Primer combination for simultaneously identifying traditional Chinese medicines of ginseng, American ginseng and pseudo-ginseng and application thereof
Technical Field
The invention relates to a primer combination for simultaneously identifying traditional Chinese medicines of ginseng, American ginseng and pseudo-ginseng and application thereof.
Background
Panax (Panax L.) plants are rare medicinal plants, and all plants are used as medicines. There are 6 kinds of Chinese pharmacopoeia including ginseng, American ginseng, notoginseng, Japanese ginseng, pansy, etc. Wherein, the ginseng, the American ginseng and the pseudo-ginseng are the main medicinal and functional food varieties of the ginseng, and the roots, the rhizomes, the leaves, the flowers, the fruits and the like of the ginseng are all used as medicaments, so the value is very high. In the clinical application of the traditional Chinese medicine, the ginseng is warm in nature, has the effects of greatly tonifying primordial qi, relieving depletion, promoting the production of body fluid and soothing the nerves; the pseudo-ginseng is warm in nature, sweet and slightly bitter in taste, and has the effects of dissipating blood stasis, stopping bleeding, diminishing swelling and relieving pain; american ginseng is cool in nature, and has the effects of tonifying qi and yin, clearing heat and promoting fluid production. The three have great difference in drug effect and cannot be used together. However, because ginseng, panax notoginseng and panax quinquefolium are related species of panax, the shapes and chemical components are similar, the phenomenon of mixing and using ginseng, panax quinquefolium decoction pieces or ginseng flowers, American ginseng flowers and panax notoginseng flowers occurs in the market, and particularly, the common situation that ginseng, panax quinquefolium decoction pieces or ginseng flowers, American ginseng flowers and panax notoginseng flowers are mixed mutually in the market causes damage to the medication safety, and an accurate and reliable identification method which can detect whether the mutual mixing exists or not at the same time is required to be established.
Although specific molecular markers and detection methods of ginseng and American ginseng are reported at present, the technologies only pay attention to identification of genuineness and genuineness of ginseng, cannot identify whether doped products exist, and can determine flowers, leaves and decoction piece doped samples actually existing in the market by carrying out multiple PCR reactions.
Disclosure of Invention
The invention aims to provide a primer combination for simultaneously identifying traditional Chinese medicines of ginseng, American ginseng and pseudo-ginseng and application thereof.
The invention provides a primer combination, which consists of a primer pair I, a primer pair II and a primer pair III;
the primer pair I consists of a primer F1 and a primer F2;
the primer F1 is (a1) or (a 2):
(a1) a single-stranded DNA molecule shown in sequence 1 of the sequence table;
(a2) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 1 and have the same functions as the sequence 1;
the primer F2 is (a3) or (a 4):
(a3) a single-stranded DNA molecule shown in a sequence 2 of a sequence table;
(a4) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 2 and have the same functions as the sequence 2;
the primer pair II consists of a primer F3 and a primer F4;
the primer F3 is (a5) or (a 6):
(a5) a single-stranded DNA molecule shown in sequence 3 of the sequence table;
(a6) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 3 and have the same functions as the sequence 3;
the primer F4 is (a7) or (a 8):
(a7) a single-stranded DNA molecule shown in a sequence 4 of the sequence table;
(a8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 4 and having the same functions as the sequence 4;
the primer pair III consists of a primer F5 and a primer F6;
the primer F5 is (a9) or (a 10):
(a9) a single-stranded DNA molecule shown in sequence 5 of the sequence table;
(a10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 5 and having the same functions as the sequence 5;
the primer F6 is (a11) or (a 12):
(a11) a single-stranded DNA molecule shown in sequence 6 of the sequence table;
(a12) and (b) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 6 and has the same function as the sequence 6.
The primer combination is used in any one of the following (b1) to (b 6):
(b1) identifying ginseng, pseudo-ginseng and American ginseng;
(b2) preparing a kit for identifying ginseng, pseudo-ginseng and American ginseng;
(b3) identifying whether the medicinal material to be detected is ginseng, pseudo-ginseng or American ginseng;
(b4) preparing a kit for identifying whether the medicinal material to be detected is ginseng, pseudo-ginseng or American ginseng;
(b5) identifying whether the sample to be detected contains ginseng and/or pseudo-ginseng and/or American ginseng or not;
(b6) preparing a kit for identifying whether the sample to be detected contains ginseng and/or pseudo-ginseng and/or American ginseng.
