated fatty acids including saturated fatty acids and monounsaturated fatty acids including stearic acid, It can be used for selection, and it can be used for the production of high value added pork which is helpful to human health. Of course, the scope of the present invention is not limited by these effects.

도 1은 본 발명의 일 실시예에 따른 SNP1의 유전자형과 지방산 조성과의 상관관계를 나타내는 일련의 그래프이다.
도 2은 본 발명의 일 실시예에 따른 SNP12의 유전자형과 지방산 조성과의 상관관계를 나타내는 일련의 그래프이다.
도 3은 본 발명의 일 실시예에 따른 SNP의 조합에 의한 일배체형을 나타내는 하플로뷰(a) 및 세가지 조합의 일배체형의 빈도를 나타내는 표(b)이다.
1 is a series of graphs showing the correlation between the genotype of SNP1 and the fatty acid composition according to an embodiment of the present invention.
FIG. 2 is a series of graphs showing the correlation between the genotype of SNP 12 and the fatty acid composition according to an embodiment of the present invention.
FIG. 3 is a flowchart (a) showing a haplotype by combination of SNPs according to an embodiment of the present invention and a table (b) showing the frequency of haplotypes of the three combinations.

이하, 실시예를 통하여 본 발명을 설명하기로 한다. 그러나 본 발명은 이하에서 개시되는 실시예에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 수 있는 것으로, 이하의 실시예는 본 발명의 개시가 완전하도록 하며, 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이다. Hereinafter, the present invention will be described by way of examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

실시예Example

실시예 1: 랜드레이스종과 한국재래종 사이의 잡종 2세대(FExample 1: Hybridization between Landrace and Korean native species The second generation (F 22 ) 돼지의 생산Production of pigs

웅성 랜드레이스(Landrace) 종 8두와 자성 한국재래종 11두를 교배시켜서 잡종 1세대(F1) 43두를 얻었고, 웅성 한국재래종 8두와 자성 랜드레이스 9두를 교배하여 F1 48두를 얻었다. 상기 F1 돼지를 상호 교배하여 1111두의 잡종 2세대(F2) 돼지를 얻었다. 부모세대를 포함하여 교배 집단은 1238두였고, F2 웅성 돼지 중 어느 것도 거세하지 않았다. 모든 실험 동물들은 비육 기간(fattening period)동안 동일한 사료로 급이하였다. 이들 돼지들은 유사한 나이에 도축하였는데, 평균 도축일은 생후 199일째였다. 모든 실험적인 교배와 사료 급이는 제주도 소재의 국립축산과학연구원의 난지축산시험장에서 이루어졌다. 돼지의 관리에 관한 상세한 사항은 Cho 등(Anim. Genet., 42: 621-626, 2011)에 기재된 바와 같다.Fourteen hybrid (F 1 ) seedlings were obtained by crossing 8 Landrace species and 11 Korean native species. Fifty eight F1 seeds were obtained by crossing 8 Korean native species and 9 magnetic land races. The F 1 pigs were crossbred to obtain 1111 two hybrid (F 2 ) pigs. There were 1238 breeders, including their parents, and none of the F 2 male pigs were castrated. All experimental animals were fed with the same feed during the fattening period. These pigs were slaughtered at a similar age, the average slaughtering day was 199 days after birth. All experimental mating and feeding were conducted at the National Livestock Research Institute 's Nanji Livestock Experiment Station in Jeju Island. Details regarding the management of pigs are as described in Cho et al . ( Anim. Genet ., 42: 621-626, 2011).

실시예 2: 지방산 분석Example 2: Fatty acid analysis

근육조직 시료를 1100두 이상의 F2 돼지로부터 채취하여 지방산 조성 분석에 사용하였다. 각 시료에서의 근육내 지방을 종래 방법에 따라 클로로포름-메탄올(2:1, v/v)을 이용하여 추출하였고(Folch et al., J. Biol. Chem., 226: 497-509, 1957), 지방추출물을 종래 방법에 따라 지방산 메틸 에스테르로 전환시켰다(Morrison et al., J. Lipid Res., 5: 600-608, 1964). 지방산 메틸 에스테르의 분리와 정량은 가스 크로마토그래피(6890N, Agilent Technologies, Germany)를 이용하여 수행하였다. 그 결과, 표 1에 나타난 바와 같이, SFA, UFA, MUFA 및 PUFA를 포함하는 18 가지 지방산이 각 돼지 시료에서 검출되었고, 전체 SFA 조성이 MUFA 보다 낮으나, PUFA 보다는 높은 것으로 나타났다. 이러한 결과는 단위동물육(monogastric meat)에서 SFA가 반추동물육(ruminant meat) 보다 덜 포화되어 있는 것과 일치한다(Smet et al., Anim. Res., 53: 81-98, 2004). 흥미로운 점은, 카프르산(capric acid, C10:0)가 본 연구에서 검출되었다는 점이다. 카프르산은 경구 박테리아를 광범위하게 저해하는 것으로 여겨지는데 부가적인 박테리아의 군집화를 억제함으로써 균총을 유지하는데 기여할 수 있다.Muscle tissue samples were taken from more than 1100 F 2 pigs and used for fatty acid composition analysis. The intramuscular fat in each sample was extracted using chloroform-methanol (2: 1, v / v) according to conventional methods (Folch et al ., J. Biol. Chem ., 226: 497-509, 1957) , Fat extracts were converted to fatty acid methyl esters according to conventional methods (Morrison et al ., J. Lipid Res ., 5: 600-608, 1964). Separation and quantification of fatty acid methyl esters were carried out using gas chromatography (6890N, Agilent Technologies, Germany). As a result, as shown in Table 1, 18 fatty acids including SFA, UFA, MUFA and PUFA were detected in each pig sample, and the total SFA composition was lower than that of MUFA but higher than that of PUFA. These results are consistent with SFA being less saturated than ruminant meat in monogastric meat (Smet et al ., Anim. Res ., 53: 81-98, 2004). Interestingly, capric acid (C10: 0) was detected in this study. Capric acid is believed to broadly inhibit oral bacteria, which can contribute to maintaining the colonies by inhibiting the clustering of additional bacteria.

F2 돼지의 지방산 조성Fatty acid composition of F 2 pig 표현형Phenotype 이름name 표본수Number of samples 평균Average 표준편차Standard Deviation 최소at least 최대maximum C10:0 (%)C10: 0 (%) 카프르산Capric acid 974974 0.110.11 0.020.02 0.050.05 0.190.19 C12:0 (%)C12: 0 (%) 라우르산Lauric acid 974974 0.100.10 0.010.01 0.060.06 0.160.16 C14:0 (%)C14: 0 (%) 리리스트산Rilistan 975975 1.571.57 0.200.20 0.670.67 2.682.68 C16:0 (%)C16: 0 (%) 팔미트산Palmitic acid 970970 25.0425.04 1.321.32 20.820.8 29.2529.25 C16:1 (%)C16: 1 (%) 팔미톨레산Palmitoleic acid 976976 3.153.15 0.500.50 1.531.53 4.614.61 C17:0 (%)C17: 0 (%) 마가르산Magar mountain 972972 0.220.22 0.060.06 0.010.01 0.400.40 C17:1 (%)C17: 1 (%) 마가르 올레산Magar oleic acid 971971 0.250.25 0.040.04 0.090.09 0.450.45 C18:0 (%)C18: 0 (%) 스테아르산Stearic acid 957957 13.6713.67 1.121.12 10.3710.37 18.5018.50 C18:1 (%)C18: 1 (%) 올레산Oleic acid 972972 40.8840.88 3.753.75 26.726.7 52.0652.06 C18:2 (%)C18: 2 (%) 리놀레산Linoleic acid 976976 11.4211.42 3.503.50 4.504.50 25.8425.84 C18:3 (%)C18: 3 (%) 알파-리놀레산Alpha-linoleic acid 975975 0.470.47 0.110.11 0.220.22 0.840.84 C20:0 (%)C20: 0 (%) 아라키드산Arachidic acid 972972 0.220.22 0.040.04 0.120.12 0.360.36 C20:1 (%)C20: 1 (%) 가돌레산Garolestan 975975 0.730.73 0.080.08 0.400.40 1.111.11 C20:4 (%)C20: 4 (%) 아라키돈산Arachidonic acid 974974 2.192.19 1.321.32 0.160.16 8.858.85 SFA (%)SFA (%) 포화지방산Saturated fatty acid 971971 40.8440.84 2.092.09 32.3932.39 46.9646.96 UFA (%)UFA (%) 불포화지방산Unsaturated fatty acid 968968 59.1459.14 2.042.04 53.0453.04 65.0365.03 MUFA (%)MUFA (%) 단일 불포화지방산Monounsaturated fatty acid 974974 44.9944.99 4.044.04 27.8327.83 56.6656.66 PUFA (%)PUFA (%) 다중 불포화지방산Polyunsaturated fatty acid 976976 14.1114.11 4.694.69 5.195.19 29.8829.88

실시예 3: 게놈 분석Example 3: Genome analysis

3-1: SNP 확인3-1: SNP check

본 발명자들은 부모세대와 F2 돼지의 혈액 시료로부터 표준 슈크로스-프로테이나제 K 방법을 이용하여 게놈 DNA를 추출하였다. 부모의 게놈 DNA 시료를 모아서 대량 평행 서열결정 기술(massive parallel sequencing technology, HiSequ2000, Illumina Inc., USA)을 이용하여 유전자 지역을 포함한 전체 돼지 게놈에서 SNP(single nucleotide polymorphism)을 확인하였다. 그 결과, 표 2에 나타난 바와 같이, SCD 유전자 내에서 총 16개의 SNP를 확인할 수 있었다. 상기 16개의 SNP 중 오직 하나(SNP1)만이 엑손 2에 위치하였고, 나머지 15개는 모두 3' UTR(untraslated region)에 위치하였다. 이 중 SNP2(rs80954581)와 SNP12 (rs80917505)는 공지의 SNP이나, SNP1과 SNP13을 포함한 나머지 14개의 SNP는 본 발명자에 의해 최초로 보고된 신규 SNP이다.The present inventors extracted genomic DNA from blood samples of parental and F 2 pigs using the standard sucrose-proteinase K method. Parental genomic DNA samples were collected and analyzed for SNP (single nucleotide polymorphism) in whole pig genomes including gene regions using massive parallel sequencing technology (HiSequ2000, Illumina Inc., USA). As a result, as shown in Table 2, a total of 16 SNPs were found in the SCD gene. Only one of the 16 SNPs (SNP1) was located in exon 2, and all 15 were located in the 3 'UTR (untraslated region). Of these, SNP2 (rs80954581) and SNP12 (rs80917505) are known SNPs, and the remaining 14 SNPs including SNP1 and SNP13 are new SNPs reported for the first time by the present inventors.

3-2: 유전자형 분석3-2: Genotype analysis

이어, 개별 돼지의 유전자형을 분석하기 위해, F2 돼지의 게놈 DNA 시료를 PCR-제한 단편 길이 다형분석(PCR-RFLP) 기반 유전자형 분석을 위해 사용하였다. 이 때 유전자형 분석에 사용한 SNP는 SNP1, SNP12 및 SNP13이었다. 상기 세 개의 SNP는 제한효소를 구하기 용이하고 RFLP 밴드 패턴이 확실하게 구분되므로 분석이 용이한 장점이 있다. SCD 유전자의 증폭을 위한 PCR 프라이머는 표 2에 기재된 바와 같이 50 ng의 게놈 DNA, 10x 완충액 혼합물, 및 10 mM dNTPs(GenetBio, Korea)를 포함하는 PCR 반응혼합물에 상기 표 2에 기재된 프라이머쌍 각각 5 pmol과 Taq DNA 폴리머라제 5 U를 첨가한 후 94℃에서 10분간 열변성시킨 후, GeneAmp PCR System 2700(Applied Biosystems, USA) 또는 C1000TM Thermal Cycler(BioRad Laboratories, USA)를 이용하여 94℃ 30초, 62℃ 30초, 및 72℃ 30초를 35회 반복한 후 72℃에서 10분간 최종연장을 수행하였다. PCR 산물은 1.5% 표준 아가로스 겔 상에서 브롬화 이티디움(ethidium bromide)으로 시각화하였다. 상기 PCR 산물 15 μl와 2 U의 각 제한효소를 포함하는 20 μl의 반응 부피에서 절단한 후 절단된 산물을 3% 아가로스 겔 상에서 전기영동하여 밴드 패턴을 분석하였다. 제한효소로는 HpyCH4IV(SNP1), AciI(SNP12) 및 MspI(SNP13)을 사용하였다. 상기 세 SNP의 유전자형과 대립유전자 빈도는 표 3에 나온 바와 같다.Next, to analyze the genotype of individual pigs, genomic DNA samples of F 2 pigs were used for PCR-restriction fragment length polymorphism (PCR-RFLP) -based genotyping. At this time, SNPs used for genotyping were SNP1, SNP12 and SNP13. The three SNPs are easy to obtain restriction enzymes and are easy to analyze because the RFLP band pattern is clearly distinguished. PCR primers for amplification of the SCD gene were prepared by adding 5 ng of the primer pairs described in Table 2 to a PCR reaction mixture containing 50 ng of genomic DNA, 10x buffer mixture, and 10 mM dNTPs (GenetBio, Korea) After denaturation at 94 ° C for 10 min, PCR was performed using GeneAmp PCR System 2700 (Applied Biosystems, USA) or C1000 TM Thermal Cycler (BioRad Laboratories, USA) at 94 ° C for 30 seconds , 62 < 0 > C for 30 seconds, and 72 < 0 > C for 30 seconds, followed by a final extension at 72 [deg.] C for 10 minutes. The PCR product was visualized on a 1.5% standard agarose gel with ethidium bromide. The PCR products were cut at a reaction volume of 20 μl containing 15 μl and 2 U of each restriction enzyme, and the cleaved products were analyzed by electrophoresis on a 3% agarose gel. As restriction enzymes, Hpy CH4IV (SNP1), Aci I (SNP12) and Msp I (SNP13) were used. The genotypes and allele frequencies of the three SNPs are as shown in Table 3.

