KR20130118650A - Snp marker for the prediction of fatty acid composition of intercross pig population - Google Patents

Abstract

PURPOSE: A SNP marker for predicting fatty acid composition of a crossbreed pig is provided to predict fatty acid composition, especially for a composition of unsaturated fatty acid and saturated fatty acid, thereby utilizing the SNP marker for selection of healthy pig entity and high value pork production. CONSTITUTION: A polynucleotide or corresponding polynucleotide for predicting fatty acid composition of a crossbreed pig is selected from polynucleotide having nucleic acid sequence of sequence number 1. The polynucleotide or corresponding polynucleotide comprises 0 or more of successive nucleic acids which include 817th of the sequence number 1 or 14384th SNP related base. The crossbreed pig is a crossbreed between Korea native kind and Landrace. The crossbreed pig is F_2. A polynucleotide which specifically mix with the polynucleotide or the corresponding polynucleotide is provided.

Description

SNP marker for the prediction of fatty acid composition of intercross pig population}

The present invention relates to a SNP marker, and more particularly, to a marker for predicting fatty acid composition of a hybrid pig.

Dietary fatty acids (FA) in meat are associated with human health. The ratio of fatty acid (saturated FA) and unsaturated fatty acid (unsaturated FA) in membrane fluidity and cell-cell interaction is known to be closely related to various human diseases such as cancer, diabetes, obesity, hypertension and neurological diseases. (Ntambi, JM, Prog. Lidpid Res ., 34: 139-150, 1995). Excessive intake of saturated fatty acids results in elevated blood cholesterol levels, which develop into cardiovascular disease. Saturated fatty acids, such as lauric acid (C12: 0), myristic acid (C14: 0), and palmitic acid (C16: 0), mostly have a detrimental effect on cardiovascular health ( Keys, A., Am. J. Clin. Nutr ., 27: 188-212, 1974). In contrast, monounsaturated FA (MUFA) and polyunsaturated FA (PUFA) lower the circulating concentrations of low density lipoprotein (LDL) -cholesterol by increasing LDL receptor activity in the liver (Woollett et al. , J. Lipid Res ., 33: 77-88, 1992).

The ratio of stearic acid to oleic acid is one of the most important factors affecting the balance of membrane fluidity (Ntambi, JM, Prog. Lidpid Res ., 34: 139-150, 1995; Zulkifli et al ., J. Anim. Sci ., 88: 2565-2575, 2010). The stearoyl-CoA desaturase (SCD) gene encodes an enzyme located in the endoplasmic reticulum and cell membrane, which is known to contribute to the balance of this ratio by inserting one cis double bond at the 9th delta position of the FA substrate in UFA synthesis. (Ren et al ., Anim. Genet. , 34: 471-473, 2003). The SCD gene was found to be located in the SSC 14 locus in pigs by fluorescence in situ hybridization and hybrid panel mapping (Ren et al ., Anim. Genet. , 34: 471-473, 2003). Several studies have been reported on the association between SCD polymorphism and FA composition in cattle (Ohsaki et al ., Anim. Sci. J. , 80: 225-232, 2009; Taniguchi et al ., Mamm. Genome , 15: 142-148, 2004). In pigs, a study of Duroc purebred investigated the association between the SCD gene and fat-related traits and reported no correlation between the gene and the thickness of the backfat (Ren et al ., Gene , 340: 19-30, 2004). However, recent studies have reported that SNPs located at the promoter region of the SCD gene have a strong correlation with fatty acid composition and melting point (Uemoto et al ., Anim. Genet ., 43 (2): 225). -228, 2012). Many factors influence changes in fatty acid composition, and differences in breeds have also been reported as one of the main factors of variation in pigs (Zhang et al ., J. Anim. Breed Genet ., 126: 259-268, 2009).

However, since the SNP markers identified by Uemoto et al. Have no correlation with saturated fatty acid (SFA), unsaturated fatty acid (UFA) and monounsaturated fatty acid (MUFA), it is difficult to use them as markers for predicting more efficient fatty acid composition.

The present invention is to solve the various problems including the above problems, SNP markers that can predict the content of stearic acid as well as other fatty acids, especially saturated fatty acids, unsaturated fatty acids and monounsaturated fatty acids in the meat of hybrid pigs It aims to provide. However, these problems are exemplary and do not limit the scope of the present invention.

According to an aspect of the present invention, a hybrid pig selected from a polynucleotide having a nucleic acid sequence of SEQ ID NO: 1 and consisting of 10 or more consecutive nucleic acids comprising the 817th or 14384th SNP related base of SEQ ID NO: 1 Polynucleotides for predicting fatty acid composition or polynucleotides complementary thereto are provided.

In the polynucleotide, the hybrid pig may be a hybrid between Landrace and Korean native, and the hybrid pig may be a hybrid second generation (F ₂ ).

According to another aspect of the present invention, a polynucleotide that specifically hybridizes with the polynucleotide or its complementary polynucleotide is provided.

In the polynucleotide, a polynucleotide that specifically hybridizes with the polynucleotide or a complementary polynucleotide thereof may be an allele-specific probe or an allele-specific primer.

According to still another aspect of the present invention, there is provided a kit for predicting hybrid swine fatty acid composition comprising any of the above polynucleotides.

According to another aspect of the invention, the genomic DNA extraction step of extracting genomic DNA from the hybrid pig; An amplifying step of amplifying the polynucleotide with a primer pair capable of amplifying the polynucleotide of claim 1 using the extracted genomic DNA as a template; A polynucleotide cleavage step of cleaving the amplified polynucleotide with an SNP specific restriction enzyme; And a band pattern analysis step of analyzing a band pattern by electrophoresing the cleaved polynucleotide.

In the prediction method, the primer pair may be a primer pair having a nucleic acid sequence of SEQ ID NO: 2 and 3 or SEQ ID NO: 8 and 9.

In the prediction method, the SNP specific restriction enzyme may be Hpy CH4IV or Aci I.

According to one embodiment of the present invention made as described above, since the composition of fatty acids, especially saturated fatty acids including stearic acid and unsaturated fatty acids including monounsaturated fatty acids, can be predicted in pigs, especially hybrid pigs, It can be used for screening, which can be used to produce high value pork that is beneficial to human health. Of course, the scope of the present invention is not limited by these effects.

1 is a series of graphs showing the correlation between genotype and fatty acid composition of SNP1 according to an embodiment of the present invention.
2 is a series of graphs showing the correlation between genotype and fatty acid composition of SNP12 according to an embodiment of the present invention.
Figure 3 is a haploview (a) showing a haplotype by the combination of the SNP according to an embodiment of the present invention and a table (b) showing the frequency of the haplotype of the three combinations.