The invention also protects the application of the primer combination, and the primer combination is any one of the following (b1) to (b 6):
(b1) identifying ginseng, pseudo-ginseng and American ginseng;
(b2) preparing a kit for identifying ginseng, pseudo-ginseng and American ginseng;
(b3) identifying whether the medicinal material to be detected is ginseng, pseudo-ginseng or American ginseng;
(b4) preparing a kit for identifying whether the medicinal material to be detected is ginseng, pseudo-ginseng or American ginseng;
(b5) identifying whether the sample to be detected contains ginseng and/or pseudo-ginseng and/or American ginseng or not;
(b6) preparing a kit for identifying whether the sample to be detected contains ginseng and/or pseudo-ginseng and/or American ginseng.
The invention also protects a kit containing the primer combination; the application of the kit is (c1), (c2) or (c 3):
(c1) identifying ginseng, pseudo-ginseng and American ginseng;
(c2) identifying whether the medicinal material to be detected is ginseng, pseudo-ginseng or American ginseng;
(c3) and identifying whether the sample to be detected contains ginseng and/or pseudo-ginseng and/or American ginseng.
The invention also provides a preparation method of the kit, which comprises the step of packaging each primer independently.
The invention also discloses a method for identifying whether the raw material of the medicinal material to be detected processed by the single raw material is ginseng, pseudo-ginseng or American ginseng, which is the following method I or method II.
The method I comprises the following steps: extracting the genomic DNA of the medicinal material to be detected; and (3) performing PCR amplification by using the genome DNA as a template and the primer combination, wherein if the amplification product contains 227-.
The method II comprises the following steps: detecting whether the genome DNA of the medicinal material to be detected contains a target sequence of a primer pair I, a target sequence of a primer pair II or a target sequence of a primer pair III in the primer combination; if the genome DNA contains the target sequence of the primer pair I and the raw material of the medicinal material to be detected is ginseng, if the genome DNA contains the target sequence of the primer pair II and the raw material of the medicinal material to be detected is pseudo-ginseng, and if the genome DNA contains the target sequence of the primer pair III and the raw material of the medicinal material to be detected is American ginseng.
The raw material of the drug to be detected is root, leaf, flower, stem or seed of ginseng, pseudo-ginseng or American ginseng.
The invention also protects a method for identifying whether the raw material of the medicinal material to be tested processed by the single raw material is ginseng, pseudo-ginseng or American ginseng, which is the following method III, method IV or method V.
The method III comprises the following steps: extracting the genome DNA of the medicinal material to be detected; and (2) performing PCR amplification by using the genome DNA as a template and the primer combination, wherein if the amplification product contains 227 plus 267bp DNA fragment and the raw material of the medicinal material to be detected is ginseng, if the amplification product contains 472 plus 512bp DNA fragment and the medicinal material to be detected is pseudo-ginseng, if the amplification product contains 1068 plus 1108bp DNA fragment and the raw material of the medicinal material to be detected is American ginseng, if the amplification product does not contain 227 plus 267bp DNA fragment, 472 plus 512bp DNA fragment or 1068 plus 1108bp DNA fragment, and the raw material of the medicinal material to be detected is non-ginseng, non-pseudo-ginseng and non-American ginseng.
The method IV comprises the following steps: extracting the genome DNA of the medicinal material to be detected; performing PCR amplification by using the primer combination by using the genome DNA as a template; if the SYBR Green I fluorescent dye is added into the amplification product, Green fluorescence can be detected, the raw material of the medicinal material to be detected is ginseng or pseudo-ginseng or American ginseng, if the SYBR Green I fluorescent dye is added into the amplification product, the Green fluorescence cannot be detected, and the raw material of the medicinal material to be detected is non-ginseng, non-pseudo-ginseng and non-American ginseng.
The method V comprises the following steps: detecting whether the genome DNA of the medicinal material to be detected contains a target sequence of a primer pair I, a target sequence of a primer pair II or a target sequence of a primer pair III in the primer combination; if the genome DNA contains the target sequence of the primer pair I, the raw material of the medicinal material to be detected is ginseng, if the genome DNA contains the target sequence of the primer pair II and the raw material of the medicinal material to be detected is pseudo-ginseng, if the genome DNA contains the target sequence of the primer pair III and the raw material of the medicinal material to be detected is American ginseng, if the genome DNA does not contain the target sequence of the primer pair I, the primer pair II or the primer pair III, the raw material to be detected is non-ginseng, non-pseudo-ginseng and non-American ginseng.
The raw materials of the medicinal materials to be detected can be roots, leaves, flowers, stems or seeds of ginseng, pseudo-ginseng, American ginseng, panax japonicus, rhizoma panacis majoris or panax pseudoginseng.
The invention also provides a method for identifying whether the sample to be detected contains ginseng and/or pseudo-ginseng and/or American ginseng, which is the following method VI, method VII or method VIII.