PCR 증폭 및 PCR-RFLP에 사용된 프라이머 및 관련 SNPPCR amplification and PCR-primers and related SNPs used in RFLP 프라이머명Primer name 핵산서열(서열번호)Nucleic acid sequence (SEQ ID NO) PCR 산물 크기
(위치)
PCR product size
(location)
SNP 명칭SNP name
SCD-P1-FSCD-P1-F TGAAGTGGCCCCTAGTGTCT(서열번호: 2)TGAAGTGGCCCCTAGTGTCT (SEQ ID NO: 2) 307 bp
(엑손 2)
307 bp
(Exon 2)
g.817C>T* (SNP 1)
 
g.817C > T * (SNP 1)
SCD-P1-RSCD-P1-R CATACAGGGCTCCCAAGTGT(서열번호: 3)CATACAGGGCTCCCAAGTGT (SEQ ID NO: 3) SCD-P2-FSCD-P2-F GTCCCTTGGGTTCCTTTTCT(서열번호: 4)GTCCCTTGGGTTCCTTTTCT (SEQ ID NO: 4) 756 bp
(엑손 6에서3' UTR)
756 bp
(3 'UTR in exon 6)
g.12544A>G (SNP 2)
g.12682A>G (SNP 3)
g.12739T>C (SNP 4)
g.12818G>A (SNP 5)
g.12918T>C (SNP 6)
g.13055A>G (SNP 7)
g.12544A > G (SNP 2)
g.12682A > G (SNP 3)
g.12739T > C (SNP 4)
g.12818G > A (SNP 5)
g.12918T > C (SNP 6)
g.13055A > G (SNP 7)
SCD-P2-RSCD-P2-R GGACACTGGGATGTGCTTTT(서열번호: 5)GGACACTGGGATGTGCTTTT (SEQ ID NO: 5) SCD-P3-FSCD-P3-F AAAAGCACATCCCAGTGTCC(서열번호: 6)AAAAGCACATCCCAGTGTCC (SEQ ID NO: 6) 475 bp
(엑손 6에서 3' UTR)
475 bp
(3 'UTR in exon 6)
g.13311C>G (SNP 8)
g.13417G>A (SNP 9)
g.13311C > G (SNP 8)
g.13417G > A (SNP 9)
SCD-P3-RSCD-P3-R CCCCCATTCTTCCTCTTCTC(서열번호: 7)CCCCCATTCTTCCTCTTCTC (SEQ ID NO: 7) SCD-P4-FSCD-P4-F GCCTTCTAGCCTCAAGCGTA(서열번호: 8)GCCTTCTAGCCTCAAGCGTA (SEQ ID NO: 8) 722 bp
(엑손 6에서 3' UTR)
722 bp
(3 'UTR in exon 6)
g.13956A>G (SNP 10)
g.14378G>A (SNP 11)
g.14384G>A (SNP 12)
g.14424C>T (SNP 13)
g.13956A > G (SNP 10)
g. 14378G > A (SNP 11)
g.14384G > A (SNP 12)
g.14424C > T (SNP 13)
SCD-P4-RSCD-P4-R GTGCTGTAGGGAATGCTGGT(서열번호: 9)GTGCTGTAGGGAATGCTGGT (SEQ ID NO: 9) SCD-P5-FSCD-P5-F ATGGAGGATAAAGGGGTTGG(서열번호: 10)ATGGAGGATAAAGGGGTTGG (SEQ ID NO: 10) 570 bp
(엑손 6 에서 3' UTR)
570 bp
(3 'UTR in exon 6)
g.14884A>G (SNP 14)
g.15066C>G (SNP 15)
g.15198C>A (SNP 16)
g.14884A > G (SNP 14)
g. 15066C > G (SNP 15)
g.15198C > A (SNP 16)
SCD-P5-RSCD-P5-R CCACTTCTGCAGGCTCTCA(서열번호: 11)CCACTTCTGCAGGCTCTCA (SEQ ID NO: 11)

*: 숫자는 전사개시점으로부터의 위치를 의미함 * : The number indicates the position from the transfer start point.

SNP1, SNP12 및 SNP13의 유전자형 및 대립유전자 빈도Genotype and allele frequency of SNP1, SNP12 and SNP13 SNP SNP 대립유전자 빈도Allele frequency 유전자형 빈도Genotype frequency SNP1 g.817C>TSNP1 g.817C > T C
0.76
C
0.76
T
0.24
T
0.24
CC
0.55
CC
0.55
CT
0.42
CT
0.42
TT
0.03
TT
0.03
SNP12 g.14384G>A SNP12 g.14384G> A G
0.82
G
0.82
A
0.18
A
0.18
GG
0.66
GG
0.66
GA
0.32
GA
0.32
AA
0.02
AA
0.02
SNP13
g.14424C>T
SNP13
g.14424C> T
C
0.62
C
0.62
T
0.38
T
0.38
CC
0.40
CC
0.40
CT
0.45
CT
0.45
TT
0.15
TT
0.15

단일 SNP 모형을 SCD 유전자의 SNP 및 유전자형과 지방산 조성과의 사이에 관련성(association)을 분석하기 위해 사용하였다. 각 FA형질을 AsReml 프로그램(VSN International, UK)에서 실행되는 혼합-효과 모형을 이용하여 상기 교배집단내에서의 혈연관계를 보정하기 위한 무작위 다원 유전(random polygenic) 효과와 고정 공변량 효과(fixed covariate effects, 예: 성(sex), 출산경력(parity), 도체중량(carcass weight))을 설정하였다. 상기 혼합-효과 모형으로부터 산출된 잔차를 종속변수로 사용하였고 SNP 표지를 독립변수로 하여 하기 일변량 분산분석 (One-way ANOVA)을 수행함으로써 SCD 유전자의 각 SNP 표지의 변이와 FA 조성 형질의 잔차 사이의 관련성을 조사하였다. A single SNP model was used to analyze association between SCD gene SNP and genotype and fatty acid composition. Each FA trait was analyzed using a random-polygenic effect and a fixed covariate effect to correct blood relations in the mated group using a mixed-effect model run in the AsReml program (VSN International, UK) , For example, sex, parity, and carcass weight). One-way ANOVA was performed using the residuals calculated from the mixed-effect model as a dependent variable and the SNP label as an independent variable. The variation of the SNP markers of the SCD gene and the residuals of the FA composition trait .

YY ijij =μ+= μ + gg ii + ε ijij

상기 식에서 Y ij 는 혼합-효과 모형로부터 도출된 잔차 데이터이고, μ는 전체 평균이며, g i 는 SCD 유전자의 SNP 유전자형(세 가지 계열)의 효과이고, ε ij 는 무작위 오차이다. 상기 유전자형의 효과 사이의 짝 차이점(pair-wise difference)를 평가하기 위해, Tukey 동시 다중 분석을 수행하였다. 0.01 미만의 p 값이 나올 경우 통계적으로 유의한 것으로 간주하였다. Y ij is the residual data derived from the mixed-effect model, μ is the overall average, g i is the effect of the SNP genotype (three classes) of the SCD gene, and ε ij is the random error. In order to evaluate the pair-wise difference between the effects of the genotypes, Tukey simultaneous multiplex analysis was performed. A p value <0.01 was considered statistically significant.

그 결과, 본 발명자들은 SCD 유전자 내에서 SNP1과 SNP12가 7 가지 지방산 형질(팔미트산(C16:0), 스테아르산(C18:0), 올레산(C18:1), 아라키드산(C20:0), 포화지방산(SFA), 불포화지방산(UFA) 및 단일 불포화지방산(MUFA))과 매우 높은 유의성을 나타냄을 규명하였다. 반면에, SNP13의 경우 오직 아라키드산(C20:0, p=3.0x10-3)과 유의한 관계를 모였다. 상기 두 SNP(SNP1 및 SNP12)의 효과와 FA 형질 사이의 잔존 평균은 p 값과 SNP에 의해 설명되는 표현형 변이와 함께 설명된다(도 1 및 2).As a result, the present inventors found that SNP1 and SNP12 in the SCD gene have seven fatty acid traits (palmitic acid (C16: 0), stearic acid (C18: 0), oleic acid (C18: 1), arachidic acid ), Saturated fatty acid (SFA), unsaturated fatty acid (UFA) and monounsaturated fatty acid (MUFA)). On the other hand, only arachidic for SNP13: gathered (C20 0, p = 3.0x10 -3 ) , and a significant relationship. The survival averages between the effects of the two SNPs (SNP1 and SNP12) and the FA trait are explained with the p value and the phenotypic variation explained by the SNP (Figures 1 and 2).

한편, 본 발명자들은 일배체형과 지방산 조성 사이의 상관관계를 분석하기 위해, Haploview 프로그램 버전 4.1(Barrett et al., Bioinformatics, 21: 263??265, 2005)을 이용하여 Gabriel 등(Science, 296: 2225-2229, 2002)에 기술된 연관불균형(linkage disequilibrium, LD)의 짝 측정(pairwise measure)를 계산함으로써 SNP 마커 사이의 LD를 측정하였다.Meanwhile, the present inventors used Gabriel et al . ( Science , 296: 265, 2005) to analyze the correlation between the haplotype and fatty acid composition, using the Haploview program version 4.1 (Barrett et al ., Bioinformatics , The LD between the SNP markers was measured by calculating a pairwise measure of linkage disequilibrium (LD) as described in US Pat.

그 결과, 도 3에 나타난 바와 같이, 두 개의 SNP(SNP1 및 SNP12)는 강한 연관불균형(D'=0.952)를 가지는 것으로 나타났고 일배체형 1(CA)의 빈도는 70% 이상인 것으로 나타났다. 따라서, SNP1과 SNP12 사이의 재조합은 거의 일어나지 않는 것으로 보인다. 도 1 및 2 상으로도 매우 유사한 유전 양상이 나타나는데, 두 SNP 사이에 거의 완전한 연관불균형을 보여주고 있다. 듀록 순종 집단을 이용한 선행 연구와 비교할 때, SCD 유전자의 프로모터의 SNP들은 근육내 지방에서의 팔미트산(C16:0), 팔미톨레산(C16:1), 스테아르산(C18:0) 및 올레산(C18:1)과 높게 연관되어 있으나, SFA, UFA, MUFA 및 아라키드산(C20:0)과의 연관성은 없었다(Uemoto et al., Anim. Genet., 43(2): 225-228, 2012). 반면, 본 연구에서는 SNP1에서 스테아르산(C18:0)과 가장 높은 관련성(association)이 나타났고(p=3.4x10-17), 그 다음으로는 팔미톨레산(C16:1)과의 관련성이 높았다(p=1.1x10-10). As a result, two SNPs (SNP1 and SNP12) showed strong association imbalance (D '= 0.952) and a frequency of haplotype 1 (CA) was 70% or more, as shown in Fig. Therefore, recombination between SNP1 and SNP12 appears to be rare. A very similar genetic pattern also appears in Figures 1 and 2, showing a nearly complete association disequilibrium between the two SNPs. The SNPs of the promoters of the SCD gene were significantly higher in the intramuscular fat compared to the previous studies using the Duroc obedience group, with palmitic acid (C16: 0), palmitoleic acid (C16: 1), stearic acid (C18: 1), but there was no association with SFA, UFA, MUFA and arachidic acid (C20: 0) (Uemoto et al ., Anim. Genet ., 43 (2): 225-228, 2012). In contrast, in this study, SNP1 had the highest association with stearic acid (C18: 0) ( p = 3.4x10 -17 ), followed by palmitoleic acid (C16: 1) ( p = 1.1x10 &lt; -10 &gt;).

구체적으로 도 1을 살펴보면, 스테아르산의 경우 유전자형이 CC일 경우 함량이 낮은 반면, CT나 TT일 경우에는 함량이 높게 나타나고, 이들 사이에는 큰 차이가 없음을 알 수 있고(상단 가운데), 아라키드산의 경우 역시 유전자형이 CC일 경우 함량이 낮고, CT나 TT일 경우 함량이 높으나, 유전자형 CT에 비하여 TT의 경우 함량이 더 높음을 알 수 있었다. 따라서 SNP1의 경우 유전자형이 CT나 TT의 경우 돼지 개체의 지방산 조성이 부적합하다고 판정할 수 있다.Specifically, FIG. 1 shows that the content of stearic acid is low when the genotype is CC, while the content is high when the genotype is CT or TT, and there is no significant difference between them (middle of the upper part) In the case of acid, it was also found that the content of CC was lower than that of genotype CT, but the content of CT and TT was higher than that of genotype CT. Therefore, in the case of SNP1, it can be judged that the fatty acid composition of the pig is inadequate when the genotype is CT or TT.

SNP12와 관련된 도 2를 살펴보면, 유전자형이 AA일 경우 스테아르산의 함량이 낮은 것으로 나타냈고, GA나 GG의 경우에는 유사하게 높은 함량을 나타냈고, 반대로 팔미톨레산(C16:1)이나 올레산(C18:1)과 같은 불포화지방산의 경우 유전자형 AA에서 높고, 유전자형 GA나 GG에서는 낮음을 알 수 있었다. 유전자형 GA와 GG 사이에도 해당 지방산의 함량 상에 대체적으로 차이가 있음을 알 수 있었다.2 related to SNP12, the content of stearic acid was low in the case of AA, while the content of GA and GG in the case of GA was similar to that of palmitoleic acid (C16: 1) or oleic acid (C18 : 1) were higher in genotype AA and lower in genotypes GA and GG. It was also found that there is a difference between the genotype GA and GG on the content of the corresponding fatty acid.

