KR20100091643A - Method for discriminating genetical identification of ginseng species with modified primers - Google Patents

Abstract

PURPOSE: A method for distinguishing ginseng species using modified primers is provided to accurately and easily distinguish Panax ginseng and Panax quinquefolius. CONSTITUTION: A method for distinguishing different species of ginsengs is performed using primers comprising original sequence at 3' and non-complementary nucleotide. The non-complementary nucleotide is 1-5. The different species of ginsengs is Panax ginseng and Panax quinquefolius. A primer for Panax ginseng is a primer set of sequence numbers 1 and 2. A primer for Panax quinquefolius is a primer set of sequence numbers 3 and 4. A kit for identifying the Panax ginseng and Panax quinquefolius comprises the primer set of sequence numbers 1-4.

Description

Method for discriminating genetical identification of ginseng species with modified Primers}

The present invention relates to a method for easily discriminating different species of ginseng by carrying out a polymerase chain reaction using a primer comprising an original sequence and a non-complementary nucleotide at the 3'-end, and using the primer according to the present invention. If the bands of amplified products of Korean ginseng and flowering ginseng are more distinctly distinguished, Korean ginseng and flowering ginseng can be easily distinguished even when using low-purity DNA or an inexperienced beginner performs a polymerase chain reaction. .

Ginseng can be classified into origin, growth environment and processing form, and there are differences in species and form depending on the origin. The genus Panax belongs to the Araliaceae family, and the genus and species are Korean ginseng, Panax Ginseng.The genus is Panax, but the species is different. (Western ginseng, American ginseng), Yunnan province in southern China, Samchil ginseng grown in Guangxi province, and bamboo shoots grown in Japan have 12 species in the genus. However, there are only three medically useful species. Ginseng (P. ginseng CA Meyer, Oriental ginseng) and Hwagi ginseng (P. quinquefolius L., American ginseng) are anti-stress, anti-fatigue and anti-aging It is used as a tonic for the purpose of aging. Ginseng (P. notoginseng, Burkill, F. H. Chen, Sanchi) is used as a hemostatic agent when bleeding.

In particular, P. quinquefolius, known as P. ginseng and American ginseng, is considered an important drug in Korea and China (Kaul PN., Et al., Prog Drug Res., 57, pp1). -75, 2001; Bhattaram VA., Et al., Phytomedicine, 9 Suppl 3, pp1-33, 2002; Wen J., et al., Mol. Phylogenet.Evol., 6 (2), pp167-77, 1996 ). Among these two species, Korean ginseng is known to strengthen GI more effectively against aging, weakness, and stress compared to Hwagi. In addition, Korean ginseng is very expensive compared to Western ginseng in the Korean market, so some merchants cheat and sell Huagi ginseng as Korean ginseng.

Traditionally, morphological, cytological, anatomical and physiological methods have been used to classify herbal medicines, but in many cases it depends not only on the subjective perspective of the discriminator, but also on the basis of the fact that most herbal medicines exist as crude drugs. Not only is it processed into powder or cut into pieces, but it is not easy to distinguish. Chemical analysis of ginsenosides by examining ginsenosides is not appropriate because they are affected by their growth conditions, storage conditions, and post-harvest processing, and they require a large amount to analyze (Yip, T., Lau, C., But, P., and Kong, Y. 1985. Am. J. Chin.Med., 13:77; and Lang, Z., Lou, W., and But, P. 1993 J. Chin. Pharm. Sci., 2: 133).

Moreover, many commercial ginseng products have problems that are difficult to identify because they are in the form of slices, powders or extracts (Um JY., Et al., Biol. Pharm. Bull., 24 (8), pp872-5, 2001). In addition, chemical analysis confirms that it is very difficult to distinguish ginseng due to the diversity of soil conditions, climate and nutritional factors (Mihalov JJ., Et al., J. Agric. Food Chem., 48 (8). ), pp3744-52, 2000).

Therefore, the present inventors have conducted extensive research on a method for distinguishing ginseng species even with a small amount of samples. The present invention was completed by confirming that anyone using a primer can easily distinguish ginseng species.