The method VI comprises the following steps: extracting the genome DNA of a sample to be detected; and (2) performing PCR amplification by using the primer combination by using the genome DNA as a template, wherein if the amplification product contains 227 plus 267bp DNA fragment, the sample to be detected contains ginseng, if the amplification product contains 472 plus 512bp DNA fragment, the sample to be detected contains panax notoginseng, if the amplification product contains 1068 plus 1108bp DNA fragment, the sample to be detected contains panax quinquefolius, if the amplification product does not contain 227 plus 267bp DNA fragment, 472 plus 512bp DNA fragment or 1068 plus 1108bp DNA fragment, and the sample to be detected does not contain ginseng, panax notoginseng and American ginseng.
The process VII comprises the steps of: extracting the genome DNA of a sample to be detected; performing PCR amplification by using the primer combination by using the genome DNA as a template; if the SYBR Green I fluorescent dye is added to the amplification product, Green fluorescence can be detected, and the sample to be detected contains ginseng or pseudo-ginseng or American ginseng, or if the SYBR Green I fluorescent dye is added to the amplification product, Green fluorescence cannot be detected, and the sample to be detected does not contain ginseng, pseudo-ginseng or American ginseng.
The method VIII comprises the following steps: detecting whether the genome DNA of a sample to be detected contains a target sequence of a primer pair I, a target sequence of a primer pair II or a target sequence of a primer pair III in the primer combination; if the genome DNA contains a target sequence of a primer pair I, the sample to be detected contains ginseng, if the genome DNA contains a target sequence of a primer pair II, the sample to be detected contains pseudo-ginseng, if the genome DNA contains a target sequence of a primer pair III, the sample to be detected contains American ginseng, if the genome DNA does not contain the target sequence of the primer pair I, the primer pair II or the primer pair III, and the sample to be detected does not contain ginseng, pseudo-ginseng or American ginseng.
The invention also protects the primer pair II or the primer pair III.
The invention also protects the application of the primer pair II in the preparation of the kit A.
The kit A is used as the following (d1) or (d 2):
(d1) identifying whether the medicinal material to be detected is pseudo-ginseng or not;
(d2) and identifying whether the sample to be detected contains the pseudo-ginseng or not.
The invention also protects the application of the primer pair III in the preparation of the kit B.
The application of the kit B is as follows (d3) or (d 4):
(d3) identifying whether the medicinal material to be detected is American ginseng or not;
(d4) and identifying whether the sample to be detected contains American ginseng or not.
The invention also protects a kit A containing the primer pair II.
The application of the kit B is as follows (d1) or (d 2):
(d1) identifying whether the medicinal material to be detected is pseudo-ginseng or not;
(d2) and identifying whether the sample to be detected contains the pseudo-ginseng or not.
The invention also protects a kit B containing the primer pair III.
The application of the kit B is as follows (d3) or (d 4):
(d3) identifying whether the medicinal material to be detected is American ginseng or not;
(d4) and identifying whether the sample to be detected contains American ginseng or not.
The annealing temperature for PCR amplification described in any of the above is 60 ℃.
The reaction system for any one of the above PCR amplifications may specifically be: 2.5. mu.L of 10 XBuffer buffer, 1.6. mu.L dNTP (2.5mM), 0.4. mu.L of primer F1, 0.4. mu.L of primer F2, 0.4. mu.L of primer F3, 0.4. mu.L of primer F4, 0.4. mu.L of primer F5, 0.4. mu.L of primer F6, 0.2. mu.L of SpeedStar HS Taq DNA polymerase, 2. mu.L of template (DNA content 0.032g-20ng), 16.3. mu.L of sterile double distilled water.
The DNA content may be 10 ng.
The above primers were added to the PCR reaction system in the form of primer solutions, and the initial concentrations of the primers in the primer solutions were all 5. mu.M.
The reaction procedure of any one of the above PCR amplifications may specifically be: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing for 10s, and extension at 72 ℃ for 20s for 35 cycles; extension at 72 ℃ for 3 min.
The 227-267bp DNA fragment can be a 247bp DNA fragment, and can be a DNA molecule shown in a sequence 7 of a sequence table.
The 472-512bp DNA fragment can be a 492bp DNA fragment, and can be a DNA molecule shown in sequence 8 of the sequence table.
The 1068-19 bp 1108bp DNA fragment can be specifically a 1088bp DNA fragment, and can be specifically a DNA molecule shown as a sequence 9 in a sequence table.
Any one of the above samples to be tested may be root, leaf, flower, stem, seed, processed product or other types of medicinal materials of Ginseng radix, Notoginseng radix, radix Panacis Quinquefolii, rhizoma Panacis Japonici, rhizoma Panacis Majoris or rhizoma Panacis Majoris.