따라서, 본 발명의 일 실시예에 따른 SNP들은 교잡종 돼지의 지방산 조성의 예측에 종래기술의 SNP와 비교하여 더 정확하고 효과적으로 사용될 수 있기 때문에, 보다 건강한 돼지 개체를 선별하는데 유용하게 사용될 수 있다.Therefore, the SNPs according to one embodiment of the present invention can be used to select healthy pigs because they can be used more accurately and effectively in comparison with the SNPs of the prior art in predicting the fatty acid composition of the crossed pigs.

본 발명은 상술한 실시예를 참고로 설명되었으나 이는 예시적인 것에 불과하며, 당해 기술분야에서 통상의 지식을 가진 자라면 이로부터 다양한 변형 및 균등한 다른 실시예가 가능하다는 점을 이해할 것이다. 따라서 본 발명의 진정한 기술적 보호 범위는 첨부된 특허청구범위의 기술적 사상에 의하여 정해져야 할 것이다.Although the present invention has been described with reference to the above embodiments, it is to be understood that various changes and modifications may be suggested to those skilled in the art without departing from the scope of the present invention. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY The Industry & Academic Cooperation in Chungnam National University (IAC) <120> SNP marker for the prediction of fatty acid composition of intercross population <130> PD12-0348 <140> 10-2012-0041710 <141> 2012-04-20 <160> 11 <170> KopatentIn 2.0 <210> 1 <211> 18231 <212> DNA <213> Sus scrofa <220> <221> variation <222> (1817) <223> SNP1(C>T) <220> <221> variation <222> (13544) <223> SNP2(A>G, rs80954581) <220> <221> variation <222> (13682) <223> SNP3(A>G) <220> <221> variation <222> (13739) <223> SNP4(T>C) <220> <221> variation <222> (13818) <223> SNP5(G>A) <220> <221> variation <222> (13918) <223> SNP6(T>C) <220> <221> variation <222> (14055) <223> SNP7(A>G) <220> <221> variation <222> (14311) <223> SNP8(C>G) <220> <221> variation <222> (14417) <223> SNP9(G>A) <220> <221> variation <222> (14956) <223> SNP10(A>G) <220> <221> variation <222> (15378) <223> SNP11(G>A) <220> <221> variation <222> (15384) <223> SNP12(G>A, rs80917505) <220> <221> variation <222> (15424) <223> SNP13(C>T) <220> <221> variation <222> (15884) <223> SNP14(A>G) <220> <221> variation <222> (16066) <223> SNP15(C>G) <220> <221> variation <222> (16198) <223> SNP16(C>A) <400> 1 gggggggcgt gggcacaagg acgggatcgc tcactggcgc ctggaggcga acgtcccctg 60 ctgggcttgc ctagtagctg aacgccgtgc gcgcgtgcag gtccacacat ctatctatgc 120 atctacgtgt gtgtacaccg ctgccggcct ggagaccggc gagttcagca gtacgcatct 180 atcgccccgc cgccagtggg cggcgcagag ccattgttcc gccgccggcc gaccctcagc 240 ccctgcggca cgcgcgttcg tcacggaggg aggtggggct tcgccgggcc cccggccccc 300 aacccggggt ttgaaggcac gtctccccct cccacgcgtc tccgcgagct agaaggcggg 360 agtggagttg tgcgtagcgg tcgcccgcgc ggcttcaccc acactttccc cggaaacttc 420 cctagtgccc atcctttcgc gaagtgcccc agggccagtc ctgggctagc acccacctcc 480 caccccccta ctgagtcctc ttcctcttcc agggaagacg ctctcgagcg cctccgagga 540 ggcaggacgc cgggcagaag cccagcggcc ggtggaagag aagctgagga ggagaaaggg 600 aggggagggg gagtgaggag ctcgcggcag agggaacagc agattgcgcc gagccaatgg 660 caacggcagg acgaggtggc accaaattcc cttcggccaa tgacgcgcca gagtctacag 720 aagcccatta gcatttcccc aggggcaggg gcagaggcag gggctgcgga gaccgagccg 780 cggagtgtct gcagcatcca gtttttgcgt ctccggcccc cagtaagccc cggctctctg 840 tctcctcccc tctcccgccc atgcggttct cccacggtga gccaactctg cgcactttgc 900 cccttcttgg cagcgaataa aaggggtcag aggaaataca ggacacggtc gcccactgcc 960 agctctagcc tttaaatacc cagcctgggg agacccgcgc acagcaggtc gggtgcagac 1020 accgacccaa cgtgcagcaa agggttccga gcgcagcatc gctgatctcc gcgcaagagc 1080 cggctccagc actagtctac gctcagtgcg gtctgccacg aactcctccc tgaagtctca 1140 tccctgggaa agtgatccca acgtccgaga gcccagatgc cggcccactt gctgcaagag 1200 gaggtgagtt tccaagtaat ggcccccaga ccgcgggctc gccggtgctg gttgggcttc 1260 taggtgactc ggtgtagaag agagttgaga tcgccgagga cagccacctt tttcgagttg 1320 tatagtcttc agtttgttgg gaatgtggat tgtaatttgg gaacttagtt ctccaacttt 1380 tgtttcctaa agcttcaaag aaaaatctgg tggtacctgt accctgatgt gtgtaggcat 1440 gcgggctttc ctttgtgtgt ttgaaggggt gcgagtgttt tacccctcta tttccccttc 1500 ccctgaggtt tcaccctcct ccccaatttc tccgcacagt tcctggggac ttgcgtctct 1560 tccatctagg atagaccttg ccctcaggta acctgggtat tggggccagg tctgtgccta 1620 taccccgccc ttcccccagc tagaccaggg agtgaagtgg cccctagtgt ctccacgtgt 1680 cctcccctct ctcccagctc tgcacttcca ctctctttca gatctctagc tcctacacaa 1740 ccaccactac catcacagca ccttcctcca gggtcctgca gaatggaggg ggcaagttgg 1800 agaagactcc ccaatacgtg gaagaagaca tccgccctga aatgaaagat gacatctatg 1860 acccaaccta ccaggataag gagggcccaa ggcccaagct tgaatatgtt tggagaaaca 1920 tcatcctcat gagtctgcta cacttgggag ccctgtatgg gatcatattg atccccacct 1980 gcaagatata caccttgctc tggggtaaga ggtccccttg tcctcctgtc tcagtatccc 2040 aggttctctc cactctttta atacagtagc aacttacaca gagtagaaac accagcccct 2100 ccaggccgag gtttttccaa ccatttctct taggtgttgt ggtgggctgg gaagggagtc 2160 tagggggttt gggatgcagg agtgtcgatt ctggggcctt taatttgggg gggggggttg 2220 gagagggagc cctgggacca tgggccacag gctttgaagt gagtagatct gtgccaggga 2280 gtcagctttt ctgtttcaag tcattttctt gactgcttgt cccagccctg ccagcctaga 2340 aagaatcaag gcccttacct ggatgcatgg gaacatgggg ctagactagt gtgactttag 2400 agggcacatg ctgggtatag tcacggggta gcaagagaaa ctactcagga agagggttaa 2460 gcagaagagg ggggaagaga gctgtggtca tccatgaaat tattttgccc tgatccttag 2520 ccttatcagg ctccttaatt acacagacag aggaaggcgg ctcctgcata actcatgtta 2580 catggatgtc ttgctctgtg actccacgtg ggtctccagg gaactgcaca tgccactcaa 2640 gaaaatgttc taatgaaata aggttaaaga aacgtttcct gccccattcc ccacccatcc 2700 tgctccagcc cctctcccct gatgccagga gtgcctcctt gctggggaca gccaagccag 2760 aaaagagact ctggagcagc cccggccctc aggctgctgc agtgagggag acagtccccc 2820 gtgcgtccct gacctgccct tagctcagct ctttcaggaa tccatggctt gggctgatag 2880 tggagccctg ccccctcaca cacatgcgct ctgcaggcat tgccactcct gcctcgagtc 2940 tgacttggga agaggagagc agggaactct aaagatccag gagctccatg ctgctaccct 3000 ctgtgatggg tgtggggttc agaactccct gttaagaaag ccacggtatg gtttctggag 3060 cagtgtcgga tgttgggtcc ttgctggcag ctatgctctt ggagggtggt tctacagaag 3120 gactggtggg ccaagtttca gcaaagtcct ccaggacctc tttgatctaa agagggtgga 3180 tctggtctgc ggagccttgt cttggcagat cctcttggtg ccacagacag agaaatgcat 3240 ctgggtagat tccctctctc aattttccca gacacaaact ggggacaaca ggactttttt 3300 taagcttaga aaggtagtgc tcctcttttg gcctccctga agcatgtgga gttgccggac 3360 cggggatcag acctaagcct cagctgcagg aatgccggat ccttaaccca ccctaccagg 3420 ccgggattcc acctgagtcc cagcattccc aaggtgccgc tgatcccgtt gtgctacagc 3480 ggacattcca agaaaggtgc tcctggagtt cctcgagtgt cattgctggg gccagccagg 3540 tgcagaggaa atcaattcat cctcagacca ggaagggctc ttataattgt aaggggaggg 3600 ggacttctgc tccccagccc ctctgagaac ccagcagagc ttgagttgca gtgtgaggaa 3660 tcaagagcca gggacatgga tgccccaggg aatctgtggg ctcccctcct gaccccttct 3720 cccccataga ggagtcttca caagtttagt cacttccaag tccccctcca gcctcaggac 3780 tccctgtcgg cctcgttaag ttccgagttt ggccaggcag ctgctgctgg ctcttctccc 3840 ttggctgcta ctgcagggga caggatgctg tccccaacca aggctgtgcc tgccgccttt 3900 ttggtgccct gcctgtagat gtgtgctctg cccttggaca gaaacctgtc acacagactg 3960 gatggtgact tttttacttg tccctggatc ctgtggtggt ggatggctta gctgatggaa 4020 tgaccatttt ggtatggcca tatccgagct cctctggtgg agttgggggg agggtcagag 4080 ttcccgaacc ttaagagttc aggaacttgg cttcatcttt tcttgtcttg tccctaagga 4140 cagtgctaaa ttagcaaatg gttgtgattc cagcatttgt caggactgag caattttgag 4200 tgtctcagaa gagccctgag ggctgaagcg atacctggca gcacctgggg gctctgaggc 4260 gaaacgtctc caggctcttc cttagggcta aaactatgaa gttttgctta accataaatc 4320 tagactttag tagagaatga atatccaact gacaggctta ggggtgctgg tagaaaaagg 4380 caccagagac ttgggtgttt ccccaggttc tctgttagga tcatatgtgc ttccattttt 4440 gtgctttgct tttttagggc cacacttgcg gcatatgtaa gttcccaggc taggggtcaa 4500 atgggagctg cagttgctgg cctacaccac agccacagca actcccacgt acaccacagt 4560 tcatggcaat gctagatctt taacccactg agtgaggcca ggcatcacac ccatgtcctc 4620 atggatacta gtcaggttcg taattcactg agccacagtc agaactgcct gcgtgtgctt 4680 tctgagtcag cttgccaggg tcttcggttg catgtaacca ccccagtagc ttcctgggtt 4740 ctgagctacc tctttcgtgc tcaaagactt ttcttggcct ttggtgattg gcgggctgcg 4800 gctcaactgt tatttatcca ggtgcagatg caggcagatg ctgcctctgg gaggatatta 4860 ccacaaggcg ggggaggcca gaaaatcacc tggaccccta atgcagcccc gaggaccgtg 4920 ggtggcactt ccctgagaca gactctggct ccctggctct cctccctgtc ctgtaggagg 4980 aataggctag ggtagaggaa ggtgggtggg acagggggct tgtttaggaa actggtgtct 5040 gtggctgaga acacaagaca atgtgttaca atgtgtggtg tctccaactg caactaagtt 5100 cagtggccac tgaggatcca ttgtttctag ctgcttccct aggaatgaaa cattgtcaac 5160 agtcactgct ctcccaaggc ctcagcctct gcctcctaga gctgctgaac agaggaaggt 5220 gggtgtgccc agcaacccgc ctcccagtta gagactccaa cctgcacccc tagaacctgc 5280 aggcccccag gaagatgagg tagacagcgc tggggtgccc cccaccacag ctttgagcct 5340 gccctaccgt tgcctagaat taaccctgac aggggtatga gctgactgag gaaggtggca 5400 aaggagagat gcaggagcgc tgcgagtatc ttgggcgggg gggacatggt aaacatcctc 5460 gagccagggc tcaggagcac caagtacttg ttgacagaac acctcatttc aaaccatggc 5520 tccatttttt tttttttttt tccttttgct ttttagggcc acaccttcgg catatggagg 5580 ttcccaggct aggggtctaa tcagagctgt agccacccac ctacaccaca gccataggaa 5640 ctcaggatcc gagccgcatc tgcgacctat tccatagctc actgcaacgc cagatcctta 5700 actcactgag tgatcccagg gatcgaacat gcaacctcat ggttactagt tggattagtt 5760 tttgctgcgc cacaacagga actcctatgg ctccctttct tactagccat gtggccttag 5820 ataaacactt aatctttctg agtgtctatt tctttggctt aaaccccatg taaggtatcc 5880 agtgaatcaa agaatacaga aatctggagt tccccttatg tctcagccgt aacgaacctg 5940 actagtatcc ataaggactc gggttgatcc ctggacccgc tcagtgggtt aaatatccag 6000 cattcctgta agctgtggtg tgggttgcag acacagctgg ggtctggcgt ggctgtggcg 6060 tacgttggcg gctgtggctc caattccacc cctagcctgg gagcttccat atgctgggga 6120 tgtggctcta gaaacaaaca caaacaaaca aacaaaaatc cttggcaaag cttaagactg 6180 tgcagatatg acttaggtgc aaggcgagtt ttccccattc tgtgaccacg cagtctgcca 6240 aaagactgaa atggttttgt accagatggt aaatagctct agttctgagc cccccccccg 6300 ccccccgccg ccccccatgt cccctagaac ccagagtccc tcaaactggt cagtgcccag 6360 gccatcctgt cttaacatat tttaatactg cccttgttta tgggtcttca gctctgcaag 6420 agtactctgt ggtccttaaa actgtggaga agcttagtga aggtcagagg agatgggacc 6480 tgggataatg tccttcatga cagagaatga caagtggctg gagggtgaga gccctcttct 6540 ctgtcccgcc ttcctgaact ttctgggacc tgtaagctta ttccagctgt gaggctaaga 6600 ggataggagg cgatggtaat ttttttccaa gtggtaaaat tgaaggggcc taagagatct 6660 aggtgtccgt ggagttcagg gaaaagcaga tcctcacctg cagcctgaag gacacccaga 6720 cgctgacctg aggagaacat cacgtgtaag acttgccccg attactgact ccctgtcctg 6780 tcttccggca gcgtttgcct actatctgct gagtgctgtg ggtgtcacgg caggagctca 6840 ccgcctgtgg agtcaccgaa cttacaaagc tcgactgccc ctgcgggtct tcctgatcat 6900 tgccaacacg atggcattcc aggtaagaag ccagctgtgc tcagctcttt atcaaacgca 6960 ggcgatgggt gcctggaagg gagcagcacc tggacagcta cttcactttc ctctctgctt 7020 ccagtcacct caagttcagg ttcagtcctt gggtccataa cacctgcagt actttggagt 7080 gactggaaaa gggaaatagg ggataaagag gaaatagcct ctgtgtatag gatcgttttc 7140 gagcctccgt tgtcacacag tctggtcgtt gtggtccctt cattagtgca cgaggcagga 7200 actgaccctg atttcctagg cagccgttgg acaatacatt cactatttta ggtgaacatc 7260 tcaggactcc accaaaaggg attaaagtta atgtttcaca gattcatgaa ccctattgtt 7320 ttcaggtgag aagatcaaac acttttatag tgttaactat acctcctggc cctattctga 7380 gcacttgaca aggattacac cattaagccc tcccaacagt cttaggaggt tggtactgtt 7440 gtgatcccca tttcacggag ggggaagctg tgtcactgag ggtgtaggta gaccatcatt 7500 atggtcctgt gttgagctgc caagctgtct aagtcaaata ttgaggtctg ctgaagccgg 7560 aagctcatag cagggaattg gagaaaggga actccgagtt attgaacagc agcactgggc 7620 aaaggctagc atgttgtgtg gggcttagct tggatcaagg ggcaaaaaga aggaaaccaa 7680 atcggttcct ttcttcgtgg cagtgtctca cacagctgca taactgtctt ctgccatagc 7740 acttaacgcc ttgaaggccc ctgatgtggt ccctgttggg gcaaaagaag gaagagatat 7800 tggcaccctc tctaagcgat agaaagtgtc ccagaggagc ccagagacca tttggaaatg 7860 cggtcaaatc atgattatgt gtctggcctt gttgagttgt gggagctgaa tcttgccaag 7920 ggattaggca gcctgtgaag accctttgct ccagttcttg ctggaagaat tgcaattttg 7980 cctcctagtg aaactcttca agctctatac aatccatctc cattctgccc accatataac 8040 ccgcaagaag cagccagccc tattcatgtg gtcctgagac ttgaaggtgc ttttccactt 8100 aagcatcagt ggccagttag agaggaggca actccctgac tcctcctttg gagccttgac 8160 tcccaggtat ttcgcgagct tgggctgagc gcctcgggct cttgaagaca cctagccatt 8220 ggcattcccc tgagagggtg tctctcctca ggcctccatt cctcttctct gtccctccag 8280 aatgacgttt atgaatgggc ccgagatcac cgtgcccacc acaagttttc agaaacagat 8340 gctgatcccc acaattcccg acgtggcttt ttcttctctc acgtgggttg gctgcttgtg 8400 cgcaaacacc cagccgtcaa agagaagggt ggtttgctta acatgtctga cctaaaagcc 8460 gagaagctgg tgatgttcca gaggaggtga gtgctgtggt ggtggagctg ggcgcctggt 