KR101508671B1 - Primer sets for discriminating of red ginseng and uses thereof - Google Patents

Abstract

The present invention relates to a primer set for discriminating red ginseng, and more particularly, to a primer set for discriminating red ginseng capable of scientifically discriminating red ginseng with a large amount of DNA damage by heat treatment.

Description

[0002] Primer sets for discriminating red ginseng and uses thereof [0002]

The present invention relates to a primer set for discriminating red ginseng, and more particularly, to a primer set capable of scientifically discriminating red ginseng with a large amount of DNA damage by heat treatment.

Recently, countries such as Europe are obliged to implement Plant Variety Protection System (PVPS) in accordance with WTO / TRIPS. In Korea, the necessity of breeding of agricultural products both domestically and abroad has emerged due to the entry of the International Union for the Protection of New Varieties of Plants (UPOV), the enactment of the Seed Industry Act, and the opening of imported agricultural products In order to protect the intellectual property rights of farmers' income and breeders, establishing a scientific breeding system is considered to be very important for developing the seed industry in a stable manner.

In recent years, nondestructive techniques such as near-infrared spectroscopy, electronic nose, and X-ray fluorescence have been widely used to identify the origin of agricultural products. Particularly, nondestructive techniques using near- Protein, and solids content of milk and dairy products, and it is possible to utilize existing protein analysis methods such as electrophoresis and HPLC method to discriminate the kind or origin of agricultural products. However, And the cost is high, and the discrimination markers of the agricultural products to be discriminated have not been developed yet, which makes it difficult to apply them in the field.

Meanwhile, Korean ginseng ( Panax ginseng CA Meyer) has been used for thousands of years as a medicinal plant, and ginseng has evolved for a long time to suit its environment. Ginseng has been adapted to the environment to be able to live well in its own environment, and ginseng is divided into ginseng, white ginseng, red ginseng according to the processing method, White ginseng is called "dried white ginseng" after it is peeled off and dried in sunlight or hot air. In addition, red ginseng is called "red ginseng" when steamed white ginseng is unpeeled and dried.

Ginseng has long been known to be the best Korean ginseng from all over the world. However, due to the recent interest in well-being and natural health food, as the market size of ginseng processed products and the demand for raw materials have increased, cheap foreign spices have been smuggled and illegally distributed as domestic ginseng. In addition, Chinese ginseng has entered the domestic market as a flounder, making it difficult to locate domestic cultivated ginseng. In the case of overseas ginseng, it does not have much significance for the determination of ginseng roots because it gathers 3-4 year old ginseng. However, The more frequent the case of disguising the low-grade roots for six years in the distribution market due to the high price of high-grade roots due to the customary belief that the better the effect of the rosemary is, the more disturbed the order of distribution and the lower the reliability of consumers. Discrimination is a big problem.

Experts predict that if the free trade agreement with China, the United States and Canada competes with the ginseng industry in the future, the damage will become even more serious. In addition, Korean consumers are aware of Korean ginseng in overseas markets such as Hong Kong, and thus counterfeit products of domestic ginseng products are circulating. Therefore, it is necessary to develop a scientific discrimination system of ginseng in order to guarantee stable income of domestic ginseng farmers and to correct the distribution order of ginseng.

At present, the criteria for the inspection of the root of the agriculture and forestry bureaucrats are to be inspected at the time of harvest and the lotus root is judged. Detailed criteria are the head, body and epidermal shape, degree of leg development, And it is difficult to apply it to the distribution market where the cultivation history is unclear because it is used as an auxiliary discrimination method in the field where the cultivation history is confirmed, . However, other methods have been reported to evaluate the accuracy of the staining of the ductal tissue, and other methods have been reported. It is a level that is used supplementarily due to low reliability. However, the secretory ductal tissue staining method is limited to the cultivated ginseng powder because it is identified as the root cross section of the main root, and it is not applicable to the ginseng powder.

Therefore, in order to accurately and quickly discriminate plant species, a method utilizing a DNA marker which is not influenced by external factors has recently been actively studied for major crops. Unlike the morphological characteristics such as the shape and size of the plant, the method using the DNA marker can distinguish the species of the plant without being influenced by the external environment, and it is possible to accurately discriminate the number of available markers.

However, the discrimination of plant species using conventional DNA markers is concentrated on the study of DNA markers used for species discrimination in the plant itself, and there is little research on food processed plants.

SUMMARY OF THE INVENTION The present invention has been made to solve the above-mentioned problems, and it is an object of the present invention to provide a primer which can be used in a system capable of scientifically discriminating red ginseng, which is damaged by heat by heat treatment.

Also, it is an object of the present invention to provide an efficient primer set which is used in constructing a species discrimination system with improved throughput per unit time in a large amount of various processed ginseng raw material products, and reducing amplification size of DNA fragments .

The present invention provides a primer set for discriminating red ginseng comprising two or more base sequences of the group consisting of SEQ ID NOS: 1 to 4.