The identification of true and false adulterants is always a difficult problem of traditional Chinese medicine identification and depends on the development of a method for simultaneously detecting the specificity markers of the true and false adulterants. Multiplex PCR is a technology for carrying out multiple PCR amplifications in the same system, and has the outstanding advantage of simultaneously representing multiple sites or gene segments in one detection, thereby having the potential of doped detection. The existing ginseng genus multiple PCR identification method usually only focuses on whether species of ginseng, American ginseng and pseudo-ginseng can be detected at the same time, and each medicinal material can be judged only by the amplification result of two pairs of primers, so that the method cannot be used for identifying whether a doped sample exists. The invention carries out experimental verification on a plurality of batches of ginseng, American ginseng, pseudo-ginseng and other closely related species, wherein the batches comprise roots, leaves, flowers, seeds and different types of medicinal materials, so that all ginseng, pseudo-ginseng and American ginseng obtain correct positive identification results, and other ginseng closely related species are negative and completely coincide with morphological identification results, thereby further verifying the reliability and stability of the invention. In order to detect the discrimination capability of the method on the mixed counterfeit products, a series of mixed samples of ginseng, American ginseng and pseudo-ginseng with different adulteration degrees are prepared and subjected to multiple PCR amplification, and the result shows that the detection limit of mutual adulteration of any two of ginseng, American ginseng and pseudo-ginseng reaches 1 percent, thereby meeting the requirement of production inspection of traditional Chinese medicines. The invention can be used for identifying roots, rhizomes, leaves, flowers and fruits of ginseng, American ginseng and pseudo-ginseng and processed products thereof.
Drawings
Fig. 1 shows the annealing temperature optimization experiment results. Wherein, each temperature lane 1 and lane 2 is an American ginseng sample (the serial numbers in Table 1 are 16 and 17); lanes 3 and 4 are panax notoginseng samples ( numbers 10, 11 in table 1); lanes 5 and 6 are ginseng samples ( numbers 1, 2 in table 1); lane M is DNA molecular weight standard: 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp are sequentially arranged from top to bottom.
FIG. 2 shows the results of the PCR identification method. Wherein lanes 1-7 are ginseng (numbers 1-7 in Table 1); lanes 8-13 are Notoginseng radix (numbers 10-15 in Table 1); lanes 14-20 are American ginseng (numbers 16, 17, 18, 19, 20 in Table 1); lane 21 is a ginseng, american ginseng, and panax notoginseng mixed sample (sample mix nos. 1, 10, and 16, the mass of the ginseng sample accounts for 1/3, the mass of the american ginseng sample accounts for 1/3, and the mass of the panax notoginseng sample accounts for 1/3); lane 22 shows the mixed sample of ginseng, american ginseng and panax notoginseng (sample numbers 1, 10 and 16 are mixed, the mass of the ginseng sample accounts for 49.75% of the mass of the mixed sample, the mass of the american ginseng sample accounts for 0.5% of the mass of the mixed sample, and the mass of the panax notoginseng sample accounts for 49.75% of the mass of the mixed sample); lane 23 shows a sample mixture of ginseng, american ginseng, and panax notoginseng (sample mixtures numbered 1, 10, and 16, the mass of the ginseng sample accounts for 0.5% of the mass of the sample mixture, the mass of the american ginseng sample accounts for 49.75% of the mass of the sample mixture, and the mass of the panax notoginseng sample accounts for 49.75% of the mass of the sample mixture); lane 24 is a blank control with water as template; lane M is DNA molecular weight standard: 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp are sequentially arranged from top to bottom.
FIG. 3 shows PCR identification limit of samples containing radix Ginseng, radix Notoginseng, and radix Panacis Quinquefolii. Wherein, lane 1 is ginseng; lane 9 is Notoginseng radix; lane 17 is american ginseng; lanes 2-8, lanes 10-16, and lanes 18-24 are mixed samples of ginseng, notoginseng, and gen-seng mixed at different mass ratios, and the mass percentages of ginseng, notoginseng, and gen-seng in the mixed samples are: lane 2 (50%, 12.5%), lane 3 (80%, 10%), lane 4 (90%, 5%), lane 5 (95%, 2.5%), lane 6 (98%, 1%), lane 7 (99%, 0.5%), lane 8 (0%, 50%), lane 10 (12.5%, 50%, 12.5%), lane 11 (10%, 80%, 10%), lane 12 (5%, 90%, 5%), lane 13 (2.5%, 95%, 2.5%), lane 14 (1%, 98%, 1%), lane 15 (0.5%, 99%, 0.5%), lane 16 (50%, 0%, 50%), lane 18 (12.5%), 12.5%, 50%), lane 19 (10%, 80%), lane 20 (5%, 90%), 21 (2.5%, 95%), lane 22 (1% >), 1%, 98%), lane 23 (0.5%, 99%), lane 24 (50%, 0%); lane M is DNA molecular weight standard: 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp are sequentially arranged from top to bottom.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, each primer was added to the PCR reaction system as a primer solution, and the initial concentration of each primer in the primer solution was 5. mu.M.