8520 gtttggggac accctctccc ctccctgttt tttcttctag gacttgtcca cataagctgg 8580 gaaactgaca gggtctgctt accccaaatc ataattcaaa acccttcttt tatgggccac 8640 agccatagac tgttgttgat tctttctctc tgagctaaaa aaaaaaacca gttaaggtca 8700 acaatgtgtg ttgacctgtt acagtcatgg atacaaagct acatgttgtc atagtcctta 8760 ccttcaagaa gttcatagcc tgttggggat gggagcacta agccaggtgt ccaaatacct 8820 atgacatggc aaaatatttt tctgtcccca ggaaaggcac agaggggagg gagactgtgg 8880 agtggggaac attagagaag ggttttatga gaaggtagct taggaatcca ctggtagctt 8940 aggaatccac ttaggaatct ttgtaagatt ttcacaagtg ttggcggagc gggaggcagt 9000 gcaaacagaa agaatgagct aaagcatgaa gcatgttcca gcaatagagt ccctctgctt 9060 aaagtacagg gtgtggtagg aaataaagac tagagagacc gagacctttc ttgtggggcc 9120 ttaagagcag acagggttta attcaactcc agcaatagga aaccatggaa gggtttttga 9180 gccggaatgt ggtcagaggt gtgctctgga gaggtcaccc tgcagatagg tgaaagaaac 9240 cgttgggctg aagaggtgag ctgcagggcc ccaggtgagg aggtagtggg catccatgct 9300 ggggaagtgg tggcacggag aggaggcgaa atgtggggac acacgtgatc caagagtagc 9360 agacttgact gctgaagagg tgcaggaaat cagctccctc ggaatgtcag tagcctgttt 9420 tactttggga gaatgaagaa tgggccaggg cctccagagg gacagcctgc aggcatccgg 9480 gacactcggt gtgcccctga ggggaaaaga agagaaagga tcagaaggct tgctggctag 9540 caagagagga aggcaagata ccaaacacag attctgcaaa gagcactgac accaagagag 9600 gagcaggcag aatggaaaga cctgggcagg agaactcagt tcagtaatct gtaatttggg 9660 ccgcccctgt tgtggtacga ttaggctgtg gtcaaagaga gcaatggatg gagagtcggg 9720 agacaaggca ttccagccct tgctccactg gttcctggtg gtatgaccct agaaaagtca 9780 tttagcccct ccttacctta cctcatcaaa aaagtatgat aataacactg ccttctcaaa 9840 agactaccca ccccatccct cttgctctgt ttcctgccac cttgtgctca cagcgtagag 9900 ggtaggggac agctcagccc catgaaagga caaagtcaga gtcccctcca tgaatggggt 9960 gtgtgatctc tccctgtagg tactacaaac ccggtatcct gttgatgtgc ttcatcctgc 10020 ccacgatcgt gccctggtat tgctggggtg aagcttttcc ccaaagcctg ttcgtcgcca 10080 cctttcttcg ttacgccatc gtgctcaatg ccacctggct ggtaaacagt gctgcccacc 10140 tatacggata tcgcccttat gacaagacta ttagcccccg ggagaatatc ctggtttcat 10200 tgggagctgt gggtaagtta gcagtccata gcaagacccc atctagtggg ctgctggtta 10260 agagtattag actaggagcc agaaaaacca gattaacctg ctttatgacc cctctctgtt 10320 tctctgctat aaaactaagg tgcaatagta gatacccctt gagagttggg cagcaagtct 10380 tatataaaga gaattgggct aaaaaataac aatgtctctg agtccaggtt ccaaaaaaga 10440 tccccaggtg ctctggatga ggaaccgctt tggcttgtcc tttttccagt catctctggg 10500 ctggcacatg gtctggctag gggcagggac tgcatgaata gaacagtagg gtcttctggg 10560 tggccagtaa gcctagtgtt ttatatttag acatgctata caaaatgcag aacaaatcct 10620 taacatttca acaagcttct cttttatcac cttgctatat tcagagaggc tgaactcaaa 10680 gtgtatttca tgccttattg tttggtgatg ccaacatgaa ggacctcaaa gcaactgttg 10740 gtggcccttt tatcaccacc gaccgctctc atctcttgtc ctttattctt ctcttgtcct 10800 ttattcttct ctaacccgtg ctgggaacac ccgctcccct taacatggct tggagaactc 10860 ctgataaagc agttaatttg atcacaagtc tctgctcact gatctaatgc tgactattca 10920 agaatatctt tctaaaaaaa aaaaaaagtt gtatctttct ctcattccag tttcaatagc 10980 cagaatctaa gacaacagtg ttctaccatc tgtctccctt ttattttttc ctctgccact 11040 cttttcaact aaacatagat cttgactaac gcctggaagc agttttcctt aagcagcgcc 11100 tgtgacctct tccacgctag tgatcagtgc cactggttgt ctggcatatc taggcaacct 11160 ccctgctccc cacatgtgtg tacactgcgg cctagctttt gctttgttct ctttaaaacc 11220 tttctttatg tgctcaaccc tgagcatctt ttttttttac aatctgtact aaagacattt 11280 catttgtatc tttttttttt tttttttttt tttagtgccg cacctgtgcc atatggaagt 11340 tcccaggcta ggggtccaat ccgagctaca gctgctggcc tccaccacag ccacggcaat 11400 gccagatcca agcaacctac accacagctc atggcaatgc tggatcctta acccactgag 11460 caaggccagg gattgaaccc acaacctcat ggttcctagt tggatttgtt tttgctgagc 11520 cacaagggga actcctgtat ctctttttaa ctttcatgta tcttccccct cctttcaggg 11580 accctctacc attgtgcatg tatctactct gaaccatgtt tgaaatctaa caggctattt 11640 tcatagaaga tttatgaatg ttgtggaagt ttctggaatg agactggtcc tggatttaga 11700 atgagctccc ccaaccccag tctctttcta accatccgtt caaagtagct gccaacatct 11760 tcctttgtct caattatcat tcatccctcc atcctggctg ctctccccct tattacctca 11820 ccctttgttc tcccatagct ggcttccctg tcattctaat ctttttcttc ttgaattacc 11880 tcccccacag tcacatgctc atctctccgc taaagctgac ctcctgcctt gagcctctcc 11940 tggactgtgt cttgctgccc cagttgcaga gtcttgtcct tctcctcttt ttttctccct 12000 tggcaactag tgtgtgtctg attaaagttt taaatctgat aagtatatct gataagcctg 12060 gctagtgctt atcaagatcc tagctgcaga attttatgga aattcgtact tttagccttg 12120 gggttatcct accctcctac tcagttcaca ctagataagc tgattatcca cttggtagag 12180 agtcagacag aggacctacc tcgaatgatg ccctggatgg tgtcatttcc tttgcagaat 12240 ttccttcctt gcttgttatt aatgtcatta ctactctact aaggctcttt catcttcaaa 12300 gggctcaaca tgctctttta ttagctattc ttgcccagct ctgcctgggc gtcataaggg 12360 gtcagcattg tcatagttga atgctgttcg gaaaaaagat cccgccaagg gttggagacc 12420 tctggctctg gagtttgcac agctcaactc atgacagaca ttattctgaa tccagagttt 12480 ctctgatttt cttctatgga gcaaagtgaa ctcctcttct cagaagcata gaggtttttt 12540 attctaattc taagcctttt gattctgttt ccctcagaga gcttctgtct tatcagcttg 12600 acccccacac caggattcaa gctcaaagaa ttagaagcca gagcagtccc ctctgaacca 12660 gtggaaactg aggaaatgtg ggcccctggt ctgggcctct ttctgacttt tgactgttgg 12720 tgcctgattc cgtggtacct tctgccctta gagatggtat ggtacagtgg ggaaaggtat 12780 acccccttgc tcaccttttt cagaaacacg gcagcagttc tttgttctag actcttctct 12840 cctcacccta acacatgctc actcatacag agctttaagg tctcagacca ataactagtg 12900 aagctctgga atttcccaat ctaaaattta tcccctgtga tagcagtttc tctccggtca 12960 tcttatcccc tcagaggaac tgtcagtcct cttcccacag aggctcccag agagccatgg 13020 cgaccagggt gtccccagtt gtttctcaag gtgcctctga ggggatctat ttcgttgaaa 13080 agactggatt cattcattca accacagcaa gttatctgct aggtttgagc tgtgccaccc 13140 ccagtgtagc ttcatgactt ttctctgctt tttgttccag gtgagggctt ccacaactac 13200 caccacacct ttccctatga ctattctgcc agcgagtacc gctggcacat caacttaacc 13260 acgttcttca tcgactgcat ggctgccctg ggtctggctt atgaccggaa gaaagtatcc 13320 aaggctgcca tcttggccag gattaaaaga actggagatg agagctacaa gagtggctga 13380 gtttggggtc ccttgggttc cttttctgaa agccagctgg gcagaggttt aatgttctgt 13440 ttattaacta ctgaataatg ctaccaggat gctaaagatg atgatgttaa cccgttccag 13500 tacagtattc ttttaaaatt tcttttaaga ttgaaagcct acaattctgc ctttatgatg 13560 ctaagctcat attcttgttt cttctctctc ttctagtccc attgtccttc tcttggcttt 13620 gttcctgtca ccttcctctc tcttccccct cactgtgccc caggcaagga gctggtcagt 13680 cattggtggg tttccagctt ccaaagccta gacctttcag tagtccaaaa ctggtgagtg 13740 gtctttgccc cagatagctc tttctttgag ttgtcctgag ctttaaggtg ggtggctcaa 13800 gggagagagg tgataaagtc ttctgggaaa gccccgttca ttattttcag cccagacttt 13860 tgctcgatga catggaaaaa taactctatt ttggcacaaa gcttcgaaag caggtaattt 13920 gtcaggggag ggagttagca tgctgtgtgt ggtggggttg ataaagaagg gggaggtgag 13980 gtgggaaacc aggcaggagg ctcctgctgt gatgggacac tcggctgact gcccagtgag 14040 ggctttgcgc cctgacacac agcatgcttc ctttctctcc tgactctggg gaatggccgt 14100 ggaacttggc aatgctagaa ctcaaaagca catcccagtg tcccaatgta cgttaggctg 14160 aggataaaga agcagcattt agtttgtggc agcagtggtc tctgctgggg aagaagtctt 14220 tcttgtctct ttaataacag gaagatttct tattccatag agtgagaaat cttgaggttc 14280 tttccggaat tgctgaatcg gcaactcatg caattgtcct cactcttttc atcttcccgc 14340 tctgccatct ttgggataca gctcccctca tagtaacaat aaggtggctg ccgcattttg 14400 agacatcgga actgaggtgt gttggtggta ccgtggtgag cttaactatc ttcccaaaaa 14460 gaaaggattt tagcaggtgg aggtgggtcc cacataaaga tagttaaacc tcggtacttt 14520 gcttggaata ccaacataat tctcttggac tatttccctc tgaaagagaa ggaggcttga 14580 gaagaggaag aatgggggtg gatggtctcc tttcctctct ctgctgaaca ggagatggag 14640 gggttgaggg gcagggtcta gaggcagctc ctgagacata acattgcaaa cgaagggctc 14700 tgggggattc agaaggttac tgagtaagtt actggacgtc ctcctatggg aagctggtca 14760 cacaggcaag ttagatattg gggttcattt cattcattcc agttgctgct tggaataagg 14820 aactagaagg ctgctcccca cagtgtgaaa gcctttcact cctgccttct agcctcaagc 14880 gtactaccct gactatggat tcctgctctg ccctgtctat ccgttttttc ctgccggttc 14940 tatctcctcc ctgagatttt tcctttctct ctggagggca ggcctccttt gggagtatgc 15000 aaaggcagtg atggctgctg ctctacaggc agcttcctct cccacagtca gaatgctcag 15060 ggtcactgaa ccactgtttc tcttcacaaa ggtgagctag ctgccacctc cacgtggcct 15120 ccagagtctc cacctgcacc cttgtgctcc cctgccactc caatgattca agacaaggcg 15180 ggcaaaccct cctagaaaca tcccgggcac gggcatcctt tctcataagg cacagccaag 15240 ccaaatgctc acgttgtgcc agtgagtcag ccacagagca aaagagggtt tgtggttagt 15300 ctcctctatc tgggtcagaa ccagagagca ggctggatgc cccctgcttg ctcggtaagc 15360 ctgcccagcc tgagtcagtg ctcgcggctg acagtgcaat gcttgcagaa acaggaggga 15420 gcccggtctt cactgggaag cacaagaggc caagacaagt tccaaagtgc ctcactcgaa 15480 agggaaccct gtcccctgga gctagggtgt accacaaagc tttggctgag tcttgggctg 15540 aacagcgtct ctgttcagca aactaaccag cattccctac agcacagccc aaggcagaca 15600 agagaataga agagggctgg aaaacaaaaa ataagaacct tggcccactc ctgtccctgt 15660 aacctcagtc gtcaacacag aagcctggct ttactctaaa gattggaaat atacaatacc 15720 agatgctctg tccactgttg agccccagga gtggaagggc agagagcatt tcttcctgta 15780 ttaactgagt aaatggagga taaaggggtt gggctggact agaggcatct ttgtcttttg 15840 agccattctt ctcagtagaa aaaaaagctg atggaagatc actatagttc acattcccag 15900 acccaagcac ctactctttg gaaatgactg ttgggttagt tttaattcca caggtcgtca 15960 gatgcctgct ttatagctga tgatcaaaac caacttttat ctttctattc taattgtttt 16020 caatggatct gatccatacc ataaccctac acaaggctgg atgggcttct taggccaagg 16080 gccccagtgt atgtgtggat gtgtagggtg ggagggcggg gagtaaggaa tacttttttc 16140 aaggttctaa agctgaattc aaatgacgca ttaatgaccc agaaactcag atctgatcga 16200 atctgaattt ctaacaggcc ttgctttgta ggtgtactga caacttatct gggggcctta 16260 catctttttt aatcggtgtt acgtccgagc ctgctctgct ccctcactcc ctctgcactc 16320 cctctgtggc gttcccttgc ccctgagagc ctgcagaagt ggctggtaga agtggggggc 16380 tggctggaga attatcagta tgcaggattc ctttctgggc tttgttttgg aaactttcct 16440 tagggctgtt tttattaagt gcccacattt gacggaaggt ggaaggaatt tgaatgtatt 16500 tgatttataa tgttattatt attatttttt tagattaaaa gatggttgta gcatttaaaa 16560 cggaaacctt ttctcctggt tagctagtat cctgagtgta ttctctgtaa gtgtagctca 16620 aatgggtcag cgtgaagaaa agttaaagaa agcacgatgt caaggttaca cgggtggtta 16680 aggccagggc ctctcctacc actgtgccac tgacttgcta tgtgaccctg ggcaagtcat 16740 ttaactataa tgtgcctcag ttttccttct gttaaaatgg gataataata ctgacctacc 16800 tcaaagggca gttttgaggc gtgactaatg ctttttataa agcattttgg gatccttcag 16860 cagaggaatt ctcttaagtc ctgagtattt ttataataac agtatccacc atgaactgtg 16920 tccaccatga accctgtgtc ctggatgctg tcattaatct ttatggttct ctctgagaaa 16980 ttgaataaac ccaatagata agtggtggat aactagtcag acagaatctg agaatgcata 17040 aactcattgc catggaaaca tacacaggat accttttcct tgattgggtg ggattttttc 17100 ccctttttat gtgggatagt agttatttgt ggcctaagaa taattttgga ataatttcta 17160 ttaatatcaa ctctgaagct agttgtactg atctgagatt gtgtttgttc ataataaaag 17220 ggaagtgaat ctgattgcct tgtgtctgag aggttttttg cctgtgagtc agtctcttgg 17280 gacttaatct gccaccctat gtcctgttcc tataccttta agagagtaaa aaaagtagaa 17340 gctacaatgg ttgattcaca ctctagtaac ccgccctgcc ctccctgccc ttcttagggg 17400 taactttagg ttaaactcag ccttggcagc aggaagccag gagtctgctg ccattagatc 17460 agacatgtta accccagctg gctctttggc cctggggaaa tgccaggtct ctttcggtaa 17520 catgggccaa aaatgatact gagagaggaa aggagcagca ggtgacactt ccctggaaag 17580 gggttctgta cctggcaacc caggctgggc catcctgctt cattcctctg aaatgtagcc 17640 ccttctggga ataaagtggc ttcctgaaaa tgctgattaa caacagcagg aagaaaggaa 17700 aagcaatcct agagaagcct tgtaaattcc tggaatagag agggcttcat gatcatcaac 17760 tagaaaggct ttggctttta ctgctttagc taagaatctt tttttttttt ttgtcttttt 17820 gctatttctt tgggccgctc ccgcggcata tggaggttcc caggctaggg gtccacagca 17880 acgcgggatc cgagccgcgt ctgcaaccta caccacagct cacagcaacg ccagatcctt 17940 aacccactga gcaggggcag ggacccaacc cgcaacctca tgattcctag tcggattcgt 18000 tgaccactgc gccacgacgg gaactccgct gagaatcttg atgtgcaaac gagaagggct 18060 ttttttgaag aggcttcatt ttccaacagg agccacctaa gcttctgagc attccccaga 18120 ccccccctta cactttctag tgtaacgtcg cactcacctt ggacaagcac gactctctca 18180 gtgattcatc ccaaatcaag tctatattca gtgaggcctt gccaggcctt a 18231 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P1-F <400> 2 tgaagtggcc cctagtgtct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P1-R <400> 3 catacagggc tcccaagtgt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P2-F <400> 4 gtcccttggg ttccttttct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P2-R <400> 5 ggacactggg atgtgctttt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P3-F <400> 6 aaaagcacat cccagtgtcc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P3-R <400> 7 cccccattct tcctcttctc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P4-F <400> 8 gccttctagc ctcaagcgta 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P4-R <400> 9 gtgctgtagg gaatgctggt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P5-F <400> 10 atggaggata aaggggttgg 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SCD-P5-R <400> 11 ccacttctgc aggctctca 19 <110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY          The Industry & Academic Cooperation in Chungnam National University (IAC) <120> SNP marker for the prediction of fatty acid composition of          intercross population <130> PD12-0348 <140> 10-2012-0041710 <141> 2012-04-20 <160> 11 <170> Kopatentin 2.0 <210> 1 <211> 18231 <212> DNA <213> Sus scrofa <220> <221> variation <222> (1817) <223> SNP1 (C> T) <220> <221> variation <222> (13544) <223> SNP2 (A> G, rs80954581) <220> <221> variation <222> (13682) <223> SNP3 (A> G) <220> <221> variation <222> (13739) <223> SNP4 (T> C) <220> <221> variation <222> 13818 <223> SNP5 (G> A) <220> <221> variation <222> (13918) <223> SNP6 (T> C) <220> <221> variation <222> (14055) <223> SNP7 (A> G) <220> <221> variation <222> (14311) <223> SNP8 (C> G) <220> <221> variation <222> (14417) <223> SNP9 (G> A) <220> <221> variation <222> (14956) <223> SNP10 (A> G) <220> <221> variation <222> (15378) <223> SNP11 (G> A) <220> <221> variation <222> (15384) <223> SNP12 (G> A, rs80917505) <220> <221> variation <222> (15424) <223> SNP13 (C> T) <220> <221> variation <222> (15884) <223> SNP14 (A> G) <220> <221> variation <222> (16066) <223> SNP15 (C> G) <220> <221> variation <222> (16198) <223> SNP16 (C> A) <400> 1 gggggggcgt gggcacaagg acgggatcgc tcactggcgc ctggaggcga acgtcccctg 60 ctgggcttgc ctagtagctg aacgccgtgc gcgcgtgcag gtccacacat ctatctatgc 120 atctacgtgt gtgtacaccg ctgccggcct ggagaccggc gagttcagca gtacgcatct 180 atcgccccgc cgccagtggg cggcgcagag ccattgttcc gccgccggcc gaccctcagc 240 ccctgcggca cgcgcgttcg tcacggaggg aggtggggct tcgccgggcc cccggccccc 300 aacccggggt ttgaaggcac gtctccccct cccacgcgtc tccgcgagct agaaggcggg 360 agtggagttg tgcgtagcgg tcgcccgcgc ggcttcaccc acactttccc cggaaacttc 420 cctagtgccc atcctttcgc gaagtgcccc agggccagtc ctgggctagc acccacctcc 480 caccccccta ctgagtcctc ttcctcttcc agggaagacg ctctcgagcg cctccgagga 540 ggcaggacgc cgggcagaag cccagcggcc ggtggaagag aagctgagga ggagaaaggg 600 aggggagggg gagtgaggag ctcgcggcag agggaacagc agattgcgcc gagccaatgg 660 caacggcagg acgaggtggc accaaattcc cttcggccaa tgacgcgcca gagtctacag 720 aagcccatta gcatttcccc aggggcaggg gcagaggcag gggctgcgga gaccgagccg 780 cggagtgtct gcagcatcca gtttttgcgt ctccggcccc cagtaagccc cggctctctg 840 tctcctcccc tctcccgccc atgcggttct cccacggtga gccaactctg cgcactttgc 900 cccttcttgg cagcgaataa aaggggtcag aggaaataca ggacacggtc gcccactgcc 960 agctctagcc tttaaatacc cagcctgggg agacccgcgc acagcaggtc gggtgcagac 1020 accgacccaa cgtgcagcaa agggttccga gcgcagcatc gctgatctcc gcgcaagagc 1080 cggctccagc actagtctac gctcagtgcg gtctgccacg aactcctccc tgaagtctca 1140 tccctgggaa agtgatccca acgtccgaga gcccagatgc cggcccactt gctgcaagag 1200 gaggtgagtt tccaagtaat ggcccccaga ccgcgggctc gccggtgctg gttgggcttc 1260 taggtgactc ggtgtagaag agagttgaga tcgccgagga cagccacctt tttcgagttg 1320 tatagtcttc agtttgttgg gaatgtggat tgtaatttgg gaacttagtt ctccaacttt 1380 tgtttcctaa agcttcaaag aaaaatctgg tggtacctgt accctgatgt gtgtaggcat 1440 gcgggctttc ctttgtgtgt ttgaaggggt gcgagtgttt tacccctcta tttccccttc 1500 ccctgaggtt tcaccctcct ccccaatttc tccgcacagt tcctggggac ttgcgtctct 1560 tccatctagg atagaccttg ccctcaggta acctgggtat tggggccagg tctgtgccta 1620 taccccgccc ttcccccagc tagaccaggg agtgaagtgg cccctagtgt ctccacgtgt 1680 cctcccctct ctcccagctc tgcacttcca ctctctttca gatctctagc tcctacacaa 1740 ccaccactac catcacagca ccttcctcca gggtcctgca gaatggaggg ggcaagttgg 1800 agaagactcc ccaatacgtg gaagaagaca tccgccctga aatgaaagat gacatctatg 1860 acccaaccta ccaggataag gagggcccaa ggcccaagct tgaatatgtt tggagaaaca 1920 tcatcctcat gagtctgcta cacttgggag ccctgtatgg gatcatattg atccccacct 1980 gcaagatata caccttgctc tggggtaaga ggtccccttg tcctcctgtc tcagtatccc 2040 aggttctctc cactctttta atacagtagc aacttacaca gagtagaaac accagcccct 2100 ccaggccgag gtttttccaa ccatttctct taggtgttgt ggtgggctgg gaagggagtc 2160 tagggggttt gggatgcagg agtgtcgatt ctggggcctt taatttgggg gggggggttg 2220 gagagggagc cctgggacca tgggccacag gctttgaagt gagtagatct gtgccaggga 2280 gtcagctttt ctgtttcaag tcattttctt gactgcttgt cccagccctg ccagcctaga 2340 aagaatcaag gcccttacct ggatgcatgg gaacatgggg ctagactagt gtgactttag 2400 agggcacatg ctgggtatag tcacggggta gcaagagaaa ctactcagga agagggttaa 2460 gcgaagagg ggggaagaga gctgtggtca tccatgaaat tattttgccc tgatccttag 2520 ccttatcagg ctccttaatt acacakacag aggaaggcgg ctcctgcata actcatgtta 2580 catggatgtc ttgctctgtg actccacgtg ggtctccagg gaactgcaca tgccactcaa 2640 gaaaatgttc taatgaaata aggttaaaga aacgtttcct gccccattcc ccacccatcc 2700 tgctccagcc cctctcccct gatgccagga gtgcctcctt gctggggaca gccaagccag 2760 aaaagagact ctggagcagc cccggccctc aggctgctgc agtgagggag acagtccccc 2820 gtgcgtccct gacctgccct tagctcagct ctttcaggaa tccatggctt gggctgatag 2880 tggagccctg ccccctcaca cacatgcgct ctgcaggcat tgccactcct gcctcgagtc 2940 tgacttggga agaggagagc agggaactct aaagatccag gagctccatg ctgctaccct 3000 ctgtgatggg tgtggggttc agaactccct gttaagaaag ccacggtatg gtttctggag 3060 cagtgtcgga tgttgggtcc ttgctggcag ctatgctctt ggagggtggt tctacagaag 3120 gactggtggg ccaagtttca gcaaagtcct ccaggacctc tttgatctaa agagggtgga 3180 tctggtctgc ggagccttgt cttggcagat cctcttggtg ccacagacag agaaatgcat 3240 ctgggtagat tccctctctc aattttccca gacacaaact ggggacaaca ggactttttt 3300 taagcttaga aaggtagtgc tcctcttttg gcctccctga agcatgtgga gttgccggac 3360 cggggatcag acctaagcct cagctgcagg aatgccggat ccttaaccca ccctaccagg 3420 ccgggattcc acctgagtcc cagcattccc aaggtgccgc tgatcccgtt gtgctacagc 3480 ggacattcca agaaaggtgc tcctggagtt cctcgagtgt cattgctggg gccagccagg 3540 tgcagaggaa atcaattcat cctcagacca ggaagggctc ttataattgt aaggggaggg 3600 ggacttctgc tccccagccc ctctgagaac ccagcagagc ttgagttgca gtgtgaggaa 3660 tcaagagcca gggacatgga tgccccaggg aatctgtggg ctcccctcct gaccccttct 3720 cccccataga ggagtcttca caagtttagt cacttccaag tccccctcca gcctcaggac 3780 tccctgtcgg cctcgttaag ttccgagttt ggccaggcag ctgctgctgg ctcttctccc 3840 ttggctgcta ctgcagggga caggatgctg tccccaacca aggctgtgcc tgccgccttt 3900 ttggtgccct gcctgtagat gtgtgctctg cccttggaca gaaacctgtc acacagactg 3960 gatggtgact tttttacttg tccctggatc ctgtggtggt ggatggctta gctgatggaa 4020 tgaccatttt ggtatggcca tatccgagct cctctggtgg agttgggggg agggtcagag 4080 ttcccgaacc ttaagagttc aggaacttgg cttcatcttt tcttgtcttg tccctaagga 4140 cagtgctaaa ttagcaaatg gttgtgattc cagcatttgt caggactgag caattttgag 4200 tgtctcagaa gagccctgag ggctgaagcg atacctggca gcacctgggg gctctgaggc 4260 gaaacgtctc caggctcttc cttagggcta aaactatgaa gttttgctta accataaatc 4320 tagactttag tagagaatga atatccaact gacaggctta ggggtgctgg tagaaaaagg 4380 caccagagac ttgggtgttt ccccaggttc tctgttagga tcatatgtgc ttccattttt 4440 gtgctttgct tttttagggc cacacttgcg gcatatgtaa gttcccaggc taggggtcaa 4500 atgggagctg cagttgctgg cctacaccac agccacagca actcccacgt acaccacagt 4560 tcatggcaat gctagatctt taacccactg agtgaggcca ggcatcacac ccatgtcctc 4620 atggatacta gtcaggttcg taattcactg agccacagtc agaactgcct gcgtgtgctt 4680 tctgagtcag cttgccaggg tcttcggttg catgtaacca ccccagtagc ttcctgggtt 4740 ctgagctacc tctttcgtgc tcaaagactt ttcttggcct ttggtgattg gcgggctgcg 4800 gctcaactgt tatttatcca ggtgcagatg caggcagatg ctgcctctgg gaggatatta 4860 ccacaaggcg ggggaggcca gaaaatcacc tggaccccta atgcagcccc gaggaccgtg 4920 ggtggcactt ccctgagaca gactctggct ccctggctct cctccctgtc ctgtaggagg 4980 aataggctag ggtagaggaa ggtgggtggg acagggggct tgtttaggaa actggtgtct 5040 gtggctgaga acacaagaca atgtgttaca atgtgtggtg tctccaactg caactaagtt 5100 cagtggccac tgaggatcca ttgtttctag ctgcttccct aggaatgaaa cattgtcaac 5160 agtcactgct ctcccaaggc ctcagcctct gcctcctaga gctgctgaac agaggaaggt 5220 gggtgtgccc agcaacccgc ctcccagtta gagactccaa cctgcacccc tagaacctgc 5280 aggcccccag gaagatgagg tagacagcgc tggggtgccc cccaccacag ctttgagcct 5340 gccctaccgt tgcctagaat taaccctgac aggggtatga gctgactgag gaaggtggca 5400 aaggagagat gcaggagcgc tgcgagtatc ttgggcgggg gggacatggt aaacatcctc 5460 gagccagggc tcaggagcac caagtacttg ttgacagaac acctcatttc aaaccatggc 5520 tccatttttt tttttttttt tccttttgct ttttagggcc acaccttcgg catatggagg 5580 ttcccaggct aggggtctaa tcagagctgt agccacccac ctacaccaca gccataggaa 5640 ctcaggatcc gagccgcatc tgcgacctat tccatagctc actgcaacgc cagatcctta 5700 actcactgag tgatcccagg gatcgaacat gcaacctcat ggttactagt tggattagtt 5760 tttgctgcgc cacaacagga actcctatgg ctccctttct tactagccat gtggccttag 5820 ataaacactt aatctttctg agtgtctatt tctttggctt aaaccccatg taaggtatcc 5880 agtgaatcaa agaatacaga aatctggagt tccccttatg tctcagccgt aacgaacctg 5940 actagtatcc ataaggactc gggttgatcc ctggacccgc tcagtgggtt aaatatccag 6000 cattcctgta agctgtggtg tgggttgcag acacagctgg ggtctggcgt ggctgtggcg 6060 tacgttggcg gctgtggctc caattccacc cctagcctgg gagcttccat atgctgggga 6120 tgtggctcta gaaacaaaca caaacaaaca aacaaaaatc cttggcaaag cttaagactg 6180 tgcagatatg acttaggtgc aaggcgagtt ttccccattc tgtgaccacg cagtctgcca 6240 aaagactgaa atggttttgt accagatggt aaatagctct agttctgagc cccccccccg 6300 ccccccgccg ccccccatgt cccctagaac ccagagtccc tcaaactggt cagtgcccag 6360 gccatcctgt cttaacatat tttaatactg cccttgttta tgggtcttca gctctgcaag 6420 agtactctgt ggtccttaaa actgtggaga agcttagtga aggtcagagg agatgggacc 6480 tgggataatg tccttcatga cagagaatga caagtggctg gagggtgaga gccctcttct 6540 ctgtcccgcc ttcctgaact ttctgggacc tgtaagctta ttccagctgt gaggctaaga 6600 ggataggagg cgatggtaat ttttttccaa gtggtaaaat tgaaggggcc taagagatct 6660 aggtgtccgt ggagttcagg gaaaagcaga tcctcacctg cagcctgaag gacacccaga 6720 cgctgacctg aggagaacat cacgtgtaag acttgccccg attactgact ccctgtcctg 6780 tcttccggca gcgtttgcct actatctgct gagtgctgtg ggtgtcacgg caggagctca 6840 ccgcctgtgg agtcaccgaa cttacaaagc tcgactgccc ctgcgggtct tcctgatcat 6900 tgccaacacg atggcattcc aggtaagaag ccagctgtgc tcagctcttt atcaaacgca 6960 ggcgatgggt gcctggaagg gagcagcacc tggacagcta cttcactttc ctctctgctt 7020 ccagtcacct caagttcagg ttcagtcctt gggtccataa cacctgcagt actttggagt 7080 gactggaaaa gggaaatagg ggataaagag gaaatagcct ctgtgtatag gatcgttttc 7140 gagcctccgt tgtcacacag tctggtcgtt gtggtccctt cattagtgca cgaggcagga 7200 actgaccctg atttcctagg cagccgttgg acaatacatt cactatttta ggtgaacatc 7260 tcaggactcc accaaaaggg attaaagtta atgtttcaca gattcatgaa ccctattgtt 7320 ttcaggtgag aagatcaaac acttttatag tgttaactat acctcctggc cctattctga 7380 gcacttgaca aggattacac cattaagccc tcccaacagt cttaggaggt tggtactgtt 7440 gtgatcccca tttcacggag ggggaagctg tgtcactgag ggtgtaggta gaccatcatt 7500 atggtcctgt gttgagctgc caagctgtct aagtcaaata ttgaggtctg ctgaagccgg 7560 aagctcatag cagggaattg gagaaaggga actccgagtt attgaacagc agcactgggc 7620 aaaggctagc atgttgtgtg gggcttagct tggatcaagg ggcaaaaaga aggaaaccaa 7680 atcggttcct ttcttcgtgg cagtgtctca cacagctgca taactgtctt ctgccatagc 7740 acttaacgcc ttgaaggccc ctgatgtggt ccctgttggg gcaaaagaag gaagagatat 7800 tggcaccctc tctaagcgat agaaagtgtc ccagaggagc ccagagacca tttggaaatg 7860 cggtcaaatc atgattatgt gtctggcctt gttgagttgt gggagctgaa tcttgccaag 7920 ggattaggca gcctgtgaag accctttgct ccagttcttg ctggaagaat tgcaattttg 7980 cctcctagtg aaactcttca agctctatac aatccatctc cattctgccc accatataac 8040 ccgcaagaag cagccagccc tattcatgtg gtcctgagac ttgaaggtgc ttttccactt 8100 aagcatcagt ggccagttag agaggaggca actccctgac tcctcctttg gagccttgac 8160 tcccaggtat ttcgcgagct tgggctgagc gcctcgggct cttgaagaca cctagccatt 8220 ggcattcccc tgagagggtg tctctcctca ggcctccatt cctcttctct gtccctccag 8280 aatgacgttt atgaatgggc ccgagatcac cgtgcccacc acaagttttc agaaacagat 8340 gctgatcccc acaattcccg acgtggcttt ttcttctctc acgtgggttg gctgcttgtg 8400 cgcaaacacc cagccgtcaa agagaagggt ggtttgctta acatgtctga cctaaaagcc 8460 gagaagctgg tgatgttcca gaggaggtga gtgctgtggt ggtggagctg ggcgcctggt 8520 gtttggggac accctctccc ctccctgttt tttcttctag gacttgtcca cataagctgg 8580 gaaactgaca gggtctgctt accccaaatc ataattcaaa acccttcttt tatgggccac 8640 agccatagac tgttgttgat tctttctctc tgagctaaaa aaaaaaacca gttaaggtca 8700 acaatgtgtg ttgacctgtt acagtcatgg atacaaagct acatgttgtc atagtcctta 8760 ccttcaagaa gttcatagcc tgttggggat gggagcacta agccaggtgt ccaaatacct 