Hereinafter, the present invention will be described through examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

Example

Example 1: Hybrid second generation between Landrace species and Korean native species (F ₂ A) production of pigs

Fifty-two hybrid first generation (F ₁ ) were obtained by crossing 8 male Landrace races and 11 female Korean native races, and 48 male F1 races were obtained by crossing 8 male Korean race races and 9 female Landrace races. The F ₁ pigs were crossed to obtain 1111 hybrid 2nd generation (F ₂ ) pigs. The breeding population, including the parental generation, was 1238 heads and none of the F ₂ male pigs were castrated. All experimental animals were fed with the same diet during the fattening period. These pigs were slaughtered at a similar age, with an average of 199 days of birth. All experimental breeding and feeding were carried out at the Nanji Livestock Experiment Station of the National Institute of Livestock Science, Jeju Island. Details of the management of swine are as described in Cho et al . ( Anim. Genet ., 42: 621-626, 2011).

Example 2: Fatty Acid Analysis

Muscle tissue samples were taken from 1100 or more F ₂ pigs and used for fatty acid composition analysis. Intramuscular fat in each sample was extracted using chloroform-methanol (2: 1, v / v) according to conventional methods (Folch et al ., J. Biol. Chem ., 226: 497-509, 1957). Fat extracts were converted to fatty acid methyl esters according to conventional methods (Morrison et al ., J. Lipid Res ., 5: 600 ?? 608, 1964). Separation and quantification of fatty acid methyl esters was performed using gas chromatography (6890N, Agilent Technologies, Germany). As a result, as shown in Table 1, 18 fatty acids including SFA, UFA, MUFA and PUFA were detected in each pig sample, the total SFA composition was lower than MUFA, but higher than PUFA. This result is consistent with SFA being less saturated than ruminant meat in monogastric meat (Smet et al ., Anim. Res ., 53: 81-98, 2004). Interestingly, capric acid (C10: 0) was detected in this study. Capric acid is believed to broadly inhibit oral bacteria and may contribute to maintaining the flora by inhibiting the colonization of additional bacteria.

Fatty Acid Composition of F ₂ Pigs Phenotype name Number of samples Average Standard Deviation at least maximum C10: 0 (%) Capric acid 974 0.11 0.02 0.05 0.19 C12: 0 (%) Lauric acid 974 0.10 0.01 0.06 0.16 C14: 0 (%) Lilistic acid 975 1.57 0.20 0.67 2.68 C16: 0 (%) Palmitic acid 970 25.04 1.32 20.8 29.25 C16: 1 (%) Palmitoleic acid 976 3.15 0.50 1.53 4.61 C17: 0 (%) Margaric acid 972 0.22 0.06 0.01 0.40 C17: 1 (%) Margar Olesan 971 0.25 0.04 0.09 0.45 C18: 0 (%) Stearic acid 957 13.67 1.12 10.37 18.50 C18: 1 (%) Oleic acid 972 40.88 3.75 26.7 52.06 C18: 2 (%) Linoleic acid 976 11.42 3.50 4.50 25.84 C18: 3 (%) Alpha-linoleic acid 975 0.47 0.11 0.22 0.84 C20: 0 (%) Arachidic acid 972 0.22 0.04 0.12 0.36 C20: 1 (%) Gadoleic acid 975 0.73 0.08 0.40 1.11 C20: 4 (%) Arachidonic acid 974 2.19 1.32 0.16 8.85 SFA (%) Saturated fatty acid 971 40.84 2.09 32.39 46.96 UFA (%) Unsaturated fatty acid 968 59.14 2.04 53.04 65.03 MUFA (%) Monounsaturated fatty acids 974 44.99 4.04 27.83 56.66 PUFA (%) Polyunsaturated fatty acid 976 14.11 4.69 5.19 29.88

Example 3: Genome Analysis

3-1: SNP confirmation

We extracted genomic DNA from parental and F ₂ pig blood samples using standard sucrose-proteinase K method. Parental genomic DNA samples were collected to identify single nucleotide polymorphisms (SNPs) in the entire swine genome, including gene regions, using massively parallel sequencing technology (Hisequ2000, Illumina Inc., USA). As a result, as shown in Table 2, a total of 16 SNPs in the SCD gene could be confirmed. Only one of the 16 SNPs (SNP1) was located in exon 2, and the remaining 15 were all located in the 3'untraslated region (UTR). Among them, SNP2 (rs80954581) and SNP12 (rs8091750) are known SNPs, but the remaining 14 SNPs including SNP1 and SNP13 are novel SNPs reported by the present inventors for the first time.

3-2: Genotyping

Then, to analyze the genotype of individual pigs, genomic DNA samples from F ₂ pigs were used for PCR-limited fragment length polymorphism (PCR-RFLP) based genotyping. At this time, SNPs used for genotyping were SNP1, SNP12, and SNP13. The three SNPs are easy to obtain restriction enzymes, and the RFLP band pattern is clearly distinguished, so there is an advantage of easy analysis. PCR primers for amplification of the SCD gene were prepared in each of the primer pairs described in Table 2 above in a PCR reaction mixture comprising 50 ng of genomic DNA, 10x buffer mixture, and 10 mM dNTPs (GenetBio, Korea) as described in Table 2. After adding pmol and Taq DNA polymerase 5 U and thermally denaturing at 94 ° C. for 10 minutes, 94 ° C. 30 seconds using GeneAmp PCR System 2700 (Applied Biosystems, USA) or C1000 ^TM Thermal Cycler (BioRad Laboratories, USA) , 62 ° C. 30 sec, and 72 ° C. 30 sec were repeated 35 times, and final extension was performed at 72 ° C. for 10 minutes. PCR products were visualized with ethidium bromide on a 1.5% standard agarose gel. Band patterns were analyzed by cleavage at a reaction volume of 20 μl containing 15 μl of the PCR product and 2 U of each restriction enzyme, followed by electrophoresis on the 3% agarose gel. As restriction enzymes, Hpy CH4IV (SNP1), Aci I (SNP12) and Msp I (SNP13) were used. Genotypes and allele frequencies of the three SNPs are shown in Table 3.

Primers and Related SNPs Used for PCR Amplification and PCR-RFLP Primer name Nucleic Acid Sequence (SEQ ID NO) PCR product size
(location) SNP name SCD-P1-F TGAAGTGGCCCCTAGTGTCT (SEQ ID NO: 2) 307 bp
(Exon 2) g.817C> T ^* (SNP 1)
SCD-P1-R CATACAGGGCTCCCAAGTGT (SEQ ID NO .: 3) SCD-P2-F GTCCCTTGGGTTCCTTTTCT (SEQ ID NO .: 4) 756 bp
(Exon 6 to 3 'UTR) g.12544A> G (SNP 2)
g.12682A> G (SNP 3)
g.12739T> C (SNP 4)
g.12818G> A (SNP 5)
g.12918T> C (SNP 6)
g.13055A> G (SNP 7) SCD-P2-R GGACACTGGGATGTGCTTTT (SEQ ID NO .: 5) SCD-P3-F AAAAGCACATCCCAGTGTCC (SEQ ID NO .: 6) 475 bp
(Exon 6 to 3 'UTR) g.13311C> G (SNP 8)
g.13417G> A (SNP 9) SCD-P3-R CCCCCATTCTTCCTCTTCTC (SEQ ID NO .: 7) SCD-P4-F GCCTTCTAGCCTCAAGCGTA (SEQ ID NO .: 8) 722 bp
(Exon 6 to 3 'UTR) g.13956A> G (SNP 10)
g.14378G> A (SNP 11)
g.14384G> A (SNP 12)
g.14424C> T (SNP 13) SCD-P4-R GTGCTGTAGGGAATGCTGGT (SEQ ID NO .: 9) SCD-P5-F ATGGAGGATAAAGGGGTTGG (SEQ ID NO .: 10) 570 bp
(Exon 6 to 3 'UTR) g.14884A> G (SNP 14)
g.15066C> G (SNP 15)
g.15198C> A (SNP 16) SCD-P5-R CCACTTCTGCAGGCTCTCA (SEQ ID NO .: 11)