The polymerase chain reaction, which has been mainly used to discriminate between different species, is able to discriminate between species even with a small amount of DNA. However, since the sensitivity is high, the results may be completely different depending on DNA purity and skillfulness. In the present invention, even if the polymerase chain reaction under any conditions, it is to provide a primer and a method for discriminating the species of ginseng using the same to make it easy to distinguish between species and easily obtain a result.

The present invention relates to a method for discriminating different species of ginseng using primers comprising original sequences and non-complementary nucleotides at the 3'-end, wherein the non-complementary nucleotides are 1 to 5, and are not contiguous. It is characterized by.

The present invention is amplified products of Korean ginseng and flowering ginseng by performing a polymerase chain reaction using a primer containing the original sequence and non-complementary nucleotide at the 3'-end, compared to the case of using the primer complementary to the original sequence Since the bands are more distinctly distinguished, Korean ginseng and flowering ginseng can be easily distinguished even when low-purity DNA is used, or when an inexperienced beginner performs a polymerase chain reaction.

The present invention relates to a method for discriminating different species of ginseng using primers comprising original sequences and non-complementary nucleotides at the 3'-end. Hereinafter, the present invention will be described in detail.

The polymerase chain reaction (PCR) obtains a large amount of DNA through multiple cycles of amplification even with a small amount of DNA, and is performed by a cycle of thermal denaturation-annealing-extension. The optimum annealing temperature and time of the primers will depend on the template DNA binding site, GC base content ratio and length, so that the exact annealing temperature cannot be determined only by the primer sequence, and the optimum annealing temperature and time should be determined experimentally. . If the annealing reaction is not performed under the correct annealing conditions, a non-specific PCR product is formed, which may lead to unexpected results. Therefore, in order to discriminate between species, optimal annealing conditions should be measured for each primer, and if the optimum annealing conditions are different, the inconvenience of having to perform multiple PCRs with different annealing conditions occurs.

In addition, when a primer corresponding to each species is prepared and amplified by a polymerase chain reaction, in theory, when a primer specific to one species is used, the amplification should be specifically performed only on that species. If you do this is often amplified together in other species that should not be amplified. As such, the polymerase chain reaction is sensitive to the reaction conditions, and nonspecific expression occurs frequently depending on how the initial DNA concentration, temperature, and amplification cycle are controlled.

The present invention is a method for discriminating ginseng using a primer including non-complementary nucleotides, specifically, the non-complementary nucleotides are not continuous. When non-complementary nucleotides are present in succession, the nucleotides below the non-complementary nucleotides do not bind to the template DNA at all, and thus the primer length plays a substantial role as a complementary primer as short as the contiguous non-complementary nucleotides. This is because there is no sense in having a non-complementary nucleotide according to. Therefore, since the polymerization process of the primer does not occur smoothly and the site to be amplified is not sufficiently amplified, when confirming the polymerization product in the agarose gel, the expression of the final band cannot be confirmed.

Ginseng samples that can be determined using primers containing nucleotides that are not complementary to the sequence include Panax species, for example, Panax ginseng, Panax quinquefolia, Jeonchisam (samchi, Panax notoginseng, Panax japonica, Panax trifolia, Panax pseudoginseng, Panax vietnamensis, Panax elegatior, Panax wanianus Or outposts, roots, stems, or leaves of Panax bipinratifidus.

It is preferred that the primer comprising the non-complementary nucleotide of the present invention is a primer having a non-complementary nucleotide within the nucleotide within 5 of the 3'-end. In the polymerase chain reaction, the polymerization process starts from the 5'-end to the 3'-end, so if the non-complementary nucleotide is at the 5'-end, the polymerization reaction is difficult to start, so that DNA polymerization may not occur at all. This is high.

In addition, in the primer comprising the non-complementary nucleotide of the present invention, the number of non-complementary nucleotides is preferably 1 to 5, more preferably 1 to 3. This is because when the number of non-complementary nucleotides exceeds 5, the binding force with the template is insufficient in the polymerization reaction, so that the polymerization reaction does not occur sufficiently, and thus it may be difficult to obtain a distinguishable band when identifying the polymerized product in the agarose gel. .