8820 atgacatggc aaaatatttt tctgtcccca ggaaaggcac agaggggagg gagactgtgg 8880 agtggggaac attagagaag ggttttatga gaaggtagct taggaatcca ctggtagctt 8940 aggaatccac ttaggaatct ttgtaagatt ttcacaagtg ttggcggagc gggaggcagt 9000 gcaaacagaa agaatgagct aaagcatgaa gcatgttcca gcaatagagt ccctctgctt 9060 aaagtacagg gtgtggtagg aaataaagac tagagagacc gagacctttc ttgtggggcc 9120 ttaagagcag acagggttta attcaactcc agcaatagga aaccatggaa gggtttttga 9180 gccggaatgt ggtcagaggt gtgctctgga gaggtcaccc tgcagatagg tgaaagaaac 9240 cgttgggctg aagaggtgag ctgcagggcc ccaggtgagg aggtagtggg catccatgct 9300 ggggaagtgg tggcacggag aggaggcgaa atgtggggac acacgtgatc caagagtagc 9360 agacttgact gctgaagagg tgcaggaaat cagctccctc ggaatgtcag tagcctgttt 9420 tactttggga gaatgaagaa tgggccaggg cctccagagg gacagcctgc aggcatccgg 9480 gacactcggt gtgcccctga ggggaaaaga agagaaagga tcagaaggct tgctggctag 9540 caagagagga aggcaagata ccaaacacag attctgcaaa gagcactgac accaagagag 9600 gagcaggcag aatggaaaga cctgggcagg agaactcagt tcagtaatct gtaatttggg 9660 ccgcccctgt tgtggtacga ttaggctgtg gtcaaagaga gcaatggatg gagagtcggg 9720 agacaaggca ttccagccct tgctccactg gttcctggtg gtatgaccct agaaaagtca 9780 tttagcccct ccttacctta cctcatcaaa aaagtatgat aataacactg ccttctcaaa 9840 agactaccca ccccatccct cttgctctgt ttcctgccac cttgtgctca cagcgtagag 9900 ggtaggggac agctcagccc catgaaagga caaagtcaga gtcccctcca tgaatggggt 9960 gtgtgatctc tccctgtagg tactacaaac ccggtatcct gttgatgtgc ttcatcctgc 10020 ccacgatcgt gccctggtat tgctggggtg aagcttttcc ccaaagcctg ttcgtcgcca 10080 cctttcttcg ttacgccatc gtgctcaatg ccacctggct ggtaaacagt gctgcccacc 10140 tatacggata tcgcccttat gacaagacta ttagcccccg ggagaatatc ctggtttcat 10200 tgggagctgt gggtaagtta gcagtccata gcaagacccc atctagtggg ctgctggtta 10260 agagtattag actaggagcc agaaaaacca gattaacctg ctttatgacc cctctctgtt 10320 tctctgctat aaaactaagg tgcaatagta gatacccctt gagagttggg cagcaagtct 10380 tatataaaga gaattgggct aaaaaataac aatgtctctg agtccaggtt ccaaaaaaga 10440 tccccaggtg ctctggatga ggaaccgctt tggcttgtcc tttttccagt catctctggg 10500 ctggcacatg gtctggctag gggcagggac tgcatgaata gaacagtagg gtcttctggg 10560 tggccagtaa gcctagtgtt ttatatttag acatgctata caaaatgcag aacaaatcct 10620 taacatttca acaagcttct cttttatcac cttgctatat tcagagaggc tgaactcaaa 10680 gtgtatttca tgccttattg tttggtgatg ccaacatgaa ggacctcaaa gcaactgttg 10740 gtggcccttt tatcaccacc gaccgctctc atctcttgtc ctttattctt ctcttgtcct 10800 ttattcttct ctaacccgtg ctgggaacac ccgctcccct taacatggct tggagaactc 10860 ctgataaagc agttaatttg atcacaagtc tctgctcact gatctaatgc tgactattca 10920 agaatatctt tctaaaaaaa aaaaaaagtt gtatctttct ctcattccag tttcaatagc 10980 cagaatctaa gacaacagtg ttctaccatc tgtctccctt ttattttttc ctctgccact 11040 cttttcaact aaacatagat cttgactaac gcctggaagc agttttcctt aagcagcgcc 11100 tgtgacctct tccacgctag tgatcagtgc cactggttgt ctggcatatc taggcaacct 11160 ccctgctccc cacatgtgtg tacactgcgg cctagctttt gctttgttct ctttaaaacc 11220 tttctttatg tgctcaaccc tgagcatctt ttttttttac aatctgtact aaagacattt 11280 catttgtatc tttttttttt tttttttttt tttagtgccg cacctgtgcc atatggaagt 11340 tcccaggcta ggggtccaat ccgagctaca gctgctggcc tccaccacag ccacggcaat 11400 gccagatcca agcaacctac accacagctc atggcaatgc tggatcctta acccactgag 11460 caaggccagg gattgaaccc acaacctcat ggttcctagt tggatttgtt tttgctgagc 11520 cacaagggga actcctgtat ctctttttaa ctttcatgta tcttccccct cctttcaggg 11580 accctctacc attgtgcatg tatctactct gaaccatgtt tgaaatctaa caggctattt 11640 tcatagaaga tttatgaatg ttgtggaagt ttctggaatg agactggtcc tggatttaga 11700 atgagctccc ccaaccccag tctctttcta accatccgtt caaagtagct gccaacatct 11760 tcctttgtct caattatcat tcatccctcc atcctggctg ctctccccct tattacctca 11820 ccctttgttc tcccatagct ggcttccctg tcattctaat ctttttcttc ttgaattacc 11880 tcccccacag tcacatgctc atctctccgc taaagctgac ctcctgcctt gagcctctcc 11940 tggactgtgt cttgctgccc cagttgcaga gtcttgtcct tctcctcttt ttttctccct 12000 tggcaactag tgtgtgtctg attaaagttt taaatctgat aagtatatct gataagcctg 12060 gctagtgctt atcaagatcc tagctgcaga attttatgga aattcgtact tttagccttg 12120 gt; agtcagacag aggacctacc tcgaatgatg ccctggatgg tgtcatttcc tttgcagaat 12240 ttccttcctt gcttgttatt aatgtcatta ctactctact aaggctcttt catcttcaaa 12300 gggctcaaca tgctctttta ttagctattc ttgcccagct ctgcctgggc gtcataaggg 12360 gtcagcattg tcatagttga atgctgttcg gaaaaaagat cccgccaagg gttggagacc 12420 tctggctctg gagtttgcac agctcaactc atgacagaca ttattctgaa tccagagttt 12480 ctctgatttt cttctatgga gcaaagtgaa ctcctcttct cagaagcata gaggtttttt 12540 attctaattc taagcctttt gattctgttt ccctcagaga gcttctgtct tatcagcttg 12600 acccccacac caggattcaa gctcaaagaa ttagaagcca gagcagtccc ctctgaacca 12660 gtggaaactg aggaaatgtg ggcccctggt ctgggcctct ttctgacttt tgactgttgg 12720 tgcctgattc cgtggtacct tctgccctta gagatggtat ggtacagtgg ggaaaggtat 12780 acccccttgc tcaccttttt cagaaacacg gcagcagttc tttgttctag actcttctct 12840 cctcacccta acacatgctc actcatacag agctttaagg tctcagacca ataactagtg 12900 aagctctgga atttcccaat ctaaaattta tcccctgtga tagcagtttc tctccggtca 12960 tcttatcccc tcagaggaac tgtcagtcct cttcccacag aggctcccag agagccatgg 13020 cgaccagggt gtccccagtt gtttctcaag gtgcctctga ggggatctat ttcgttgaaa 13080 agactggatt cattcattca accacagcaa gttatctgct aggtttgagc tgtgccaccc 13140 ccagtgtagc ttcatgactt ttctctgctt tttgttccag gtgagggctt ccacaactac 13200 caccacacct ttccctatga ctattctgcc agcgagtacc gctggcacat caacttaacc 13260 acgttcttca tcgactgcat ggctgccctg ggtctggctt atgaccggaa gaaagtatcc 13320 aaggctgcca tcttggccag gattaaaaga actggagatg agagctacaa gagtggctga 13380 gtttggggtc ccttgggttc cttttctgaa agccagctgg gcagaggttt aatgttctgt 13440 ttattaacta ctgaataatg ctaccaggat gctaaagatg atgatgttaa cccgttccag 13500 tacagtattc ttttaaaatt tcttttaaga ttgaaagcct acaattctgc ctttatgatg 13560 ctaagctcat attcttgttt cttctctctc ttctagtccc attgtccttc tcttggcttt 13620 gttcctgtca ccttcctctc tcttccccct cactgtgccc caggcaagga gctggtcagt 13680 cattggtggg tttccagctt ccaaagccta gacctttcag tagtccaaaa ctggtgagtg 13740 gtctttgccc cagatagctc tttctttgag ttgtcctgag ctttaaggtg ggtggctcaa 13800 gggagagagg tgataaagtc ttctgggaaa gccccgttca ttattttcag cccagacttt 13860 tgctcgatga catggaaaaa taactctatt ttggcacaaa gcttcgaaag caggtaattt 13920 gtcaggggag ggagttagca tgctgtgtgt ggtggggttg ataaagaagg gggaggtgag 13980 gtgggaaacc aggcaggagg ctcctgctgt gatgggacac tcggctgact gcccagtgag 14040 ggctttgcgc cctgacacac agcatgcttc ctttctctcc tgactctggg gaatggccgt 14100 ggaacttggc aatgctagaa ctcaaaagca catcccagtg tcccaatgta cgttaggctg 14160 aggataaaga agcagcattt agtttgtggc agcagtggtc tctgctgggg aagaagtctt 14220 tcttgtctct ttaataacag gaagatttct tattccatag agtgagaaat cttgaggttc 14280 tttccggaat tgctgaatcg gcaactcatg caattgtcct cactcttttc atcttcccgc 14340 tctgccatct ttgggataca gctcccctca tagtaacaat aaggtggctg ccgcattttg 14400 agacatcgga actgaggtgt gttggtggta ccgtggtgag cttaactatc ttcccaaaaa 14460 gaaaggattt tagcaggtgg aggtgggtcc cacataaaga tagttaaacc tcggtacttt 14520 gcttggaata ccaacataat tctcttggac tatttccctc tgaaagagaa ggaggcttga 14580 gaagaggaag aatgggggtg gatggtctcc tttcctctct ctgctgaaca ggagatggag 14640 gggttgaggg gcagggtcta gaggcagctc ctgagacata acattgcaaa cgaagggctc 14700 tgggggattc agaaggttac tgagtaagtt actggacgtc ctcctatggg aagctggtca 14760 cacaggcaag ttagatattg gggttcattt cattcattcc agttgctgct tggaataagg 14820 aactagaagg ctgctcccca cagtgtgaaa gcctttcact cctgccttct agcctcaagc 14880 gtactaccct gactatggat tcctgctctg ccctgtctat ccgttttttc ctgccggttc 14940 tatctcctcc ctgagatttt tcctttctct ctggagggca ggcctccttt gggagtatgc 15000 aaaggcagtg atggctgctg ctctacaggc agcttcctct cccacagtca gaatgctcag 15060 ggtcactgaa ccactgtttc tcttcacaaa ggtgagctag ctgccacctc cacgtggcct 15120 ccagagtctc cacctgcacc cttgtgctcc cctgccactc caatgattca agacaaggcg 15180 ggcaaaccct cctagaaaca tcccgggcac gggcatcctt tctcataagg cacagccaag 15240 ccaaatgctc acgttgtgcc agtgagtcag ccacagagca aaagagggtt tgtggttagt 15300 ctcctctatc tgggtcagaa ccagagagca ggctggatgc cccctgcttg ctcggtaagc 15360 ctgcccagcc tgagtcagtg ctcgcggctg acagtgcaat gcttgcagaa acaggaggga 15420 gcccggtctt cactgggaag cacaagaggc caagacaagt tccaaagtgc ctcactcgaa 15480 agggaaccct gtcccctgga gctagggtgt accacaaagc tttggctgag tcttgggctg 15540 aacagcgtct ctgttcagca aactaaccag cattccctac agcacagccc aaggcagaca 15600 agagaataga agagggctgg aaaacaaaaa ataagaacct tggcccactc ctgtccctgt 15660 aacctcagtc gtcaacacag aagcctggct ttactctaaa gattggaaat atacaatacc 15720 agatgctctg tccactgttg agccccagga gtggaagggc agagagcatt tcttcctgta 15780 ttaactgagt aaatggagga taaaggggtt gggctggact agaggcatct ttgtcttttg 15840 agccattctt ctcagtagaa aaaaaagctg atggaagatc actatagttc acattcccag 15900 acccaagcac ctactctttg gaaatgactg ttgggttagt tttaattcca caggtcgtca 15960 gatgcctgct ttatagctga tgatcaaaac caacttttat ctttctattc taattgtttt 16020 caatggatct gatccatacc ataaccctac acaaggctgg atgggcttct taggccaagg 16080 gccccagtgt atgtgtggat gtgtagggtg ggagggcggg gagtaaggaa tacttttttc 16140 aaggttctaa agctgaattc aaatgacgca ttaatgaccc agaaactcag atctgatcga 16200 atctgaattt ctaacaggcc ttgctttgta ggtgtactga caacttatct gggggcctta 16260 catctttttt aatcggtgtt acgtccgagc ctgctctgct ccctcactcc ctctgcactc 16320 cctctgtggc gttcccttgc ccctgagagc ctgcagaagt ggctggtaga agtggggggc 16380 tggctggaga attatcagta tgcaggattc ctttctgggc tttgttttgg aaactttcct 16440 tagggctgtt tttattaagt gcccacattt gacggaaggt ggaaggaatt tgaatgtatt 16500 tgatttataa tgttattatt attatttttt tagattaaaa gatggttgta gcatttaaaa 16560 cggaaacctt ttctcctggt tagctagtat cctgagtgta ttctctgtaa gtgtagctca 16620 aatgggtcag cgtgaagaaa agttaaagaa agcacgatgt caaggttaca cgggtggtta 16680 aggccagggc ctctcctacc actgtgccac tgacttgcta tgtgaccctg ggcaagtcat 16740 ttaactataa tgtgcctcag ttttccttct gttaaaatgg gataataata ctgacctacc 16800 tcaaagggca gttttgaggc gtgactaatg ctttttataa agcattttgg gatccttcag 16860 cagaggaatt ctcttaagtc ctgagtattt ttataataac agtatccacc atgaactgtg 16920 tccaccatga accctgtgtc ctggatgctg tcattaatct ttatggttct ctctgagaaa 16980 ttgaataaac ccaatagata agtggtggat aactagtcag acagaatctg agaatgcata 17040 aactcattgc catggaaaca tacacaggat accttttcct tgattgggtg ggattttttc 17100 ccctttttat gtgggatagt agttatttgt ggcctaagaa taattttgga ataatttcta 17160 ttaatatcaa ctctgaagct agttgtactg atctgagatt gtgtttgttc ataataaaag 17220 ggaagtgaat ctgattgcct tgtgtctgag aggttttttg cctgtgagtc agtctcttgg 17280 gacttaatct gccaccctat gtcctgttcc tataccttta agagagtaaa aaaagtagaa 17340 gctacaatgg ttgattcaca ctctagtaac ccgccctgcc ctccctgccc ttcttagggg 17400 taactttagg ttaaactcag ccttggcagc aggaagccag gagtctgctg ccattagatc 17460 agacatgtta accccagctg gctctttggc cctggggaaa tgccaggtct ctttcggtaa 17520 catgggccaa aaatgatact gagagaggaa aggagcagca ggtgacactt ccctggaaag 17580 gggttctgta cctggcaacc caggctgggc catcctgctt cattcctctg aaatgtagcc 17640 ccttctggga ataaagtggc ttcctgaaaa tgctgattaa caacagcagg aagaaaggaa 17700 aagcaatcct agagaagcct tgtaaattcc tggaatagag agggcttcat gatcatcaac 17760 tagaaaggct ttggctttta ctgctttagc taagaatctt tttttttttt ttgtcttttt 17820 gctatttctt tgggccgctc ccgcggcata tggaggttcc caggctaggg gtccacagca 17880 acgcgggatc cgagccgcgt ctgcaaccta caccacagct cacagcaacg ccagatcctt 17940 aacccactga gcaggggcag ggacccaacc cgcaacctca tgattcctag tcggattcgt 18000 tgaccactgc gccacgacgg gaactccgct gagaatcttg atgtgcaaac gagaagggct 18060 ttttttgaag aggcttcatt ttccaacagg agccacctaa gcttctgagc attccccaga 18120 ccccccctta cactttctag tgtaacgtcg cactcacctt ggacaagcac gactctctca 18180 gtgattcatc ccaaatcaag tctatattca gtgaggcctt gccaggcctt a 18231 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P1-F <400> 2 tgaagtggcc cctagtgtct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P1-R <400> 3 catacagggc tcccaagtgt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P2-F <400> 4 gtcccttggg ttccttttct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P2-R <400> 5 ggacactggg atgtgctttt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P3-F <400> 6 aaaagcacat cccagtgtcc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P3-R <400> 7 cccccattct tcctcttctc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P4-F <400> 8 gccttctagc ctcaagcgta 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P4-R <400> 9 gtgctgtagg gaatgctggt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P5-F <400> 10 atggaggata aaggggttgg 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SCD-P5-R <400> 11 ccacttctgc aggctctca 19