^* : Number means position from start of transcription

Genotype and Allele Frequency of SNP1, SNP12, and SNP13 SNP Allele frequency Genotype frequency SNP1 g.817C> T C
0.76 T
0.24 CC
0.55 CT
0.42 TT
0.03 SNP12 g.14384G> A G
0.82 A
0.18 GG
0.66 GA
0.32 AA
0.02 SNP13
g.14424C> T C
0.62 T
0.38 CC
0.40 CT
0.45 TT
0.15

A single SNP model was used to analyze the association between the SNP and genotype and fatty acid composition of the SCD gene. Each FA trait was randomized and fixed covariate effects to correct kinship in the cross population using a mixed-effect model run in the AsReml program (VSN International, UK). , Eg, sex, parity, carcass weight. The residual calculated from the mixed-effect model was used as a dependent variable and the SNP label was used as an independent variable, and the following one-way ANOVA was performed to carry out variation of each SNP label and FA composition trait of the SCD gene. The relationship between the two was investigated.

Y _ij = μ + g _i + ε _ij

Where Y _ij is the residual data derived from the mixed-effect model, μ is the overall mean, g _i is the effect of the SNP genotype (three series) of the SCD gene, and ε _ij is the random error. To assess the pair-wise difference between the effects of the genotypes, Tukey simultaneous multiplex analysis was performed. A p value less than 0.01 was considered statistically significant.

As a result, in the SCD gene, the present inventors found that SNP1 and SNP12 have seven fatty acid traits (palmitic acid (C16: 0), stearic acid (C18: 0), oleic acid (C18: 1), and arachidic acid (C20: 0). ), Saturated fatty acids (SFA), unsaturated fatty acids (UFA) and monounsaturated fatty acids (MUFA)). On the other hand, in the case of SNP13, only arachidic acid (C20: 0, p = 3.0 × 10 ⁻³ ) had a significant relationship. The effect of the two SNPs (SNP1 and SNP12) and the residual mean between FA traits are explained along with the p value and phenotypic variation explained by SNPs (FIGS. 1 and 2).

Meanwhile, the present inventors used Gabriel et al . ( Science , 296: 265, 2005) to analyze the correlation between the haplotype and fatty acid composition, using the Haploview program version 4.1 (Barrett et al ., Bioinformatics , The LD between the SNP markers was measured by calculating a pairwise measure of linkage disequilibrium (LD) as described in US Pat.

As a result, as shown in Figure 3, the two SNPs (SNP1 and SNP12) was found to have a strong associative imbalance (D '= 0.952) and the frequency of haplotype 1 (CA) was 70% or more. Thus, recombination between SNP1 and SNP12 seems to occur little. Figures 1 and 2 show very similar genetic patterns, showing a nearly complete linkage disequilibrium between the two SNPs. Compared to previous studies using the Duroc obedient population, the SNPs of the promoter of the SCD gene were found to be palmitic acid (C16: 0), palmitoleic acid (C16: 1), stearic acid (C18: 0) and oleic acid in muscle fat. Highly associated with (C18: 1), but not with SFA, UFA, MUFA and arachidic acid (C20: 0) (Uemoto et al ., Anim. Genet ., 43 (2): 225-228, 2012). In contrast, this study showed the highest association with stearic acid (C18: 0) in SNP1 ( p = 3.4x10 ^-17 ), followed by palmitoleic acid (C16: 1). ( p = 1.1x10 ^-10 ).

Specifically, when looking at Figure 1, the stearic acid genotype is low in the case of CC, while the content is high in the case of CT or TT, it can be seen that there is no significant difference between them (top middle), arachid In case of acid, the genotype was CC, but the content was low in CT or TT, but the content was higher in TT than in genotype CT. Thus, in the case of SNP1, the genotype may be determined to be inappropriate for the fatty acid composition of porcine individuals in the case of CT or TT.

Referring to FIG. 2 related to SNP12, the content of stearic acid was low when the genotype was AA, and similarly high in the case of GA or GG, and conversely, palmitoleic acid (C16: 1) or oleic acid (C18). Unsaturated fatty acids such as: 1) were high in genotype AA and low in genotype GA or GG. The genotypes GA and GG were found to have a general difference in the content of the corresponding fatty acids.

Therefore, SNPs according to one embodiment of the present invention can be used more effectively and accurately in predicting the health of pigs, since they can be used more accurately and effectively compared to the SNPs of the prior art for the prediction of fatty acid composition of hybrid pigs.