10 × buffer: takara corporation, catalog number: a 1101E.
SpeedStar HS Taq DNA polymerase: takara, 5U/. mu.L, catalog No.: RR 070A.
100 × SYBR Green I: invitrogen corporation, catalog No.: 1135054.
ginseng: reference documents: zhangyuan. the latest progress of ginseng research [ J ]. proceedings of jiangsu university, medical edition, 2009, 19 (3): 185, 191; the public is available from the institute of traditional Chinese medicine of the Chinese academy of sciences.
American ginseng: reference documents: wang junmer, the latest progress of the pharmacological action research of american ginseng [ J ] pharmacology and clinics of traditional Chinese medicine, 2001, 13 (4): 46-48.; the public is available from the institute of traditional Chinese medicine of the Chinese academy of sciences.
Pseudo-ginseng: reference documents: new progress in pharmacological research on yangxinggang, chenajin, Shusondong, notoginseng [ J ]. Shanghai J.Med.2005, 39 (4): 59-62.; the public is available from the institute of traditional Chinese medicine of the Chinese academy of sciences.
Rhizoma Panacis Japonici: reference documents: study progress on chemical composition and pharmacological activity of yuanyin, panax japonicus [ J ]. current chinese and medicinal herbs, 2005, 16 (9): 838 and 839; the public is available from the institute of traditional Chinese medicine of the Chinese academy of sciences.
Ginseng, rhizoma panacis majoris: reference documents: zhaoyanzi, Zhaoyai, Lidongming, etc. pearl ginseng research progress [ J ] Chinese modern traditional medicine, 2008, 10 (7): 3-6.; the public is available from the institute of traditional Chinese medicine of the Chinese academy of sciences.
Leaf of feather notoginseng: reference documents: zhaoyanyi, Zhaoyanren, Shanchongxiang, etc. analysis of plant traits and growth dynamics of Panax notoginseng (J) proceedings of Yunnan college of traditional Chinese medicine 2012, 35 (2): 24-27.; the public is available from the institute of traditional Chinese medicine of the Chinese academy of sciences.
The Panax plant material and its sources in the following examples are shown in Table 1. The samples in table 1 all meet the relevant regulations under each medicinal material item in the text of the Chinese pharmacopoeia (2015 edition). Through identification, the sample object of each taste accords with the name, and the quality accords with the standard. All plant materials are dried under reduced pressure and then crushed by a ball mill crusher to be sieved by a No. five sieve, and plant material powder is obtained for detection.
TABLE 1 Panax plant material Source Table
Example 1 primer design
A large number of sequence analyses were performed on the genomes of various Panax species, resulting in several primers for identifying Panax ginseng, Panax notoginseng and Panax quinquefolium. And performing a pre-experiment on each primer, and comparing the performances of sensitivity, specificity and the like to finally obtain three sets of primer pairs for identifying ginseng, pseudo-ginseng and American ginseng.
The primer pair (primer pair I) for identifying ginseng was composed of primer F1 and primer F2 (5 '→ 3'):
f1 (SEQ ID NO: 1 of the sequence Listing): TAACAATACCGGGCTGATAC, respectively;
f2 (SEQ ID NO: 2 of the sequence Listing): CCAGTTAAGGACAGGAG, respectively;
the primer pair (primer pair II) for identifying notoginseng consists of primer F3 and primer F4 (5 '→ 3'):
f3 (SEQ ID NO: 3 of the sequence Listing): AGGGATGAGGGGTGCGTAG, respectively;
f4 (SEQ ID NO: 4 of the sequence Listing): CGACATGAGAAGAGGGCTTTTA, respectively;
the primer pair (primer pair III) for identifying american ginseng consists of primer F5 and primer F6 (5 '→ 3'):
f5 (SEQ ID NO: 5 of the sequence Listing): AAATGCGGGTTATGACAAA, respectively;
f6 (SEQ ID NO: 6 of the sequence Listing): TTCTGCATATACGCCCAAATT are provided.
The primer pair I, the primer pair II and the primer pair III form a primer combination.
Example 2 identification method optimization
First, annealing temperature optimization
The sample to be tested is: ginseng (nos. 1 and 2 in table 1), notoginseng (nos. 10 and 11 in table 1), and american ginseng (nos. 16 and 17 in table 1).
1. And extracting the genome DNA of the sample to be detected.
2. The genomic DNA obtained in step 1 was used as a template, and PCR amplification was performed using the primer set prepared in example 1.
PCR amplification System (25. mu.L): 2.5. mu.L of 10 XBuffer buffer, 1.6. mu.L of dNTP (2.5mM), 0.4. mu.L of primer F1, 0.4. mu.L of primer F2, 0.4. mu.L of primer F3, 0.4. mu.L of primer F4, 0.4. mu.L of primer F5, 0.4. mu.L of primer F6, 0.2. mu.L of LSpeedStar HS Taq DNA polymerase, 2. mu.L of template (10 ng DNA content), 16.3. mu.L of sterile double distilled water.