According to a preferred embodiment of the present invention, the red ginseng discriminating primer set of the present invention comprises a primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Or a primer set of SEQ ID NO: 3 and SEQ ID NO: 4; . ≪ / RTI >

According to another preferred embodiment of the present invention, the red ginseng discriminating primer set of the present invention comprises a primer set of SEQ ID NO: 1 and SEQ ID NO: 2; And a primer set of SEQ ID NO: 3 and SEQ ID NO: 4; . ≪ / RTI >

According to another preferred embodiment of the present invention, ginseng primer set for determination of the present invention domestic ginseng (Panax ginseng; Panax ginseng CA Meyer), Chinese red ginseng ( Panax notoginseng (Burk.) FH Chen) and American red ginseng ( Panax quinquefolius L.) can be distinguished from at least one red ginseng.

According to another preferred embodiment of the present invention, the red ginseng discriminating primer set of the present invention may be obtained from a consensus primer library constructed using Arabidopsis thaliana mitochondrial DNA.

The present invention also relates to a primer set of the present invention as described above; And a reagent for carrying out an amplification reaction; The method comprising the steps of:

According to a preferred embodiment of the present invention, the reagent for performing the amplification reaction may include a DNA polymerase, dTNPs, and a buffer.

The present invention also provides a method for isolating genomic DNA from a red ginseng sample, Performing amplification reaction of the separated genomic DNA of the first step using a primer set as described above to produce an amplification product; And a third step of detecting the amplification product of the two steps; The method comprising the steps of:

According to a preferred embodiment of the present invention, the detection of the three steps can be performed by capillary electrophoresis, DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement.

According to another preferred embodiment of the present invention, the method for distinguishing red ginseng according to the present invention is a method for distinguishing Korean red ginseng from Panax ginseng CA Meyer), Chinese red ginseng ( Panax notoginseng (Burk.) FH Chen) and American red ginseng ( Panax quinquefolius L.) can be distinguished from at least one red ginseng.

Hereinafter, terms of the present invention will be described.

The "primer" of the present invention is a nucleic acid sequence having a short free 3'-hydroxyl group, which can form a base pair with a complementary template and serves as a starting point for copying the template Short nucleic acid sequence " The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. The PCR conditions, the lengths of the sense and antisense primers can be modified based on those known in the art. Such oligonucleotide primers can be easily prepared and used by those skilled in the art according to methods known in the art.

The term "primer " of the present invention is a single strand of oligonucleotides that is hybridized under suitable conditions (presence of four different nucleoside triphosphates and polymerase such as DNA or RNA polymerase) Quot; means acting as a starting point for initiating template-directed DNA synthesis under the buffer.

Furthermore, the "red ginseng" of the present invention includes both red ginseng and red ginseng concentrate prepared by processing ginseng, red ginseng extract, red ginseng extract and red ginseng processed food.

The present invention provides a primer that can be used in a system capable of scientifically discriminating not only red ginseng, which is severely damaged by DNA by heat treatment, but also processed red ginseng processed with red ginseng.

In addition, there is an effect of providing an efficient primer set in which amplification size of a DNA fragment is reduced in order to construct a species discrimination system with improved processing throughput per unit time in a variety of processed ginseng raw material products in the future. Therefore, it is effective to provide a scientific discrimination system that can guarantee stable income of domestic ginseng farmers and correct the distribution order of ginseng.

Furthermore, by using the red ginseng discrimination method of the present invention, the industry can guarantee the product variety and the country of origin of the manufactured product, thereby contributing to the improvement of the reliability of consumers who prefer domestic products.

Fig. 1 shows polymorphism results obtained by insertion or deletion of the cox1 site measured in Example 2-2. Fig.
Fig. 2 shows polymorphism results obtained by insertion or deletion of the nad1 / 2-3 region measured in Example 2-2.
Fig. 3 shows the result of polymorphism evaluation by insertion or deletion of the nad2 / 1-2 site measured in Example 2-2.
4 shows the result of base sequence analysis through PCR amplification in Example 2-3.
FIG. 5 shows the result of performing PCR using the PQ91 primer of the present invention in the case of Experimental Example 1-2.
FIG. 6 shows the results of performing PCR using the PN418 primer of the present invention in the case of Domestic red ginseng, American goat, and Chinese ginseng in Experimental Example 1-2.
FIG. 7 shows the results of PCR performed on the Korean red ginseng concentrate, the US red ginseng concentrate and the Chinese red ginseng concentrate using the PQ91 primer of the present invention in Experimental Example 2. FIG.
FIG. 8 shows the results of PCR of the Korean red ginseng concentrate, the American red ginseng concentrate and the Chinese red ginseng concentrate using the PN418 primer of the present invention in Experimental Example 2. FIG.
FIG. 9 shows the result of performing PCR using RAPD URP 9 primer in Comparative Preparation Example 1. FIG.
Figure 10 is a list of thirty primers used for EST-SSR analysis in Comparative Preparation Example 2.
11 shows the results of PCR performed using EST-SSR 2 and EST-SSR 17 primers in Comparative Preparation Example 2. (A: using EST-SSR 2 primer and B using EST-SSR 17 primer)
FIG. 12 shows the results of PCR of the domestic red ginseng concentrate, American red ginseng concentrate and Chinese red ginseng concentrate using RAPD primer in the comparative example.
FIG. 13 shows the results of PCR of the domestic red ginseng concentrate, American red ginseng concentrate and Chinese red ginseng concentrate using the EST-SSR2 primer in the comparative example.
FIG. 14 shows the results of PCR of the domestic red ginseng concentrate, American red ginseng concentrate and Chinese red ginseng concentrate using the EST-SSR17 primer in the comparative example.