Although the present invention has been described with reference to the above embodiments, it is to be understood that various changes and modifications may be suggested to those skilled in the art without departing from the scope of the present invention. Therefore, the true technical protection scope of the present invention will be defined by the technical spirit of the appended claims.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY          The Industry & Academic Cooperation in Chungnam National University (IAC) <120> SNP marker for the prediction of fatty acid composition of          intercross population <130> PD12-0348 <160> 11 <170> Kopatentin 2.0 <210> 1 <211> 18231 <212> DNA <213> Porcula salvania <220> <221> variation <222> (817) <223> SNP1 (C> T) <220> <221> variation <222> (12544) <223> SNP2 (A> G, rs80954581) <220> <221> variation <222> (12682) <223> SNP3 (A> G) <220> <221> variation <222> (12739) <223> SNP4 (T> C) <220> <221> variation <222> (12818) <223> SNP5 (G> A) <220> <221> variation <222> (12918) <223> SNP6 (T> C) <220> <221> variation <222> (13055) <223> SNP7 (A> G) <220> <221> variation <222> (13311) <223> SNP8 (C> G) <220> <221> variation <222> (13417) <223> SNP9 (G> A) <220> <221> variation <222> (13956) <223> SNP10 (A> G) <220> <221> variation <222> (14378) <223> SNP11 (G> A) <220> <221> variation <222> (14384) <223> SNP12 (G> A, rs8091750) <220> <221> variation <222> (14424) <223> SNP13 (C> T) <220> <221> variation <222> (14884) <223> SNP14 (A> G) <220> <221> variation <222> (15066) <223> SNP15 (C> G) <220> <221> variation <222> (15198) <223> SNP16 (C> A) <400> 1 gggggggcgt gggcacaagg acgggatcgc tcactggcgc ctggaggcga acgtcccctg 60 ctgggcttgc ctagtagctg aacgccgtgc gcgcgtgcag gtccacacat ctatctatgc 120 atctacgtgt gtgtacaccg ctgccggcct ggagaccggc gagttcagca gtacgcatct 180 atcgccccgc cgccagtggg cggcgcagag ccattgttcc gccgccggcc gaccctcagc 240 ccctgcggca cgcgcgttcg tcacggaggg aggtggggct tcgccgggcc cccggccccc 300 aacccggggt ttgaaggcac gtctccccct cccacgcgtc tccgcgagct agaaggcggg 360 agtggagttg tgcgtagcgg tcgcccgcgc ggcttcaccc acactttccc cggaaacttc 420 cctagtgccc atcctttcgc gaagtgcccc agggccagtc ctgggctagc acccacctcc 480 caccccccta ctgagtcctc ttcctcttcc agggaagacg ctctcgagcg cctccgagga 540 ggcaggacgc cgggcagaag cccagcggcc ggtggaagag aagctgagga ggagaaaggg 600 aggggagggg gagtgaggag ctcgcggcag agggaacagc agattgcgcc gagccaatgg 660 caacggcagg acgaggtggc accaaattcc cttcggccaa tgacgcgcca gagtctacag 720 aagcccatta gcatttcccc aggggcaggg gcagaggcag gggctgcgga gaccgagccg 780 cggagtgtct gcagcatcca gtttttgcgt ctccggcccc cagtaagccc cggctctctg 840 tctcctcccc tctcccgccc atgcggttct cccacggtga gccaactctg cgcactttgc 900 cccttcttgg cagcgaataa aaggggtcag aggaaataca ggacacggtc gcccactgcc 960 agctctagcc tttaaatacc cagcctgggg agacccgcgc acagcaggtc gggtgcagac 1020 accgacccaa cgtgcagcaa agggttccga gcgcagcatc gctgatctcc gcgcaagagc 1080 cggctccagc actagtctac gctcagtgcg gtctgccacg aactcctccc tgaagtctca 1140 tccctgggaa agtgatccca acgtccgaga gcccagatgc cggcccactt gctgcaagag 1200 gaggtgagtt tccaagtaat ggcccccaga ccgcgggctc gccggtgctg gttgggcttc 1260 taggtgactc ggtgtagaag agagttgaga tcgccgagga cagccacctt tttcgagttg 1320 tatagtcttc agtttgttgg gaatgtggat tgtaatttgg gaacttagtt ctccaacttt 1380 tgtttcctaa agcttcaaag aaaaatctgg tggtacctgt accctgatgt gtgtaggcat 1440 gcgggctttc ctttgtgtgt ttgaaggggt gcgagtgttt tacccctcta tttccccttc 1500 ccctgaggtt tcaccctcct ccccaatttc tccgcacagt tcctggggac ttgcgtctct 1560 tccatctagg atagaccttg ccctcaggta acctgggtat tggggccagg tctgtgccta 1620 taccccgccc ttcccccagc tagaccaggg agtgaagtgg cccctagtgt ctccacgtgt 1680 cctcccctct ctcccagctc tgcacttcca ctctctttca gatctctagc tcctacacaa 1740 ccaccactac catcacagca ccttcctcca gggtcctgca gaatggaggg ggcaagttgg 1800 agaagactcc ccaatacgtg gaagaagaca tccgccctga aatgaaagat gacatctatg 1860 acccaaccta ccaggataag gagggcccaa ggcccaagct tgaatatgtt tggagaaaca 1920 tcatcctcat gagtctgcta cacttgggag ccctgtatgg gatcatattg atccccacct 1980 gcaagatata caccttgctc tggggtaaga ggtccccttg tcctcctgtc tcagtatccc 2040 aggttctctc cactctttta atacagtagc aacttacaca gagtagaaac accagcccct 2100 ccaggccgag gtttttccaa ccatttctct taggtgttgt ggtgggctgg gaagggagtc 2160 tagggggttt gggatgcagg agtgtcgatt ctggggcctt taatttgggg gggggggttg 2220 gagagggagc cctgggacca tgggccacag gctttgaagt gagtagatct gtgccaggga 2280 gtcagctttt ctgtttcaag tcattttctt gactgcttgt cccagccctg ccagcctaga 2340 aagaatcaag gcccttacct ggatgcatgg gaacatgggg ctagactagt gtgactttag 2400 agggcacatg ctgggtatag tcacggggta gcaagagaaa ctactcagga agagggttaa 2460 gcagaagagg ggggaagaga gctgtggtca tccatgaaat tattttgccc tgatccttag 2520 ccttatcagg ctccttaatt acacagacag aggaaggcgg ctcctgcata actcatgtta 2580 catggatgtc ttgctctgtg actccacgtg ggtctccagg gaactgcaca tgccactcaa 2640 gaaaatgttc taatgaaata aggttaaaga aacgtttcct gccccattcc ccacccatcc 2700 tgctccagcc cctctcccct gatgccagga gtgcctcctt gctggggaca gccaagccag 2760 aaaagagact ctggagcagc cccggccctc aggctgctgc agtgagggag acagtccccc 2820 gtgcgtccct gacctgccct tagctcagct ctttcaggaa tccatggctt gggctgatag 2880 tggagccctg ccccctcaca cacatgcgct ctgcaggcat tgccactcct gcctcgagtc 2940 tgacttggga agaggagagc agggaactct aaagatccag gagctccatg ctgctaccct 3000 ctgtgatggg tgtggggttc agaactccct gttaagaaag ccacggtatg gtttctggag 3060 cagtgtcgga tgttgggtcc ttgctggcag ctatgctctt ggagggtggt tctacagaag 3120 gactggtggg ccaagtttca gcaaagtcct ccaggacctc tttgatctaa agagggtgga 3180 tctggtctgc ggagccttgt cttggcagat cctcttggtg ccacagacag agaaatgcat 3240 ctgggtagat tccctctctc aattttccca gacacaaact ggggacaaca ggactttttt 3300 taagcttaga aaggtagtgc tcctcttttg gcctccctga agcatgtgga gttgccggac 3360 cggggatcag acctaagcct cagctgcagg aatgccggat ccttaaccca ccctaccagg 3420 ccgggattcc acctgagtcc cagcattccc aaggtgccgc tgatcccgtt gtgctacagc 3480 ggacattcca agaaaggtgc tcctggagtt cctcgagtgt cattgctggg gccagccagg 3540 tgcagaggaa atcaattcat cctcagacca ggaagggctc ttataattgt aaggggaggg 3600 ggacttctgc tccccagccc ctctgagaac ccagcagagc ttgagttgca gtgtgaggaa 3660 tcaagagcca gggacatgga tgccccaggg aatctgtggg ctcccctcct gaccccttct 3720 cccccataga ggagtcttca caagtttagt cacttccaag