PCR reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing for 10s, and extension at 72 ℃ for 20s for 35 cycles; extension at 72 ℃ for 3 min.
The following annealing temperatures were set, respectively:
annealing temperature I: 59 ℃;
annealing temperature II: 60 ℃;
annealing temperature III: 61 ℃;
annealing temperature IV: at 62 ℃.
3. And (3) carrying out 1.5% agarose gel electrophoresis on the amplification product obtained in the step (2).
The results are shown in FIG. 1. The result shows that specific bands with the sizes of about 247bp, 492bp and 1088bp appear in the ginseng, the pseudo-ginseng and the American ginseng respectively when the annealing temperature is 60-62 ℃, non-specific amplification and false positive bands do not appear, but the brightness of the specific bands of the ginseng and the pseudo-ginseng is obviously reduced when the annealing temperature is more than 61 ℃, so that the optimal annealing temperature of PCR is determined to be 60 ℃.
Second, optimizing the primer dosage
The sample to be tested is: ginseng (nos. 1 and 2 in table 1), notoginseng (nos. 10 and 11 in table 1), and american ginseng (nos. 16 and 17 in table 1).
1. And extracting the genome DNA of the sample to be detected.
2. The genomic DNA obtained in step 1 was used as a template, and PCR amplification was performed using the primer set prepared in example 1.
PCR amplification System (25. mu.L): mu.L of 10 XBuffer buffer, 1.6. mu.L of dNTP (2.5mM), primer F1, primer F2, primer F3, primer F4, primer F5, primer F6, 0.2. mu.L of SpeedStar HS Taq DNA polymerase, 2. mu.L of template (10 ng DNA content), sterile double distilled water to 25. mu.L.
PCR reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 20s for 35 cycles; extension at 72 ℃ for 3 min.
Different amounts of primers were set. Setting method as shown in table 2, 64 treatment groups were set in accordance with 3 factors (F1, F2 addition amount, F3, F4 addition amount, F5, F6 addition amount) shown in table 2.
TABLE 2 primer addition
F1, F2 addition amount (mu L)
|
F3, F4 addition amount (mu L)
|
F5, F62 addition amount (mu L)
|
0.1
|
0.1
|
0.1
|
0.2
|
0.2
|
0.15
|
0.3
|
0.3
|
0.2
|
0.4
|
0.4
|
0.25 |
3. And (3) carrying out 1.5% agarose gel electrophoresis on the amplification product obtained in the step (2).
As a result, the optimal amounts of primers added were 0.3. mu.L for F1 and F2, 0.2. mu.L for F3 and F4, and 0.25. mu.L for F5 and F6.
Example 3 identification method establishment
Agarose gel electrophoresis method
1. And extracting the genome DNA of the sample to be detected.
2. The genomic DNA obtained in step 1 was used as a template, and the primer combination prepared in example 1 was used to perform PCR amplification, to obtain an amplification product.
PCR amplification System (25. mu.L): 2.5. mu.L of 10 XBuffer buffer, 1.6. mu.L of dNTP (2.5mM), 0.3. mu.L of primer F1, 0.3. mu.L of primer F2, 0.2. mu.L of primer F3, 0.2. mu.L of primer F4, 0.25. mu.L of primer F5, 0.25. mu.L of primer F6, 0.2. mu.L of LSpeedStar HS Taq DNA polymerase, 2. mu.L of template DNA, 17.2. mu.L of sterile double distilled water.
PCR reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 20s for 35 cycles; extension at 72 ℃ for 3 min.
3. And (3) carrying out 1.5% agarose gel electrophoresis on the amplification product obtained in the step (2), and judging according to the result as follows:
if the amplification product contains a 247bp DNA fragment, the sample to be detected contains ginseng, and if the amplification product does not contain the 247bp DNA fragment, the sample to be detected does not contain ginseng;
if the amplification product contains a 492bp DNA fragment, the sample to be detected contains pseudo-ginseng, and if the amplification product does not contain the 492bp DNA fragment, the sample to be detected does not contain pseudo-ginseng;
if the amplification product contains the DNA fragment of 1088bp, the sample to be detected contains American ginseng, and if the amplification product does not contain the DNA fragment of 1088bp, the sample to be detected does not contain American ginseng.
Second, fluorescent staining method
1. And extracting the genome DNA of the sample to be detected.
2. The genomic DNA obtained in step 1 was used as a template, and the primer combination prepared in example 1 was used to perform PCR amplification, to obtain an amplification product.