Hereinafter, the present invention will be described in more detail.

As described above, it is difficult to apply the widely used morphological traits to red ginseng, which is a processed product of ginseng. Since the method using the isotope mutation and component difference may be affected by the cultivation environment, There was a difficult problem to distinguish. In addition, conventional DNA markers have problems such as application of a limited variety, reproducibility caused by long time consuming due to additional experiments after PCR, and random primers, and a large amount of processed ginseng raw materials It is necessary to provide a new DNA marker used in a species discrimination system with improved throughput per unit time.

Thus, the present invention sought to solve the above-mentioned problems by providing a set of primers comprising two or more base sequences of the group consisting of SEQ ID NOS: 1 to 4. Accordingly, it is possible to provide a novel primer set capable of promptly, accurately, and simply discriminating red ginseng with severe DNA deformation through heat treatment or the like, and a discrimination method using the primer set.

The primer set of the present invention may include two or more base sequences of the group consisting of SEQ ID NOS: 1 to 4.

The primer set may include two or more primer sets selected from the group consisting of SEQ ID NOS: 1 to 4, and the primers may include addition, deletion or substitution sequences of the nucleotide sequences of SEQ ID NOS: 1 to 4 Preferably, a primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Or a primer set of SEQ ID NO: 3 and SEQ ID NO: 4, more preferably a primer set of SEQ ID NO: 1 and SEQ ID NO: 2; And a primer set of SEQ ID NO: 3 and SEQ ID NO: 4.

The suitable length of the primer is determined depending on the characteristics of the primer to be used, but it is usually 80 to 500 bp. The primer need not be exactly complementary to the sequence of the template but can be complementary enough to form a hybridcomplex with the template.

The primer of the present invention is not particularly limited as long as it is obtained from a library that can be constructed so as to select a primer, but it may preferably be obtained from a consensus primer library constructed using Arabidopsis thaliana mitochondrial DNA .

Further, red ginseng to determine the primer set of the present invention, if necessary a conventional ginseng to determine, but can be determined, without particular limitation, and preferably domestic ginseng (Panax ginseng; Panax ginseng CA Meyer), Chinese red ginseng ( Panax notoginseng (Burk.) FH Chen) and American red ginseng ( Panax quinquefolius L.), and more preferably, it can discriminate between domestic red ginseng and Chinese red ginseng and / or domestic red ginseng and American red ginseng.

Further, the present invention relates to a primer set as described above; And a reagent for carrying out an amplification reaction.

In the kit of the present invention, the reagent for carrying out the amplification reaction is not particularly limited as long as it is included in the ginseng discrimination kit, but it may preferably include DNA polymerase, dNTPs, buffer and the like.

In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure may include instructions on the surface of a package that includes a brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure may include information that is disclosed or provided through an electronic medium, such as the Internet.

The primer set included in the kit is an amplification primer set for identifying red ginseng. The primer set included in the kit can be easily designed by a person skilled in the art using the primer set for discriminating red ginseng according to the present invention. Primer sets are included within the scope of the present invention. Preferably, the ginseng cultivar is subjected to polymorphism analysis by insertion or deletion (In / Del), and the In / Del DNA marker of the breed specificity is selected and the nucleotide sequence analysis result of the selected In / Del DNA marker The primer set can be designed. As described above, the designed primer set can be prepared as a DNA primer set with or without four bases of the selection In / Del DNA marker.

Further, the above-mentioned red ginseng identification kit is not particularly limited as long as it can be used for discriminating species of red ginseng. Preferably, the red ginseng can be classified into Korean ginseng ( Panax ginseng CA Meyer), Chinese red ginseng ( Panax notoginseng (Burk.) FH Chen) and American red ginseng ( Panax quinquefolius L.), and more preferably, it can be used to distinguish Korean red ginseng from Chinese red ginseng and / or domestic red ginseng and American red ginseng.

In addition, the present invention relates to a method for isolating genomic DNA from a red ginseng sample, Performing amplification reaction of the separated genomic DNA of the first step using a primer set as described above to produce an amplification product; And a third step of detecting the amplification product of the two steps; The method comprising the steps of:

First, step 1 is the step of isolating genomic DNA from the red ginseng sample. The red ginseng is required if the conventional determination in not particularly limited, preferably the domestic ginseng (Panax ginseng; Panax ginseng CA Meyer), Chinese ginseng (Panax notoginseng (Burk.) FH Chen) and American ginseng (Panax quinquefolius L.).

Genomic DNA isolation is not particularly limited as long as it is a method used for separating genomic DNA from a plant. Preferably, the red ginseng sample is pulverized and / or broken into powder, and then a kit used for extracting plant DNA is used Genome DNA can be isolated. More preferably, the DNeasy Plant Mini Kit of QIAGEN, Germany, can be used as a kit for extracting the plant DNA.

Next, in step 2, the amplification reaction of the separated genomic DNA of step 1 is performed using the primer set as described above to produce an amplification product.

The method for amplifying the target sequence is not particularly limited as far as it is a method for amplifying the target sequence in a plant species or a method for distinguishing the species. For example, a polymerase chain reaction (PCR), a ligase chain reaction, nucleic acid sequence-based amplification, a transcription-based amplification system, , Amplification with strand displacement amplification or Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art.