Claims (9)

교잡종 돼지의 지방산 조성 예측에 이용되는, 서열번호 1의 1,817번째 염기가 C 또는 T인 단일염기다형(SNP)을 포함하는, 서열번호 1의 핵산서열의 10개 내지 100개의 연속적인 핵산으로 구성되는 폴리뉴클레오티드.Comprising 10 to 100 consecutive nucleotides of the nucleic acid sequence of SEQ ID NO: 1, comprising a single base polymorphism (SNP) wherein the 1,817 base of SEQ ID NO: 1 is C or T, Polynucleotide. 제1항에 있어서,
상기 교잡종 돼지는 랜드레이스종과 한국재래종 사이의 교잡종인, 폴리뉴클레오티드.
The method according to claim 1,
Wherein the hybrid pig is a hybrid between a landrace species and a Korean native species.
제2항에 있어서,
상기 교잡종 돼지는 F2인, 폴리뉴클레오티드.
3. The method of claim 2,
Wherein the hybrid pig is F 2 , a polynucleotide.
제1항의 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드와 특이적으로 혼성화하는 폴리뉴클레오티드.A polynucleotide that specifically hybridizes with the polynucleotide of claim 1 or a complementary polynucleotide thereof. 제4항에 있어서, 상기 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드와 특이적으로 혼성화하는 폴리뉴클레오티드는 서열번호 1의 1,817번째 염기에 대한 대립 유전자 특이적 프로브 또는 서열번호 1의 1,817번째 염기에 대한 대립 유전자 특이적 프라이머인 폴리뉴클레오티드.5. The polynucleotide according to claim 4, wherein the polynucleotide or the polynucleotide that specifically hybridizes with the complementary polynucleotide of the polynucleotide is an allele-specific probe for the 1,817th base of SEQ ID NO: 1 or an allele specific to the 1,817th base of SEQ ID NO: A polynucleotide that is a specific primer. 서열번호 1의 1,817번째 염기가 C 또는 T인 단일염기다형(SNP)을 포함하는 서열번호 1의 핵산서열의 10개 내지 100개의 연속적인 핵산으로 구성되는 폴리뉴클레오티드 또는 서열번호 1의 15,384번째 염기가 A 또는 G인 단일염기다형을 포함하는 서열번호 1의 핵산서열의 10개 내지 100개의 연속적인 핵산으로 구성되는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드 중 어느 하나를 증폭할 수 있는 프라이머쌍을 포함하는 교잡종 돼지 지방산 조성 예측용 키트.A polynucleotide consisting of 10 to 100 consecutive nucleotides of the nucleic acid sequence of SEQ ID NO: 1 comprising a single nucleotide polymorphism (SNP) wherein the 1,817th nucleotide of SEQ ID NO: 1 is C or T, or a polynucleotide consisting of the 15,384th nucleotide of SEQ ID NO: A polynucleotide consisting of 10 to 100 consecutive nucleotides of the nucleic acid sequence of SEQ ID NO: 1 comprising a single base polymorphism of A or G or a pair of primers capable of amplifying any of said polynucleotides Composition prediction kit. 교잡종 돼지로부터 게놈 DNA를 추출하는 게놈 DNA 추출단계;
상기 추출된 게놈 DNA를 주형으로 서열번호 1의 1,817번째 또는 15,384번째 염기를 포함하는 서열번호 1의 핵산서열의 10개 이상의 연속적인 핵산으로 구성되는 폴리뉴클레오티드를 증폭할 수 있는 프라이머쌍으로 상기 폴리뉴클레오티드를 증폭하는 증폭단계;
상기 증폭된 폴리뉴클레오티드를 제한효소 HpyCH4IV 또는 AciI로 절단하는 폴리뉴클레오티드 절단단계; 및
상기 절단된 폴리뉴클레오티드를 전기영동하여 밴드 패턴을 분석하는 밴드 패턴 분석단계를 포함하는 교잡종 돼지의 지방산 조성 예측방법.
A genomic DNA extraction step of extracting genomic DNA from the hybrid pig;
The extracted genomic DNA is used as a template and the polynucleotide can be amplified as a primer pair capable of amplifying a polynucleotide consisting of 10 or more consecutive nucleic acids of the nucleic acid sequence of SEQ ID NO: 1 including the 1,817th or 15,384th base of SEQ ID NO: An amplifying step for amplifying the amplified signal;
Polynucleotide cutting step of cutting the amplified polynucleotides with a restriction enzyme or Hpy CH4IV Aci I; And
And a band pattern analysis step of analyzing the band pattern by electrophoresis of the cleaved polynucleotide.
제7항에 있어서,
상기 프라이머쌍은 서열번호 2 및 3 또는 서열번호 8 및 9의 핵산서열을 갖는 프라이머쌍인, 예측방법.
8. The method of claim 7,
Wherein the primer pair is a primer pair having the nucleic acid sequences of SEQ ID NOS: 2 and 3 or SEQ ID NOS: 8 and 9.
삭제delete
KR1020120041710A 2012-04-20 2012-04-20 SNP marker for the prediction of fatty acid composition of intercross pig population KR101472323B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120041710A KR101472323B1 (en) 2012-04-20 2012-04-20 SNP marker for the prediction of fatty acid composition of intercross pig population