In particular, in the case of Korean ginseng and flowering ginseng, as shown in Figure 1, since the different portions of the gene sequence is only five nucleotides, it is preferable that the non-complementary nucleotides are present among the five different nucleotides.

Guanine (G) may be modified to cytosine (C), adenine (A), or thymine (T) in SEQ ID NO: 5'-GATTC-3 'present only in Korean ginseng or SEQ ID NO: 5'-CAGTG-3' present only in Korean ginseng Adenine (A) is cytosine (C), guanine (G), thymine (T), cytosine (C) is guanine (G), thymine (T), adenine (A) and thymine (T) is adenine ( A), cytosine (C), guanine (G) can be modified, and may be modified with a nucleotide having a structural change such as methylation.

Primers comprising nucleotides that are non-complementary to the sequence according to the present invention, it is particularly preferable to use primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 for Korean ginseng and primer sets of SEQ ID NO: 3 and SEQ ID NO: 4 for flowering ginseng Do.

In addition, the present invention relates to a determination kit using a primer comprising the non-complementary nucleotide, and particularly, it is preferable to use a primer set of SEQ ID NOs: 1 to 4 for the determination of Korean ginseng and flowering ginseng.

The determination kit of the present invention comprises the first step of extracting DNA from the ginseng sample; A second step of preparing a reaction solution of the extracted DNA and a primer; A third step of amplifying the prepared reaction solution; And identifying a band of the product of the amplified DNA.

The second step may include a primer described in SEQ ID NOs: 1 to 4. The determination kit of the present invention can easily identify ginseng that is difficult to discriminate with the naked eye using a small amount of sample using a species specific modified primer.

Reagents and experimental procedures used in the polymerase chain reaction described herein may be used without limitation to those known to those skilled in the art. Hereinafter, the configuration and effects of the present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

Example

1. DNA extraction

100 g each of Korean ginseng (Ginseng, Red Ginseng) and Hwagi Ginseng (Ginseng, Dried Ginseng) powder were put in a 1.5 ml tube, and DNA was extracted using a commercial DNA extraction kit (DNeasy Plant Mini Kit, Quiagen).

2. Preparation of non-complementary primer

18S rRNA gene sequence of Korean ginseng (NCBI Genbank No. D83275) and 18S rRNA gene sequence of NCB (NCBI Genbank No. D85172) were compared using the CLUSTAL W program, and then, in each specific sequence portion of Korean ginseng and flowering ginseng, Primer was prepared. The prepared primers are shown in Table 1 below.

Target Phra
Emer Standing column
(5 '→ 3') PCR product size (bp) Annealing temperature
(℃) PCR positive control UP-F CACGGGGAGGTAGTGACAAT 195 60 UP-R CCCAACCCAAAGTCCAACTA Korean ginseng KR-F ACAATACCGGGCTGTTC 170 60 UP-R CCCAACCCAAAGTCCAACTA Fire ginseng US-F ACAATACCGGGCTCAGTG 170 60 UP-R CCCAACCCAAAGTCCAACTA

As shown in Table 1, since the different portions of the sequences of Korean ginseng and flowering ginseng are only 5 nucleotides, when the polymerase chain reaction is performed, it is difficult to confirm the species-specific expression when the purity is lowered. It was not easy.

Accordingly, the GATTC portion of the 3′-terminus of the primer KR-F of Korean ginseng among the primers complementary to the gene sequences of Korean ginseng and flowering ginseng was modified with two nucleotides with G G T C C, and the primer US- The 3'-terminal CAGTG portion of F was modified with one nucleotide with CAG G G to produce three modified specific primers (Table 2).