Among these methods, the polymerase chain reaction (PCR) is a method of amplifying a target sequence from a primer set that specifically binds to a target sequence using a polymerase. Such PCR methods are well known in the art and commercially available kits can be used.

In addition, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance is not particularly limited as long as it is ordinarily used as a primer-labeled substance. For example, fluorescent, phosphorescent or radioactive materials can be used, and ethidium bromide or Hoechst 33258 dyes can preferably be used. When the radioactive isotope such as ³² P or ³⁵ S is added to the reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive.

Furthermore, the primer set used for amplifying the target sequence may include two or more base sequences among the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4.

Next, the step of detecting the amplification product will be described.

The method of detecting the amplification product is not particularly limited as long as it is a method of detecting an amplified product, but it is preferably performed by capillary electrophoresis, DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement have.

The capillary electrophoresis can use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and gel electrophoresis can utilize agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity of the amplification product can be measured using a liquid scintillation counter.

According to an embodiment of the present invention, the method may further include a step of comparing the detected amplification product with the amplification product of the red ginseng standard to determine the product type.

Further, the red ginseng to determine if the method is typically cultivated and / or sale of the red ginseng is determined, but can be used without particularly limited, preferably the domestic ginseng (Panax ginseng; Panax ginseng CA Meyer), Chinese ginseng (Panax notoginseng (Burk.) FH Chen) and American red ginseng ( Panax quinquefolius L.) can be distinguished from at least one red ginseng.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to explain the present invention to the average person skilled in the art in more detail.

[ Example ]

Example  One. DNA  extraction

The domestic ginseng cultivars and foreign species used in the present invention are shown in Table 1 below.

All of the ginsengs listed in Table 1 were preserved and proliferated in the test package of the National Institute of Horticultural Science, National Rural Development Administration, and contained 10 Korean cultivars, 1 Chinese accession, and 1 American accession. Four - year - old leaves were collected and used as ginseng samples.

The ginseng sample was quenched with liquid nitrogen, ground to a powder state using a mortar and then DNA was purified using a DNeasy Plant Mini Kit (QIAGEN, Germany) according to the manufacturer's instructions. And extracted. The extracted DNA was measured using Nanodrop (manufactured by Thermo Fisher Scientific, USA). The final concentration of each DNA was adjusted to 5 ng / μl using sterilized distilled water.

Example  2. PCR  Analysis, polymorphism search and base sequence analysis

Example  2-1: PCR  analysis

Polymerase chain reaction (PCR) from the DNA extracted in Example 1 was performed on a Biometra Tprofessional thermal cycler (Whatman, Germany).

The total volume of the PCR reaction solution was 50 μl, and 10 ng of the DNA of Example 1, 0.5 unit Taq DNA polymerase (manufactured by Inclone Co., Ltd.), 2.5 mM MgCl ₂ , 20 pmole primer and 0.25 mM dNTPs .

In addition, the primers of PCR were prepared in the same manner as described in Dumimil et al., 2002, Arabidopsis thaliana (L.) Heynh.) were synthesized and used.

Further, the PCR reaction was carried out by pre-denaturation at 95 ° C for 5 minutes, followed by amplification at 95 ° C for 30 seconds, at 55-60 ° C for 30 seconds, and at 72 ° C for 2 minutes And the final amplification (final extension) was carried out at 72 ° C for 5 minutes.

The DNA product amplified by the PCR reaction was electrophoresed on 1.5% agarose gel at 180 V, stained with EtB (Ethidium Bromide), and the band was observed on a UV-illuminator. .

Example  2-2: Polymorphism search

The 30 primer sets obtained in the above Example 2-1 were applied to the foreign ginsengs of 10 Korean Ginseng, 1 American Ginseng and 1 Chinese Ginseng as shown in Table 1 of Example 1, (In / Del, Insertion or Deletion) primers were selected. The selected PCR products were purified using a Mega Quick-spin Kit (Intron Bio, Korea), and analyzed for nucleotide sequences by Macrogen Co., Ltd. (Macrogen Co., Ltd.). The nucleotide sequences were compiled using the BioEdit program (BioEdit program), stored as no gaps, and sequenced with Cluster X (ver. 1.83, BioEdit, lbis Biosciences, Carlsbad, USA).

The 30 consensus primers synthesized based on the mitochondrial DNA of Arabidopsis thaliana obtained in Example 2-1 were applied to 10 kinds of Korean ginseng and 2 kinds of foreign ginseng (American ginseng and Chinese ginseng) Polymorphism due to insertion or deletion (In / Del) was observed at nad1 / 2-3 and nad2 / 1-2 sites. There was no polymorphism between the three pairs of primers (cox1, nad1 / 2-3 and nad2 / 1-2), but polymorphism between Korean ginseng and foreign ginseng (Chinese ginseng and American ginseng) was confirmed. PCR images used in the above polymorphism analysis are shown in FIGS.

The lanes 1 to 3 of the drawings 1 to 3 are Chunpoong, the lanes 3 to 4 are Yunpoong, the lanes 5 to 6 are Gopoong, the lanes 7 to 8 are Gumpoong, Sunwong lanes 11 to 12, Sunwoon lanes 13 to 14, Sunwon lanes 13 to 14, Chungsun 15 to 16 lanes, and Chungsun 17 to 18 lanes. (Sunhyang), lanes 19 to 20 are Cheonryang, lanes 21 to 22 are P. quinquefolius , lanes 23 to 24 are P. notoginseng , M is 2- A log DNA ladder (from NewEngland Biolab (NEB), Massachusetts, USA) was indicated.