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120041710A KR101472323B1 (en) 2012-04-20 2012-04-20 SNP marker for the prediction of fatty acid composition of intercross pig population

Publications (2)

Publication Number Publication Date
KR20130118650A KR20130118650A (en) 2013-10-30
KR101472323B1 true KR101472323B1 (en) 2014-12-15

Family

ID=49636893

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120041710A KR101472323B1 (en) 2012-04-20 2012-04-20 SNP marker for the prediction of fatty acid composition of intercross pig population

Country Status (1)

Country Link
KR (1) KR101472323B1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101629097B1 (en) 2014-10-31 2016-06-10 제주대학교 산학협력단 Novel SNP marker for the levels of lauric acid in pig meats and method for determination of the levels of lauric acid using the same
KR101629096B1 (en) 2014-10-31 2016-06-10 제주대학교 산학협력단 Novel SNP marker for the levels of capric acid in pig meats and method for determination of the levels of capric acid using the same
CN108108853B (en) * 2018-01-08 2021-01-26 中国农业科学院农业信息研究所 Pork yield prediction method and system

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040049758A (en) * 2002-12-07 2004-06-12 대한민국(진주산업대학교총장) Early selection analysis method for gene of pigs with quality meat
KR20070038836A (en) * 2005-10-07 2007-04-11 정의룡 Development of molecular marker gene related with meat quality using stearoyl- coa desaturase (scd) gene of hanwoo

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040049758A (en) * 2002-12-07 2004-06-12 대한민국(진주산업대학교총장) Early selection analysis method for gene of pigs with quality meat
KR20070038836A (en) * 2005-10-07 2007-04-11 정의룡 Development of molecular marker gene related with meat quality using stearoyl- coa desaturase (scd) gene of hanwoo

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Anim. Genet., Vol. 43, No. 2, pp. 225-228 (2011.08.01.) *
고려대학교 대학원, 생명과학과 임규상의 석사학위 논문 (2010.02.) *

Also Published As

Publication number Publication date
KR20130118650A (en) 2013-10-30

Similar Documents

Publication Publication Date Title
Anton et al. Effect of leptin, DGAT1 and TG gene polymorphisms on the intramuscular fat of Angus cattle in Hungary
Raza et al. Association between FASN gene polymorphisms ultrasound carcass traits and intramuscular fat in Qinchuan cattle
Muñoz et al. Effects of porcine MC4R and LEPR polymorphisms, gender and Duroc sire line on economic traits in Duroc× Iberian crossbred pigs
Chung et al. Association of SNP marker in IGF-I and MYF5 candidate genes with growth traits in Korean cattle
Milanesi et al. Stearoyl CoA desaturase (SCD) gene polymorphisms in Italian cattle breeds
JP6424027B2 (en) DNA markers related to the 6 traits of pigs developed by analyzing the relations with traits and their discrimination systems
Mullen et al. Associations between novel single nucleotide polymorphisms in the Bos taurus growth hormone gene and performance traits in Holstein-Friesian dairy cattle
Stachowiak et al. The ACACA and SREBF1 genes are promising markers for pig carcass and performance traits, but not for fatty acid content in the longissimus dorsi muscle and adipose tissue
CN103911373B (en) Affect the main effect SNP marker of pork fat acid constituents and the application in kind of pig flesh characters genetic improvement thereof
CN109811063B (en) SNP molecular marker related to pig growth speed and application thereof
Jia et al. Study of the correlation between GH gene polymorphism and growth traits in sheep
Zhang et al. Single nucleotide polymorphisms in the FTO gene and their association with growth and meat quality traits in rabbits
Tomas et al. High amino acid variation in the intracellular domain of the pig prolactin receptor (PRLR) and its relation to ovulation rate and piglet survival traits
CN112195253B (en) SNP (Single nucleotide polymorphism) locus for increasing content of fatty acid C14:0 in chicken and method for breeding high-quality chicken strain by using SNP locus
Bhuiyan et al. DNA polymorphisms in SREBF1 and FASN genes affect fatty acid composition in Korean cattle (Hanwoo)
Fernández et al. Validating porcine SCD haplotype effects on fatty acid desaturation and fat deposition in different genetic backgrounds
Bartz et al. Transcript abundance of the pig stearoyl-CoA desaturase gene has no effect on fatty acid composition in muscle and fat tissues, but its polymorphism within the putative microRNA target site is associated with daily body weight gain and feed conversion ratio
KR101472323B1 (en) SNP marker for the prediction of fatty acid composition of intercross pig population
KR100804310B1 (en) 4 DNA marker of adipocyte-fatty acid binding protein gene related the intramuscular fat content in beef cattle
Orford et al. A single nucleotide polymorphism in the acetyl-coenzyme A acyltransferase 2 (ACAA2) gene is associated with milk yield in Chios sheep
Ferraz et al. Association of single nucleotide polymorphisms with carcass traits in Nellore cattle
CA2748228A1 (en) Selection of animals for desired milk and/or tissue profile
Fontanesi et al. Polymorphisms in an obesity-related gene (PCSK1) are associated with fat deposition and production traits in Italian heavy pigs
Cánovas et al. Functional and association studies on the pig HMGCR gene, a cholesterol-synthesis limiting enzyme
Grupioni et al. Association of RUNX2 and TNFSF11 genes with production traits in a paternal broiler line.

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20171020

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20181016

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20191206

Year of fee payment: 6