tccccctcca gcctcaggac 3780 tccctgtcgg cctcgttaag ttccgagttt ggccaggcag ctgctgctgg ctcttctccc 3840 ttggctgcta ctgcagggga caggatgctg tccccaacca aggctgtgcc tgccgccttt 3900 ttggtgccct gcctgtagat gtgtgctctg cccttggaca gaaacctgtc acacagactg 3960 gatggtgact tttttacttg tccctggatc ctgtggtggt ggatggctta gctgatggaa 4020 tgaccatttt ggtatggcca tatccgagct cctctggtgg agttgggggg agggtcagag 4080 ttcccgaacc ttaagagttc aggaacttgg cttcatcttt tcttgtcttg tccctaagga 4140 cagtgctaaa ttagcaaatg gttgtgattc cagcatttgt caggactgag caattttgag 4200 tgtctcagaa gagccctgag ggctgaagcg atacctggca gcacctgggg gctctgaggc 4260 gaaacgtctc caggctcttc cttagggcta aaactatgaa gttttgctta accataaatc 4320 tagactttag tagagaatga atatccaact gacaggctta ggggtgctgg tagaaaaagg 4380 caccagagac ttgggtgttt ccccaggttc tctgttagga tcatatgtgc ttccattttt 4440 gtgctttgct tttttagggc cacacttgcg gcatatgtaa gttcccaggc taggggtcaa 4500 atgggagctg cagttgctgg cctacaccac agccacagca actcccacgt acaccacagt 4560 tcatggcaat gctagatctt taacccactg agtgaggcca ggcatcacac ccatgtcctc 4620 atggatacta gtcaggttcg taattcactg agccacagtc agaactgcct gcgtgtgctt 4680 tctgagtcag cttgccaggg tcttcggttg catgtaacca ccccagtagc ttcctgggtt 4740 ctgagctacc tctttcgtgc tcaaagactt ttcttggcct ttggtgattg gcgggctgcg 4800 gctcaactgt tatttatcca ggtgcagatg caggcagatg ctgcctctgg gaggatatta 4860 ccacaaggcg ggggaggcca gaaaatcacc tggaccccta atgcagcccc gaggaccgtg 4920 ggtggcactt ccctgagaca gactctggct ccctggctct cctccctgtc ctgtaggagg 4980 aataggctag ggtagaggaa ggtgggtggg acagggggct tgtttaggaa actggtgtct 5040 gtggctgaga acacaagaca atgtgttaca atgtgtggtg tctccaactg caactaagtt 5100 cagtggccac tgaggatcca ttgtttctag ctgcttccct aggaatgaaa cattgtcaac 5160 agtcactgct ctcccaaggc ctcagcctct gcctcctaga gctgctgaac agaggaaggt 5220 gggtgtgccc agcaacccgc ctcccagtta gagactccaa cctgcacccc tagaacctgc 5280 aggcccccag gaagatgagg tagacagcgc tggggtgccc cccaccacag ctttgagcct 5340 gccctaccgt tgcctagaat taaccctgac aggggtatga gctgactgag gaaggtggca 5400 aaggagagat gcaggagcgc tgcgagtatc ttgggcgggg gggacatggt aaacatcctc 5460 gagccagggc tcaggagcac caagtacttg ttgacagaac acctcatttc aaaccatggc 5520 tccatttttt tttttttttt tccttttgct ttttagggcc acaccttcgg catatggagg 5580 ttcccaggct aggggtctaa tcagagctgt agccacccac ctacaccaca gccataggaa 5640 ctcaggatcc gagccgcatc tgcgacctat tccatagctc actgcaacgc cagatcctta 5700 actcactgag tgatcccagg gatcgaacat gcaacctcat ggttactagt tggattagtt 5760 tttgctgcgc cacaacagga actcctatgg ctccctttct tactagccat gtggccttag 5820 ataaacactt aatctttctg agtgtctatt tctttggctt aaaccccatg taaggtatcc 5880 agtgaatcaa agaatacaga aatctggagt tccccttatg tctcagccgt aacgaacctg 5940 actagtatcc ataaggactc gggttgatcc ctggacccgc tcagtgggtt aaatatccag 6000 cattcctgta agctgtggtg tgggttgcag acacagctgg ggtctggcgt ggctgtggcg 6060 tacgttggcg gctgtggctc caattccacc cctagcctgg gagcttccat atgctgggga 6120 tgtggctcta gaaacaaaca caaacaaaca aacaaaaatc cttggcaaag cttaagactg 6180 tgcagatatg acttaggtgc aaggcgagtt ttccccattc tgtgaccacg cagtctgcca 6240 aaagactgaa atggttttgt accagatggt aaatagctct agttctgagc cccccccccg 6300 ccccccgccg ccccccatgt cccctagaac ccagagtccc tcaaactggt cagtgcccag 6360 gccatcctgt cttaacatat tttaatactg cccttgttta tgggtcttca gctctgcaag 6420 agtactctgt ggtccttaaa actgtggaga agcttagtga aggtcagagg agatgggacc 6480 tgggataatg tccttcatga cagagaatga caagtggctg gagggtgaga gccctcttct 6540 ctgtcccgcc ttcctgaact ttctgggacc tgtaagctta ttccagctgt gaggctaaga 6600 ggataggagg cgatggtaat ttttttccaa gtggtaaaat tgaaggggcc taagagatct 6660 aggtgtccgt ggagttcagg gaaaagcaga tcctcacctg cagcctgaag gacacccaga 6720 cgctgacctg aggagaacat cacgtgtaag acttgccccg attactgact ccctgtcctg 6780 tcttccggca gcgtttgcct actatctgct gagtgctgtg ggtgtcacgg caggagctca 6840 ccgcctgtgg agtcaccgaa cttacaaagc tcgactgccc ctgcgggtct tcctgatcat 6900 tgccaacacg atggcattcc aggtaagaag ccagctgtgc tcagctcttt atcaaacgca 6960 ggcgatgggt gcctggaagg gagcagcacc tggacagcta cttcactttc ctctctgctt 7020 ccagtcacct caagttcagg ttcagtcctt gggtccataa cacctgcagt actttggagt 7080 gactggaaaa gggaaatagg ggataaagag gaaatagcct ctgtgtatag gatcgttttc 7140 gagcctccgt tgtcacacag tctggtcgtt gtggtccctt cattagtgca cgaggcagga 7200 actgaccctg atttcctagg cagccgttgg acaatacatt cactatttta ggtgaacatc 7260 tcaggactcc accaaaaggg attaaagtta atgtttcaca gattcatgaa ccctattgtt 7320 ttcaggtgag aagatcaaac acttttatag tgttaactat acctcctggc cctattctga 7380 gcacttgaca aggattacac cattaagccc tcccaacagt cttaggaggt tggtactgtt 7440 gtgatcccca tttcacggag ggggaagctg tgtcactgag ggtgtaggta gaccatcatt 7500 atggtcctgt gttgagctgc caagctgtct aagtcaaata ttgaggtctg ctgaagccgg 7560 aagctcatag cagggaattg gagaaaggga actccgagtt attgaacagc agcactgggc 7620 aaaggctagc atgttgtgtg gggcttagct tggatcaagg ggcaaaaaga aggaaaccaa 7680 atcggttcct ttcttcgtgg cagtgtctca cacagctgca taactgtctt ctgccatagc 7740 acttaacgcc ttgaaggccc ctgatgtggt ccctgttggg gcaaaagaag gaagagatat 7800 tggcaccctc tctaagcgat agaaagtgtc ccagaggagc ccagagacca tttggaaatg 7860 cggtcaaatc atgattatgt gtctggcctt gttgagttgt gggagctgaa tcttgccaag 7920 ggattaggca gcctgtgaag accctttgct ccagttcttg ctggaagaat tgcaattttg 7980 cctcctagtg aaactcttca agctctatac aatccatctc cattctgccc accatataac 8040 ccgcaagaag cagccagccc tattcatgtg gtcctgagac ttgaaggtgc ttttccactt 8100 aagcatcagt ggccagttag agaggaggca actccctgac tcctcctttg gagccttgac 8160 tcccaggtat ttcgcgagct tgggctgagc gcctcgggct cttgaagaca cctagccatt 8220 ggcattcccc tgagagggtg tctctcctca ggcctccatt cctcttctct gtccctccag 8280 aatgacgttt atgaatgggc ccgagatcac cgtgcccacc acaagttttc agaaacagat 8340 gctgatcccc acaattcccg acgtggcttt ttcttctctc acgtgggttg gctgcttgtg 8400 cgcaaacacc cagccgtcaa agagaagggt ggtttgctta acatgtctga cctaaaagcc 8460 gagaagctgg tgatgttcca gaggaggtga gtgctgtggt ggtggagctg ggcgcctggt 8520 gtttggggac accctctccc ctccctgttt tttcttctag gacttgtcca cataagctgg 8580 gaaactgaca gggtctgctt accccaaatc ataattcaaa acccttcttt tatgggccac 8640 agccatagac tgttgttgat tctttctctc tgagctaaaa aaaaaaacca gttaaggtca 8700 acaatgtgtg ttgacctgtt acagtcatgg atacaaagct acatgttgtc atagtcctta 8760 ccttcaagaa gttcatagcc tgttggggat gggagcacta agccaggtgt ccaaatacct 8820 atgacatggc aaaatatttt tctgtcccca ggaaaggcac agaggggagg