Fig. 1 shows the result of polymorphism evaluation by insertion or deletion of the cox1 site. Fig. 2 shows the results of polymorphism evaluation by insertion or deletion of the nad1 / 2-3 site. Fig. 3 shows the result of insertion or deletion of the nad2 / .

As shown in FIG. 1, the amplified DNA fragment of Korean ginseng and Chinese ginseng was found to be about 1.3 kb in cox1, and the remaining DNA fragment was about 2.1 kb in length and 800 bp in In / Del polymorphisms ).

In addition, as shown in FIG. 2, in the nad1 / 2-3, the size of the DNA fragment of Korean ginseng and that of American ginseng was about 1.3 kb, but it was confirmed that the DNA fragments of American ginseng were slightly smaller. On the other hand, the DNA fragments of Chinese ginseng were about 1.5 kb in length, and about 200 ~ 300 bp of In / Del polymorphisms were identified. At the same time, three kinds of ginseng were identified.

Further, as shown in FIG. 3, the size of the DNA fragment of Korean ginseng and that of American ginseng was 1.1 kb in nad2 / 1-2, but the DNA fragment of Chinese ginseng was 1.2 kb in insertion or deletion of about 100 bp Polymorphism was confirmed.

Based on the results of the above polymorphism analysis, it is possible to identify all of Korean Ginseng, Chinese Ginseng and American Ginseng among primers of three pairs (cox1, nad1 / 2-3, nad2 / 1-2) Nad1 / 2-3 primers that are easy to convert into markers were selected.

Example  2-3: Sequence analysis

The DNA extracted in Example 1 using the nad1 / 2-3 primer selected in Example 2-2 was subjected to PCR amplification reaction in the same manner as the PCR in Example 2-1, Sequence analysis was performed on the PCR amplification products. The result of the nucleotide sequence analysis is shown in FIG.

As can be seen from FIG. 4, the nucleotide sequence lengths of all 10 Korean ginseng were 1,355 bp in length, and 1,334 bp in the US and 1,587 bp in the Chinese ginseng. The nucleotide sequence lengths of all 10 ginseng Korean ginsengs were the same, and 237 bp base deletion was observed in all 10 species at 1,150-1,370 bp. However, among the 10 species, 'Amount' confirmed 4 base substitutions (T → C, G → T, A → T, G → A) at the base sequence of 80-90 bp, (American ginseng and Chinese ginseng).

In the case of American goat, there were 14 bp, 7 bp and 237 bp deletion at 360-380 bp, 985-995 bp and 1,150-1,370 bp, respectively, and no base substitution was observed.

The most common mutations were found in 7 mutants (326 bp, 458 bp, 504 bp, 1,077 bp, 1,288 bp, 1,290 bp and 1,373 bp) T, C → A, C → G, and G → T), and 5 bp sequence deletion was confirmed at 700-710 bp.

Example  3. New primer  making

Based on the nucleotide sequence analysis of Example 2-2, primers (nad1 / 2-3 primer) having interspecies insertion and deletion (In / Del) polymorphism confirmed were screened and more accurate and quick analysis was performed based on nucleotide sequence variation The primer was designed using primer 3 (http://primer3.wi.mit.edu/) so that the amplification size of the PCR product was less than 500 bp and that the rapid experiment could be performed.

The designed primers were designed to shorten the amplification interval to shorten the reaction time compared to the existing primers and to clearly distinguish the differences in DNA amplification band length between species.

The PCR reaction was carried out by pre-denaturation at 95 ° C for 5 minutes, followed by 35 cycles of amplification consisting of 30 seconds at 95 ° C, 30 seconds at 60 ° C, and 30 seconds at 72 ° C And the final extension process was carried out at 72 ° C for 5 minutes.

PCR amplification of 10 ginseng Korean ginseng seeds and mitochondrial nad1 / 2-3 region of American ginseng and Chinese ginseng were able to distinguish all three species by insertion and deletion polymorphism. However, the difference in species-specific nucleotide deletion was so small that it was difficult to identify the difference in the length of DNA fragments by the naked eye, and the amplification interval of the target DNA was long, so that the reaction time was long and the accuracy and reproducibility were poor. .

As shown in FIG. 4, two pairs of primers (PQ91 and PN418) were prepared targeting a species-specific base sequence deletion region.

PQ91 was designed to target 14 bp deletion sites between 360 and 380 bp in the United States. PN418 was designed as a marker to identify Chinese ginseng, targeting 10 Korean Ginseng and 237 bp deletion sites at 1,150-1,370 bp positions in American ginseng. Two sets of designed primers are shown in Table 2 below.