PCR amplification System (25. mu.L): 2.5. mu.L of 10 XBuffer buffer, 1.6. mu.L of dNTP (2.5mM), 0.3. mu.L of primer F1, 0.3. mu.L of primer F2, 0.2. mu.L of primer F3, 0.2. mu.L of primer F4, 0.25. mu.L of primer F5, 0.25. mu.L of primer F6, 0.2. mu.L of LSpeedStar HS Taq DNA polymerase, 2. mu.L of template DNA, 17.2. mu.L of sterile double distilled water.
PCR reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 20s for 35 cycles; extension at 72 ℃ for 3 min.
3. Adding 1 mu L of 100 XSSYBR Green I into the PCR amplification product obtained in the step 2, detecting fluorescence under 362nm ultraviolet wavelength, and judging according to the result as follows:
if the amplification product is added with 1 muL of 100 SYBR Green I and then the detection can generate Green fluorescence, the sample to be detected contains ginseng or pseudo-ginseng or American ginseng, and if the amplification product is added with 1 muL of 100 SYBR Green I and then the detection can not generate Green fluorescence, the sample to be detected does not contain ginseng, pseudo-ginseng or American ginseng.
Example 4 authentication method verification
A sample to be detected: panax plant material in Table 1.
The agarose gel electrophoresis method and the fluorescent staining method established in the embodiment 3 are respectively adopted to identify the sample to be detected, and the DNA content of the template in the PCR reaction system is 10 ng.
The results of the partial identification by agarose gel electrophoresis are shown in FIG. 2. The 247bp bands of interest from lanes 1-7 of FIG. 1 were sequenced, and the sequence results are shown in SEQ ID No. 7. The 492bp bands of interest in lanes 8-13 of FIG. 1 were sequenced, and the sequencing results are shown in SEQ ID No. 8. The target band of 1088bp from lanes 14-20 of FIG. 1 was sequenced, and the sequencing results are shown as sequence 9. The pooled samples all yielded three bands of interest of 247bp, 492bp and 1088 bp. No bands were obtained for the remaining samples (Panax japonicus, Panax japonicus and Panax notoginseng). The result shows that the result of the identification by the agarose gel electrophoresis method is consistent with the actual situation, and the detection accuracy is up to 100%.
The results of the identification by adopting the fluorescent staining method are all consistent with the actual conditions, and the detection accuracy is up to 100%.
In summary, the agarose gel electrophoresis method and the fluorescent staining method established in example 3 can be used to successfully identify three Panax plant materials, namely, Panax ginseng, Panax notoginseng and Panax quinquefolium.
Example 5 sensitivity
The samples to be tested were: in table 1, the ginseng sample No. 1, the panax notoginseng sample No. 5, and the panax quinquefolius sample No. 16 are shown.
1. Extracting genome DNA of a sample to be detected to obtain a DNA solution;
2. by ddH2Diluting the DNA solution obtained in the step 1 to obtain each diluent;
3. taking each diluent obtained in the step 2 as a template, and identifying by adopting the primer combination prepared in the example 1 according to the agarose gel electrophoresis method and the fluorescent staining method in the example 3 respectively;
due to different dilution degrees of the adopted diluents, different reaction systems are formed as follows:
in the reaction system 1, the initial content of the genomic DNA of the sample to be detected is as follows: 20 ng;
in the reaction system 2, the initial content of the genomic DNA of the sample to be detected is as follows: 4 ng;
in the reaction system 3, the initial content of the genomic DNA of the sample to be detected is as follows: 0.8 ng;
in the reaction system 4, the initial content of the genomic DNA of the sample to be detected is as follows: 0.16 ng;
in the reaction system 5, the initial content of the genomic DNA of the sample to be detected is as follows: 0.032 ng.
The results show that when the minimum content of the template DNA is 0.032ng, the agarose gel electrophoresis method and the fluorescent staining method established in the example 3 can be used for successfully identifying the three panax plant materials of ginseng, panax notoginseng and panax quinquefolium.
Example 6 limit of detection of adulteration
The sample to be tested is: ginseng (No. 1 in table 1), notoginseng (No. 10 in table 1), and american ginseng (No. 16 in table 1).
1. And mixing the sample powder to be detected according to different mass ratios to obtain a mixed sample.
2. And (3) taking a sample to be detected and the mixed sample obtained in the step (1), and extracting genome DNA to obtain a DNA solution.
3. The DNA solutions obtained in step 2 were identified by agarose gel electrophoresis methods established in example 3, respectively, and the DNA content of the template in the PCR reaction system was 10 ng.
The results are shown in FIG. 3. The result shows that when the adulteration mixed sample is identified by using the method, the ginseng can be detected when the mass of the ginseng accounts for more than 0.5 percent of the mass of the mixed sample, the pseudo-ginseng can be detected when the mass of the pseudo-ginseng accounts for more than 1 percent of the mass of the mixed sample, and the American ginseng can be detected when the mass of the American ginseng accounts for more than 0.5 percent of the mass of the mixed sample.