gagactgtgg 8880 agtggggaac attagagaag ggttttatga gaaggtagct taggaatcca ctggtagctt 8940 aggaatccac ttaggaatct ttgtaagatt ttcacaagtg ttggcggagc gggaggcagt 9000 gcaaacagaa agaatgagct aaagcatgaa gcatgttcca gcaatagagt ccctctgctt 9060 aaagtacagg gtgtggtagg aaataaagac tagagagacc gagacctttc ttgtggggcc 9120 ttaagagcag acagggttta attcaactcc agcaatagga aaccatggaa gggtttttga 9180 gccggaatgt ggtcagaggt gtgctctgga gaggtcaccc tgcagatagg tgaaagaaac 9240 cgttgggctg aagaggtgag ctgcagggcc ccaggtgagg aggtagtggg catccatgct 9300 ggggaagtgg tggcacggag aggaggcgaa atgtggggac acacgtgatc caagagtagc 9360 agacttgact gctgaagagg tgcaggaaat cagctccctc ggaatgtcag tagcctgttt 9420 tactttggga gaatgaagaa tgggccaggg cctccagagg gacagcctgc aggcatccgg 9480 gacactcggt gtgcccctga ggggaaaaga agagaaagga tcagaaggct tgctggctag 9540 caagagagga aggcaagata ccaaacacag attctgcaaa gagcactgac accaagagag 9600 gagcaggcag aatggaaaga cctgggcagg agaactcagt tcagtaatct gtaatttggg 9660 ccgcccctgt tgtggtacga ttaggctgtg gtcaaagaga gcaatggatg gagagtcggg 9720 agacaaggca ttccagccct tgctccactg gttcctggtg gtatgaccct agaaaagtca 9780 tttagcccct ccttacctta cctcatcaaa aaagtatgat aataacactg ccttctcaaa 9840 agactaccca ccccatccct cttgctctgt ttcctgccac cttgtgctca cagcgtagag 9900 ggtaggggac agctcagccc catgaaagga caaagtcaga gtcccctcca tgaatggggt 9960 gtgtgatctc tccctgtagg tactacaaac ccggtatcct gttgatgtgc ttcatcctgc 10020 ccacgatcgt gccctggtat tgctggggtg aagcttttcc ccaaagcctg ttcgtcgcca 10080 cctttcttcg ttacgccatc gtgctcaatg ccacctggct ggtaaacagt gctgcccacc 10140 tatacggata tcgcccttat gacaagacta ttagcccccg ggagaatatc ctggtttcat 10200 tgggagctgt gggtaagtta gcagtccata gcaagacccc atctagtggg ctgctggtta 10260 agagtattag actaggagcc agaaaaacca gattaacctg ctttatgacc cctctctgtt 10320 tctctgctat aaaactaagg tgcaatagta gatacccctt gagagttggg cagcaagtct 10380 tatataaaga gaattgggct aaaaaataac aatgtctctg agtccaggtt ccaaaaaaga 10440 tccccaggtg ctctggatga ggaaccgctt tggcttgtcc tttttccagt catctctggg 10500 ctggcacatg gtctggctag gggcagggac tgcatgaata gaacagtagg gtcttctggg 10560 tggccagtaa gcctagtgtt ttatatttag acatgctata caaaatgcag aacaaatcct 10620 taacatttca acaagcttct cttttatcac cttgctatat tcagagaggc tgaactcaaa 10680 gtgtatttca tgccttattg tttggtgatg ccaacatgaa ggacctcaaa gcaactgttg 10740 gtggcccttt tatcaccacc gaccgctctc atctcttgtc ctttattctt ctcttgtcct 10800 ttattcttct ctaacccgtg ctgggaacac ccgctcccct taacatggct tggagaactc 10860 ctgataaagc agttaatttg atcacaagtc tctgctcact gatctaatgc tgactattca 10920 agaatatctt tctaaaaaaa aaaaaaagtt gtatctttct ctcattccag tttcaatagc 10980 cagaatctaa gacaacagtg ttctaccatc tgtctccctt ttattttttc ctctgccact 11040 cttttcaact aaacatagat cttgactaac gcctggaagc agttttcctt aagcagcgcc 11100 tgtgacctct tccacgctag tgatcagtgc cactggttgt ctggcatatc taggcaacct 11160 ccctgctccc cacatgtgtg tacactgcgg cctagctttt gctttgttct ctttaaaacc 11220 tttctttatg tgctcaaccc tgagcatctt ttttttttac aatctgtact aaagacattt 11280 catttgtatc tttttttttt tttttttttt tttagtgccg cacctgtgcc atatggaagt 11340 tcccaggcta ggggtccaat ccgagctaca gctgctggcc tccaccacag ccacggcaat 11400 gccagatcca agcaacctac accacagctc atggcaatgc tggatcctta acccactgag 11460 caaggccagg gattgaaccc acaacctcat ggttcctagt tggatttgtt tttgctgagc 11520 cacaagggga actcctgtat ctctttttaa ctttcatgta tcttccccct cctttcaggg 11580 accctctacc attgtgcatg tatctactct gaaccatgtt tgaaatctaa caggctattt 11640 tcatagaaga tttatgaatg ttgtggaagt ttctggaatg agactggtcc tggatttaga 11700 atgagctccc ccaaccccag tctctttcta accatccgtt caaagtagct gccaacatct 11760 tcctttgtct caattatcat tcatccctcc atcctggctg ctctccccct tattacctca 11820 ccctttgttc tcccatagct ggcttccctg tcattctaat ctttttcttc ttgaattacc 11880 tcccccacag tcacatgctc atctctccgc taaagctgac ctcctgcctt gagcctctcc 11940 tggactgtgt cttgctgccc cagttgcaga gtcttgtcct tctcctcttt ttttctccct 12000 tggcaactag tgtgtgtctg attaaagttt taaatctgat aagtatatct gataagcctg 12060 gctagtgctt atcaagatcc tagctgcaga attttatgga aattcgtact tttagccttg 12120 gggttatcct accctcctac tcagttcaca ctagataagc tgattatcca cttggtagag 12180 agtcagacag aggacctacc tcgaatgatg ccctggatgg tgtcatttcc tttgcagaat 12240 ttccttcctt gcttgttatt aatgtcatta ctactctact aaggctcttt catcttcaaa 12300 gggctcaaca tgctctttta ttagctattc ttgcccagct ctgcctgggc gtcataaggg 12360 gtcagcattg tcatagttga atgctgttcg gaaaaaagat cccgccaagg gttggagacc 12420 tctggctctg gagtttgcac agctcaactc atgacagaca ttattctgaa tccagagttt 12480 ctctgatttt cttctatgga gcaaagtgaa ctcctcttct cagaagcata gaggtttttt 12540 attctaattc taagcctttt gattctgttt ccctcagaga gcttctgtct tatcagcttg 12600 acccccacac caggattcaa gctcaaagaa ttagaagcca gagcagtccc ctctgaacca 12660 gtggaaactg aggaaatgtg ggcccctggt ctgggcctct ttctgacttt tgactgttgg 12720 tgcctgattc cgtggtacct tctgccctta gagatggtat ggtacagtgg ggaaaggtat 12780 acccccttgc tcaccttttt cagaaacacg gcagcagttc tttgttctag actcttctct 12840 cctcacccta acacatgctc actcatacag agctttaagg tctcagacca ataactagtg 12900 aagctctgga atttcccaat ctaaaattta tcccctgtga tagcagtttc tctccggtca 12960 tcttatcccc tcagaggaac tgtcagtcct cttcccacag aggctcccag agagccatgg 13020 cgaccagggt gtccccagtt gtttctcaag gtgcctctga ggggatctat ttcgttgaaa 13080 agactggatt cattcattca accacagcaa gttatctgct aggtttgagc tgtgccaccc 13140 ccagtgtagc ttcatgactt ttctctgctt tttgttccag gtgagggctt ccacaactac 13200 caccacacct ttccctatga ctattctgcc agcgagtacc gctggcacat caacttaacc 13260 acgttcttca tcgactgcat ggctgccctg ggtctggctt atgaccggaa gaaagtatcc 13320 aaggctgcca tcttggccag gattaaaaga actggagatg agagctacaa gagtggctga 13380 gtttggggtc ccttgggttc cttttctgaa agccagctgg gcagaggttt aatgttctgt 13440 ttattaacta ctgaataatg ctaccaggat gctaaagatg atgatgttaa cccgttccag 13500 tacagtattc ttttaaaatt tcttttaaga ttgaaagcct acaattctgc ctttatgatg 13560 ctaagctcat attcttgttt cttctctctc ttctagtccc attgtccttc tcttggcttt 13620 gttcctgtca ccttcctctc tcttccccct cactgtgccc caggcaagga gctggtcagt 13680 cattggtggg tttccagctt ccaaagccta gacctttcag tagtccaaaa ctggtgagtg 13740 gtctttgccc cagatagctc tttctttgag ttgtcctgag ctttaaggtg ggtggctcaa 13800 gggagagagg tgataaagtc ttctgggaaa gccccgttca ttattttcag cccagacttt 13860 tgctcgatga catggaaaaa taactctatt ttggcacaaa gcttcgaaag caggtaattt 13920 gtcaggggag