Clone
Information Name of the primer Sequence (5 '- > 3') PCR product size (bp) Anneal Temp. (℃)
nad1 / 2-3 PQ91 GAGCAAACACTCGAACGTGA SEQ ID NO: 1 91 bp 60 ° C CGCCACTTCTCTGAAAGCAT SEQ ID NO: 2 PN418 TGATGAAAGCACTCCAGTCG SEQ ID NO: 3 418 bp 60 ° C AACCACACGTGCAAGTTTCC SEQ ID NO: 4

Experimental Example  1. Identification of red ginseng concentrate

Experimental Example  1-1: DNA  Extraction and quantification

For the identification of red ginseng, DNA was extracted from red ginseng concentrate (Gangwon Ginseng Nonghyup). The DNA extraction was carried out by dissolving 1 g of red ginseng concentrate in 20 ml of sterilized water and 2 g of red ginseng concentrate respectively and then preparing 5% or 10% of red ginseng concentrate solution. After that, 5% red ginseng concentrate solution or 10% red ginseng concentrate solution and 100% ethanol were mixed to obtain a precipitate containing DNA from 5% or 10% red ginseng concentrate solution. , 60%, 70%, 80%, 90%, 92% and 95% mixed solution). Details of the above 14 solutions (50%, 60%, 70%, 80%, 90%, 92% and 95% mixed solutions each) are shown in Table 3 below.

Then, 100 mg of pellet precipitated in the mixed solution was quantitatively determined. The DNA was extracted with a DNeasy Plant Mini Kit (QIAGEN, Germany), and the DNA was extracted using Nanodrop (Thermo Fisher Scientific, USA) The DNA concentration was confirmed by the method described above. As shown in the following Table 3, the DNA concentration was checked, and 0.1 to 12.0 ng / μl of DNA was extracted and used for genetic analysis.

number Mixing ratio Final concentration One 5% red ginseng concentrate 0.5 ml + 100% ethanol 9.5 ml 95% 2 5% red ginseng concentrate 0.5 ml + 100% ethanol 9.2 ml 92% 3 5% red ginseng concentrate 0.5 ml + 100% ethanol 9.0 ml 90% 4 5% red ginseng concentrate 0.5 ml + 100% ethanol 8.0 ml 80% 5 5% red ginseng concentrate 0.5 ml + 100% ethanol 7.0 ml 70% 6 5% red ginseng concentrate 0.5 ml + 100% ethanol 6.0 ml 60% 7 5% red ginseng concentrate 0.5 ml + 100% ethanol 5.0 ml 50% 8 10% red ginseng concentrate 0.5 ml + 100% ethanol 9.5 ml 95% 9 10% red ginseng concentrate 0.5 ml + 100% ethanol 9.2 ml 92% 10 10% red ginseng concentrate 0.5 ml + 100% ethanol 9.0 ml 90% 11 10% red ginseng concentrate 0.5 ml + 100% ethanol 8.0 ml 80% 12 10% red ginseng concentrate 0.5 ml + 100% ethanol 7.0 ml 70% 13 10% red ginseng concentrate 0.5 ml + 100% ethanol 6.0 ml 60% 14 10% red ginseng concentrate 0.5 ml + 100% ethanol 5.0 ml 50%

Experimental Example  1-2: Domestic red ginseng discrimination

PCR analysis was performed by applying 14 domestic red ginseng DNAs obtained in Experimental Example 1-1 and the US three DNAs and Chinese ginseng DNAs obtained in Example 1 using the PQ91 and PN418 primers shown in Table 2 above.

The PCR reaction was carried out by pre-denaturation at 95 ° C for 5 minutes, followed by 35 cycles of amplification consisting of 30 seconds at 95 ° C, 30 seconds at 60 ° C, and 30 seconds at 72 ° C And the final extension process was carried out at 72 ° C for 5 minutes.

The DNA product band photographs obtained in the PCR reaction are shown in FIGS. 5 to 6.

The lane 1 in FIG. 5 to 6 is the domestic red ginseng DNA 1 and the lane 2 in Table 3, the domestic red ginseng DNA 2 in the above Table 3, the domestic ginseng DNA 3 in the lane 3 in the above Table 3, 3 domestic red ginseng DNA 4 and 5 lane are domestic domestic red ginseng DNA 5 in Table 3 and domestic ginseng DNA 6 in the above Table 3 and domestic domestic red ginseng DNA 7 in Table 3 and lane 8 in the above Table 3, The domestic red ginseng DNAs 8 and 9 of Table 3 above are domestic red ginseng DNA 9 and lane 10 of Table 3, domestic red ginseng DNA 10 of Table 3 and domestic red ginseng DNA 11 and 12 The lanes are domestic red ginseng DNA 12 and lane 13 in Table 3, the domestic red ginseng DNA 13 in Table 3, the domestic red ginseng DNA 14 in Table 3 and the Korean ginseng 10 species in Table 3 and ginseng 10 breeds) mixing DNA, 16 ~ 20 times lane American ginseng (P. quinquefolius), 21 ~ 24 times lanes Chinese ginseng (P. notoginseng), M It showed a 2-log DNA ladder (ladder) (Massachusetts, USA Material NewEnglandBiolab (NEB) Co.).

FIG. 5 shows PCR results of Korean red ginseng, Korean red ginseng and Chinese ginseng using PQ91 primer. FIG. 6 shows PCR results of Korean red ginseng, American yellow ginseng and Chinese ginseng using PN418 primer.

As can be seen from Fig. 5, in the PCR analysis using the PQ91 primer DNA fragments of 91 bp of USA were identified and DNA fragments of 14 bp and 105 bp of Korean red ginseng were identified.

As can be seen in Fig. 6, in the PCR analysis using the PN418 primer Chinese ginseng was identified as 418 bp, Korean red ginseng DNA as 14, and American bands as 179 bp.