Target Phra
Emer Standing column
(5 '→ 3') PCR product size (bp) Annealing temperature
(℃) PCR positive control UP-F CACGGGGAGGTAGTGACAAT 195 60 UP-R CCCAACCCAAAGTCCAACTA Korean Ginseng Specific Modified Primer PGS-F
(SEQ ID NO 1) ACAATACCGGGCTG G T C C 170 60 UP-R
(SEQ ID NO: 2) CCCAACCCAAAGTCCAACTA Hwagisam specific modified primer PQS-F
(SEQ ID NO: 3) ACAATACCGGGCTCAG G G 170 60 UP-R
(SEQ ID NO: 4) CCCAACCCAAAGTCCAACTA

3. Chain Polymerization Reaction Using Modified Primer

The modified primer and positive control primer of Table 2 were amplified by repeating 30 cycles at the temperature of Table 3, respectively.

step Temperature time Repeat (times) Pre-thermal degeneration 94 ℃ 10 minutes One Heat denaturation 94 ℃ 30 seconds 30 Annealing 60 ℃ 30 seconds polymerization 72 ℃ 30 seconds Final polymerization 72 ℃ 10 minutes One keep 4 ℃ - -

The result of the polymerase chain reaction was electrophoresed in agarose gel to confirm the band. As a result, as shown in Figure 2, the DNA sample of dried ginseng powder of hwagisam was able to confirm the band in the specific primer (PG-F) and positive control primer of hwagisam, and the Korean ginseng-specific primer (PQM) in the DNA sample of Korean red ginseng powder -F) it was confirmed that the band is expressed with a positive primer band.

4. Comparison of Expression of Unmodified and Modified Primers

In order to confirm the specificity of the discrimination between species in the case of using a modified primer, a chain polymerization reaction was carried out by changing the cycle and temperature using an unmodified primer.

As shown in FIG. 3, when the annealing temperature of 60 ° C. was carried out in the same manner as the modified primer using the unmodified primer at 30 ° C., the band was strongly expressed in both the case of using the primers of Korean ginseng or Hwagi ginseng. Could not be easily distinguished from. However, when the modified primer was used, the band was expressed only in the Korean ginseng modified primer (PG-F), and the band was expressed only in the modified Ginseng modified primer (PQS-F). In case of using Korean ginseng and Hwagi ginseng, each could be easily distinguished.

1 is a comparison of the gene sequence of Korean ginseng and hwagisam. Arrows indicate the nucleotides used in the primer design and their orientation, PGS-F represents the specific primer of Korean ginseng, and PQS-F represents the specific primer of flowering ginseng.

FIG. 2 shows the results of three repeated polymerase chain reactions of Korean ginseng (red ginseng powder capsule) and Hwagisam dry ginseng powder using specific modified primers. UP-F is a positive control.

FIG. 3 shows the results of 30 cycles of polymerase chain reaction with primers before modification (KR: Korea ginseng, US: Ginseng ginseng) and primers after modification. 1: Korean ginseng sample 2: Ginseng sample PG: Specific primer of Korean ginseng PQ: Specific primer of Korean ginseng

<110> Korea Ginseng Corp. <120> Method for discriminating genetical identification of ginseng          species with modified Primers <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 18 <212> DNA <213> Panax Ginseng <400> 1 acaataccgg gctggtcc 18 <210> 2 <211> 20 <212> DNA <213> Panax Ginseng <400> 2 cccaacccaa agtccaacta 20 <210> 3 <211> 18 <212> DNA <213> Panax Quinquefolius <400> 3 acaataccgg gctcaggg 18 <210> 4 <211> 20 <212> DNA <213> Panax Quinquefolius <400> 4 cccaacccaa agtccaacta 20  

Claims (6)

A method for discriminating different species of ginseng using primers comprising original sequences and non-complementary nucleotides at the 3'-end. The method of claim 1 wherein the non-complementary nucleotides are not contiguous. The method of claim 1, wherein the non-complementary nucleotides are 1-5. The method of claim 1, wherein the different species of ginseng are Korean ginseng and hwagisam. The method according to claim 4, wherein the Korean ginseng uses the primer sets of SEQ ID NOs: 1 and 2, and the fire ginseng uses the primer sets of SEQ ID NOs: 3 and 4. Identification kit of Korean ginseng and flower ginseng comprising a primer set of SEQ ID NOs: 1 to 4.

Images