ggagttagca tgctgtgtgt ggtggggttg ataaagaagg gggaggtgag 13980 gtgggaaacc aggcaggagg ctcctgctgt gatgggacac tcggctgact gcccagtgag 14040 ggctttgcgc cctgacacac agcatgcttc ctttctctcc tgactctggg gaatggccgt 14100 ggaacttggc aatgctagaa ctcaaaagca catcccagtg tcccaatgta cgttaggctg 14160 aggataaaga agcagcattt agtttgtggc agcagtggtc tctgctgggg aagaagtctt 14220 tcttgtctct ttaataacag gaagatttct tattccatag agtgagaaat cttgaggttc 14280 tttccggaat tgctgaatcg gcaactcatg caattgtcct cactcttttc atcttcccgc 14340 tctgccatct ttgggataca gctcccctca tagtaacaat aaggtggctg ccgcattttg 14400 agacatcgga actgaggtgt gttggtggta ccgtggtgag cttaactatc ttcccaaaaa 14460 gaaaggattt tagcaggtgg aggtgggtcc cacataaaga tagttaaacc tcggtacttt 14520 gcttggaata ccaacataat tctcttggac tatttccctc tgaaagagaa ggaggcttga 14580 gaagaggaag aatgggggtg gatggtctcc tttcctctct ctgctgaaca ggagatggag 14640 gggttgaggg gcagggtcta gaggcagctc ctgagacata acattgcaaa cgaagggctc 14700 tgggggattc agaaggttac tgagtaagtt actggacgtc ctcctatggg aagctggtca 14760 cacaggcaag ttagatattg gggttcattt cattcattcc agttgctgct tggaataagg 14820 aactagaagg ctgctcccca cagtgtgaaa gcctttcact cctgccttct agcctcaagc 14880 gtactaccct gactatggat tcctgctctg ccctgtctat ccgttttttc ctgccggttc 14940 tatctcctcc ctgagatttt tcctttctct ctggagggca ggcctccttt gggagtatgc 15000 aaaggcagtg atggctgctg ctctacaggc agcttcctct cccacagtca gaatgctcag 15060 ggtcactgaa ccactgtttc tcttcacaaa ggtgagctag ctgccacctc cacgtggcct 15120 ccagagtctc cacctgcacc cttgtgctcc cctgccactc caatgattca agacaaggcg 15180 ggcaaaccct cctagaaaca tcccgggcac gggcatcctt tctcataagg cacagccaag 15240 ccaaatgctc acgttgtgcc agtgagtcag ccacagagca aaagagggtt tgtggttagt 15300 ctcctctatc tgggtcagaa ccagagagca ggctggatgc cccctgcttg ctcggtaagc 15360 ctgcccagcc tgagtcagtg ctcgcggctg acagtgcaat gcttgcagaa acaggaggga 15420 gcccggtctt cactgggaag cacaagaggc caagacaagt tccaaagtgc ctcactcgaa 15480 agggaaccct gtcccctgga gctagggtgt accacaaagc tttggctgag tcttgggctg 15540 aacagcgtct ctgttcagca aactaaccag cattccctac agcacagccc aaggcagaca 15600 agagaataga agagggctgg aaaacaaaaa ataagaacct tggcccactc ctgtccctgt 15660 aacctcagtc gtcaacacag aagcctggct ttactctaaa gattggaaat atacaatacc 15720 agatgctctg tccactgttg agccccagga gtggaagggc agagagcatt tcttcctgta 15780 ttaactgagt aaatggagga taaaggggtt gggctggact agaggcatct ttgtcttttg 15840 agccattctt ctcagtagaa aaaaaagctg atggaagatc actatagttc acattcccag 15900 acccaagcac ctactctttg gaaatgactg ttgggttagt tttaattcca caggtcgtca 15960 gatgcctgct ttatagctga tgatcaaaac caacttttat ctttctattc taattgtttt 16020 caatggatct gatccatacc ataaccctac acaaggctgg atgggcttct taggccaagg 16080 gccccagtgt atgtgtggat gtgtagggtg ggagggcggg gagtaaggaa tacttttttc 16140 aaggttctaa agctgaattc aaatgacgca ttaatgaccc agaaactcag atctgatcga 16200 atctgaattt ctaacaggcc ttgctttgta ggtgtactga caacttatct gggggcctta 16260 catctttttt aatcggtgtt acgtccgagc ctgctctgct ccctcactcc ctctgcactc 16320 cctctgtggc gttcccttgc ccctgagagc ctgcagaagt ggctggtaga agtggggggc 16380 tggctggaga attatcagta tgcaggattc ctttctgggc tttgttttgg aaactttcct 16440 tagggctgtt tttattaagt gcccacattt gacggaaggt ggaaggaatt tgaatgtatt 16500 tgatttataa tgttattatt attatttttt tagattaaaa gatggttgta gcatttaaaa 16560 cggaaacctt ttctcctggt tagctagtat cctgagtgta ttctctgtaa gtgtagctca 16620 aatgggtcag cgtgaagaaa agttaaagaa agcacgatgt caaggttaca cgggtggtta 16680 aggccagggc ctctcctacc actgtgccac tgacttgcta tgtgaccctg ggcaagtcat 16740 ttaactataa tgtgcctcag ttttccttct gttaaaatgg gataataata ctgacctacc 16800 tcaaagggca gttttgaggc gtgactaatg ctttttataa agcattttgg gatccttcag 16860 cagaggaatt ctcttaagtc ctgagtattt ttataataac agtatccacc atgaactgtg 16920 tccaccatga accctgtgtc ctggatgctg tcattaatct ttatggttct ctctgagaaa 16980 ttgaataaac ccaatagata agtggtggat aactagtcag acagaatctg agaatgcata 17040 aactcattgc catggaaaca tacacaggat accttttcct tgattgggtg ggattttttc 17100 ccctttttat gtgggatagt agttatttgt ggcctaagaa taattttgga ataatttcta 17160 ttaatatcaa ctctgaagct agttgtactg atctgagatt gtgtttgttc ataataaaag 17220 ggaagtgaat ctgattgcct tgtgtctgag aggttttttg cctgtgagtc agtctcttgg 17280 gacttaatct gccaccctat gtcctgttcc tataccttta agagagtaaa aaaagtagaa 17340 gctacaatgg ttgattcaca ctctagtaac ccgccctgcc ctccctgccc ttcttagggg 17400 taactttagg ttaaactcag ccttggcagc aggaagccag gagtctgctg ccattagatc 17460 agacatgtta accccagctg gctctttggc cctggggaaa tgccaggtct ctttcggtaa 17520 catgggccaa aaatgatact gagagaggaa aggagcagca ggtgacactt ccctggaaag 17580 gggttctgta cctggcaacc caggctgggc catcctgctt cattcctctg aaatgtagcc 17640 ccttctggga ataaagtggc ttcctgaaaa tgctgattaa caacagcagg aagaaaggaa 17700 aagcaatcct agagaagcct tgtaaattcc tggaatagag agggcttcat gatcatcaac 17760 tagaaaggct ttggctttta ctgctttagc taagaatctt tttttttttt ttgtcttttt 17820 gctatttctt tgggccgctc ccgcggcata tggaggttcc caggctaggg gtccacagca 17880 acgcgggatc cgagccgcgt ctgcaaccta caccacagct cacagcaacg ccagatcctt 17940 aacccactga gcaggggcag ggacccaacc cgcaacctca tgattcctag tcggattcgt 18000 tgaccactgc gccacgacgg gaactccgct gagaatcttg atgtgcaaac gagaagggct 18060 ttttttgaag aggcttcatt ttccaacagg agccacctaa gcttctgagc attccccaga 18120 ccccccctta cactttctag tgtaacgtcg cactcacctt ggacaagcac gactctctca 18180 gtgattcatc ccaaatcaag tctatattca gtgaggcctt gccaggcctt a 18231 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P1-F <400> 2 tgaagtggcc cctagtgtct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P1-R <400> 3 catacagggc tcccaagtgt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P2-F <400> 4 gtcccttggg ttccttttct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P2-R <400> 5 ggacactggg atgtgctttt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P3-F <400> 6 aaaagcacat cccagtgtcc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P3-R <400> 7 cccccattct tcctcttctc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P4-F <400> 8 gccttctagc ctcaagcgta 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P4-R <400> 9 gtgctgtagg gaatgctggt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCD-P5-F <400> 10 atggaggata aaggggttgg 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SCD-P5-R <400> 11 ccacttctgc aggctctca 19