Experimental Example  2. Identification of red ginseng concentrate

For the determination of using the ginseng collected from Chinese ginseng concentrate (to China goryeosam ginseng concentrate) and Red Ginseng extract using American ginseng (to American ginseng concentrate), the Chinese goryeosam ginseng concentrate (after purchase goryeosam in China processing domestic ginseng company (Manufactured by Chungbuk Korea Ginseng Farming Association) and American red ginseng concentrate (imported from China and imported from Korea Ginseng special division ginseng cultivation package) were purchased from Korea Chungbuk Ginseng Farming Association Korean ginseng red ginseng DNA and US red ginseng DNA were extracted by using.

In addition, red ginseng concentrate (Korean traditional ginseng concentrate) using the Korean ginseng native species (manufactured by commissioning the domestic red ginseng processing company, Chungbuk ginseng farming association corporation) and Korean ginseng chunpung (Ginseng cultivated in Ginseng Cultivation Packaging of Rural Development Administration) was cultivated in Korea using ginseng red ginseng concentrate and Chinese red ginseng concentrate Was carried out in the same manner as in the DNA extraction method of Experimental Example 1-1.

The PQ91 and PN418 primers shown in Table 2 were applied to the above-mentioned concentrated DNA, chestnut concentrate DNA, Chinese ginseng red ginseng concentrate DNA and US red ginseng concentrate DNA to perform PCR analysis.

The PCR reaction was carried out by pre-denaturation at 95 ° C for 5 minutes, followed by 35 cycles of amplification consisting of 30 seconds at 95 ° C, 30 seconds at 60 ° C, and 30 seconds at 72 ° C And the final extension process was carried out at 72 ° C for 5 minutes.

The photographs of each DNA product band obtained in the PCR reaction are shown in FIGS. 7 to 8.

7 and 8 are denominator concentrate DNAs, lanes 3 to 4 are chestnut concentrate DNA, lanes 5 to 6 are Chinese ginseng ginseng concentrate DNA, lanes 7 to 8 are american red ginseng concentrate DNA, M Was a 2-log DNA ladder (from NewEngland Biolab (NEB), Massachusetts, USA).

FIG. 7 shows the result of PCR of the domestic red ginseng concentrate, the American red ginseng concentrate and the Chinese ginseng red ginseng concentrate using the PQ91 primer, and FIG. 8 shows the results of the PCR reaction using the PN418 primer for domestic red ginseng concentrate, US red ginseng concentrate and Chinese ginseng red ginseng concentrate PCR reaction.

As can be seen in FIG. 7, in the PCR analysis using the PQ91 primer, the DNA fragment of 91 bp in the United States was identified as Panax ginseng CA Meyer). These domestic and Chinese ginseng concentrates were able to discriminate between the US and the USA with a DNA fragment of 105 bp.

Further, as seen on Figure 8, in the PCR analysis using the primer species PN418 (Panax ginseng CA Meyer) and 179 bp DNA fragments were found in both domestic and Chinese ginseng concentrates and in the USA.

In conclusion, PQ91 primer and PN418 primer could be used to distinguish between Korean ginseng and American red ginseng.

Comparative Example . RAPD  And EST - SSR Primer  Discrimination using

compare Preparation Example  One. RAPD primer  Selection

RAPD analysis was performed using 12 primers shown in Table 4 below.

Primer Sequence (5 '- > 3') SEQ ID NO: Annealing  Temperature (℃) URP1 ATC CAA GGT CCG AGA CAA CC SEQ ID NO: 5 48 URP2 GTG TGC CAT CAG TTG CTG GG SEQ ID NO: 6 46 URP3 CCC AGC AAC TGA TCG CAC AC SEQ ID NO: 7 48 URP4 AGG ACT CGA TAA CAG GCT CC SEQ ID NO: 8 46 URP5 GGC AAG CTG GTG GGA GGT AC SEQ ID NO: 9 50 URP6 ATG TGT GCG ATC AGT TGC TG SEQ ID NO: 10 48 URP7 TAC ATC GCA AGT TAC ACA GG SEQ ID NO: 11 50 URP8 AAT GTG GGC AAG CTG GTG GT SEQ ID NO: 12 44 URP9 GAT GTG TTC TTG GAG CCT GT SEQ ID NO: 13 50 URP10 GGA CAA GAA GAG GAT GTG GA SEQ ID NO: 14 42 URP11 TAC ACG TCT CGA TCT ACA GG SEQ ID NO: 15 50 URP12 AAG AGG CAY YCY ACC ACC AC SEQ ID NO: 16 48

The PCR reaction was carried out by pre-denaturation at 94 ° C for 5 minutes, amplification at 40 ° C for 40 seconds at 94 ° C, 40 seconds at 48 ° C to 52 ° C, and 120 seconds at 72 ° C for 40 times And the final extension process was carried out at 72 ° C for 10 minutes.

As a result of the PCR analysis, URP 9 represented by SEQ ID NO: 13 among the RAPD primers shown in Table 4 was judged to be most preferable and selected. RAPD analysis using URP9 PCR results are shown in FIG.

compare Preparation Example  2. EST - SSR primer  Selection

EST-SSR analysis was performed using 30 kinds of primers shown in FIG.

The PCR reaction was carried out by pre-denaturation at 95 ° C for 5 minutes, amplification at 95 ° C for 30 seconds, 55 to 62 ° C for 30 seconds, and 72 ° C for 60 seconds for 35 cycles And the final extension process was carried out at 72 ° C for 10 minutes.