The result is combined to show that the detection limit of the mutual adulteration of any two of the ginseng, the American ginseng and the pseudo-ginseng by using the method of the invention reaches 1 percent.
<110> institute of traditional Chinese medicine of Chinese academy of traditional Chinese medicine
<120> a primer combination for simultaneously identifying traditional Chinese medicines of ginseng, American ginseng and pseudo-ginseng and application thereof
<160>9
<210>1
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>1
taacaatacc gggctgatac 20
<210>2
<211>17
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>2
ccagttaagg acaggag 17
<210>3
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>3
agggatgagg ggtgcgtag 19
<210>4
<211>22
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>4
cgacatgaga agagggcttt ta 22
<210>5
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>5
aaatgcgggt tatgacaaa 19
<210>6
<211>21
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>6
ttctgcatat acgcccaaat t 21
<210>7
<211>247
<212>DNA
<213> Ginseng radix (Panax ginseng C.A. Mey.)
<400>7
taacaatacc gggctgatac agtctggtaa ttggaatgag tacaatctaa atcccttaac 60
gaggatccat tggagggcaa gtctggtgcc agcagccgcg gtaattccag ctccaatagc 120
gtatatttaa gttgttgcag ttaaaaagct cgtagttgga ctttgggttg ggtcggccgg 180
tccgcctctc ggtgtgcacc gatcgtctcg tcccttctgc cggcgatgcg ctcctgtcct 240
taactgg 247
<210>8
<211>492
<212>DNA
<213> Panax notoginseng (Burk.) F.H.Chen)
<400>8
agggatgagg ggtgcgtagg ctccccaagt tgcaaaccca tggtcgggga ccgcccttgg 60
gtggccctcg tccgaacaac gaccccccgg cgcggaatgc gccaaggaaa tcaaattgaa 120
cygcacgcgt cccccccgtt tgcgggcggc ggaagcgtct ttctaaaaca caaacgactc 180
tcggcaacgg atatctcggc tctcgcatcg atgaagaacg tagcgaaatg cgatacttgg 240
tgtgaattgc agaatcccgt gaatcatcga gtctttgaac gcaagttgcg cccgaagcca 300
ttaggccgag ggcacgtctg cctgggcgtc acgcatcgcg tcgcccccca acccatcatt 360
ccctcgcggg agtcgatgcg gaggggcgga taatggcctc ccgtgtctca ccgcgcggtt 420
ggcccaaatg cgagtccttg gcgatggacg tcacgacaag tggtggttgt taaaagccct 480
cttctcatgt cg 492
<210>9
<211>1088
<212>DNA
<213> American ginseng (Panax quinquefolius L.)
<400>9
aaatgcgggt tatgacaaaa aattcagttt actaattgtg aaacgtttaa ttgctcgaat 60
gtatcaacag aatcatttga ttctttctac taatgattct aaccaaaata gatttttgag 120
gcgcaacaag aatttgtatt ctcaaatgat atcagagggg tttgcagtca ttgtggaaat 180
tccattttat ctacaattaa aatcttccct agaaagcaaa gggatagtca aatctcataa 240
tttacgatca attcattcaa tatttccttt tttagaggac aaaatttcac atttaattta 300
tggtttagag atactaatac cctacccagt ccatctggaa atcttggttc aaactcttcg 360
ctactgggta aaagatgctt cttctttgca tttattacga ttctttctcc acgagtattg 420
taattggaat actccaaata aagccggttc ttctttttca aaaagaaatc aaagactatt 480
cttcttacta tataattctc atctatgtga atacgaatcc atcttcatct ttctccgtaa 540
ccaatcttct catttacgct caacatcttc tggaaccctt cttgaacgaa tctatttcta 600
tggaaaaata aaatatcttg taaaagtctt tgttaaggct tttcaagtca atctattgtt 660
gttgaaggat cctttcatgc attatgttag gtatcaagga aaatcaattc tcgcttcaaa 720
agggacgccc tttttgatga aaaaatggac atattacttt gttaatttat ggcaatgtca 780
tttttacctg tggtctcaac cgggaaggat ctgtataaac caattataca atcattccct 840
cgacattctg ggctatctat caagtgcgcg gctaaaccct tcaatggtac gcggtcaaat 900
gctagaaaat tcatttctaa ttgataatgc tattaataag ttcgatgcta ttgttccaat 960
tattcctctg attggatcat tggctaaagc gaaattttgt aacgtattgg ggcatcctat 1020
tagtaaggcg gtttggaccg atttatcaga ttctgatatt attgaccaat ttgggcgtat 1080
atgcagaa 1088