Claims (9)

A polynucleotide for predicting fatty acid composition of a hybrid pig selected from a polynucleotide having a nucleic acid sequence of SEQ ID NO: 1 and consisting of 10 or more consecutive nucleic acids including the 817th or 14384th SNP related base of Truth No. 1 or Complementary polynucleotides. The method of claim 1,
The hybrid pig is a hybrid between a Landrace species and a Korean native species, polynucleotide. 3. The method of claim 2,
Wherein said hybrid pig is F ₂ . A polynucleotide that specifically hybridizes to the polynucleotide of claim 1 or a complementary polynucleotide thereof. The polynucleotide of claim 4, wherein the polynucleotide that specifically hybridizes with the polynucleotide or its complementary polynucleotide is an allele specific probe or an allele specific primer. A kit for predicting hybrid swine fatty acid composition comprising the polynucleotide of any one of claims 1 to 5. Genomic DNA extraction step of extracting genomic DNA from hybrid pigs;
An amplifying step of amplifying the polynucleotide with a primer pair capable of amplifying the polynucleotide of claim 1 using the extracted genomic DNA as a template;
A polynucleotide cleavage step of cleaving the amplified polynucleotide with an SNP specific restriction enzyme; And
A fatty acid composition predicting method of a hybrid pig comprising a band pattern analysis step of analyzing the band pattern by electrophoresis of the cleaved polynucleotide. The method of claim 7, wherein
The primer pair is a primer pair having a nucleic acid sequence of SEQ ID NO: 2 and 3 or SEQ ID NO: 8 and 9. The method of claim 7, wherein
The SNP specific restriction enzyme is Hpy CH4IV or Aci I, prediction method.

Images