As a result of the PCR analysis, P2 and P17 among the EST-SSR primers shown in FIG. 9 were judged to be most preferable, and these were selected as EST-SSR2 and EST-SSR17 primers. RAPD analysis using EST-SSR2 PCR results are shown in FIG. 11A, and RAPD analysis using EST-SSR17 PCR results are shown in FIG. 11B.

Comparative Example  One.

The RAPD UPR 9 primer, EST-SSR 2, and EST-SSR 17 primer selected in Comparative Preparation Examples 1 and 2 were added to the homogenized concentrate DNA, chestnut concentrate DNA, Chinese ginseng red ginseng concentrate DNA and US red ginseng concentrate PCR analysis was performed by applying to the discrimination of DNA.

RAPD analysis performed in Comparative Preparation Example 1 or 2 PCR reaction or EST-SST analysis The PCR reaction of RAPD analysis or EST-SST analysis was performed in the same manner as the PCR reaction conditions.

The DNA product band photographs obtained in the above PCR reaction are shown in FIGS. 10 to 12.

The lanes 1 to 2 in Figs. 12 to 14 are DNA of native species concentrate DNA, the lanes 3 to 4 are chestnut concentrate DNA, the lanes 5 to 6 are Chinese red ginseng concentrate DNA, the lanes 7 to 8 are red ginseng concentrate DNA, Was a 2-log DNA ladder (from NewEngland Biolab (NEB), Massachusetts, USA).

FIG. 12 shows the result of PCR of the domestic red ginseng concentrate, US red ginseng concentrate and Chinese ginseng red ginseng concentrate using RAPD UPR 9 primer. FIG. 13 shows the result of PCR using the EST-SSR2 primer, the domestic red ginseng concentrate, FIG. 14 shows the result of performing PCR reaction of Korean red ginseng concentrate, American red ginseng concentrate and Chinese ginseng red ginseng concentrate using EST-SSR17 primer.

As shown in FIGS. 10 to 12, PCR analysis using the RAPD URP9 primer, the EST-SSR2 primer and the EST-SSR17 primer revealed that some PCR reactions were not observed or the results of discrimination and reproducibility could not be obtained It was confirmed that the sample used was not suitable for the identification of red ginseng concentrate.

As can be seen from Examples and Experimental Examples, the primer set of the present invention is a marker which can identify red ginseng produced using Korean Ginseng, American Ginseng and Chinese Ginseng which are commonly used three types of ginseng in a short time, It is expected that it can be used as an on-the-spot regulation technology to prevent illegal circulation of smuggled ginseng, counterfeit products of domestic ginseng products, and red ginseng produced using non-Korean ginseng species. In addition, the present invention can provide a primer set which effectively reduces amplification size of a DNA fragment, thereby providing a red ginseng discrimination method in which a large amount of processed red ginseng products are improved in processing ability per unit time. Therefore, the present invention provides a scientific discrimination system that can guarantee stable income of domestic ginseng farmers and correct the distribution order of red ginseng and red ginseng processed food.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer sets for discriminating of red ginseng and uses thereof <130> 1039878 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Arabidopsis thaliana <400> 1 gagcaaacac tcgaacgtga 20 <210> 2 <211> 20 <212> DNA <213> Arabidopsis thaliana <400> 2 cgccacttct ctgaaagcat 20 <210> 3 <211> 20 <212> DNA <213> Arabidopsis thaliana <400> 3 tgatgaaagc actccagtcg 20 <210> 4 <211> 20 <212> DNA <213> Arabidopsis thaliana <400> 4 aaccacacgt gcaagtttcc 20

Claims (10)

A primer set of SEQ ID NO: 1 and SEQ ID NO: 2; And
A primer set of SEQ ID NO: 3 and SEQ ID NO: 4; A primer set for discriminating red ginseng. delete delete The method according to claim 1, wherein the primer set is selected from the group consisting of domestic red ginseng ( Panax ginseng CA Meyer), Chinese red ginseng ( Panax notoginseng (Burk.) FH Chen) and American red ginseng ( Panax quinquefolius L.). The primer set for discriminating red ginseng. The primer set for discriminating red ginseng according to claim 1, wherein the primer set for discriminating red ginseng is obtained from a consensus primer library constructed using Arabidopsis thaliana mitochondrial DNA. A primer set according to any one of claims 1, 4 and 5; And
A reagent for carrying out an amplification reaction; And a red ginseng extract. [Claim 7] The kit for identifying red ginseng according to claim 6, wherein the reagent for performing the amplification reaction comprises DNA polymerase, dTNPs, and a buffer. A first step of isolating genomic DNA from the red ginseng sample;
Performing amplification reaction of the separated genomic DNA of step 1 using a primer set according to any one of claims 1 to 5 to produce an amplification product; And
A third step of detecting the amplification products of the two steps;
/ RTI &gt; 9. The method according to claim 8, wherein the detection of the three steps is performed by capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. The method of claim 8, wherein the ginseng determination method domestic ginseng (Panax ginseng; Panax ginseng CA Meyer), Chinese ginseng (Panax notoginseng (Burk.) FH Chen) and American red ginseng ( Panax quinquefolius L.). &lt; / RTI &gt;

Images