KR101494610B1 - Specific SCAR marker for discriminating novel Korean Zoysia japonica 'Jangseongsaetbyul' and uses thereof - Google Patents

Abstract

The present invention relates to a specific SCAR marker for identifying a new turf variety of Korean turfgrass, and its use. Through the specific SCAR marker of the present invention, efficient breeding identification, breeding protection and purity testing of one turfgrass are carried out It is possible. In addition, it can be applied very usefully in molecular breeding research and grass breeding industry of Jangseong morning varieties of high quality Korean turfgrass with high growth rate, fast growing speed, high density and short length of maddel.

Description

Specific SCAR Markers for Identification of New Lawn New Varieties and Their Uses (Specific SCAR Marker for Discriminating Pseudomonas Korean Zoysia japonica 'Jangseongsaetbyul' and uses thereof)

The present invention relates to a specific SCAR marker for distinguishing a new turf variety from Korean grass varieties and a use thereof. More particularly, the present invention relates to a novel SCAR marker having a nucleotide sequence of SEQ ID NO: 2 from Zoysia japonica ), a SCAR primer set for amplifying the markers, a kit for sorting varieties including the SCAR primer set, and a method for sorting varieties using the SCAR primer set .

Korean grass is a perennial herbaceous plant, and it grows with apricot and undergrowth, and shows many variations in shape and characteristics depending on the region. Research so far has deuljandi Korea (Zoysia It has been reported that five to six species of grasses are distributed, such as japonica , Z. matrella , Z. tenufolia , Z. sinica and Z. macrostachya . Korean grass is a turf grass which is widely grown in Korea and Far East Asia. It is used in almost all places such as garden, park, stadium, golf course, road slope, reclaimed land and airport. Especially, Korean lawn is the most suitable grass for the climate of Korea, and it is more environment adaptable than Hanji lawn grass and other turf grass. Especially, it is known that it is resistant to weather resistance, resistance to pressure, cold resistance, resistance to intumescence and salt resistance. However, since the grass composition is late and the green period is short, superior breeding breeding is required to overcome this. The new turfgrass varieties of the present invention were selected as a high-quality strain with high growth rate, high density and high madding length (Korean Journal of Turfgrass Science, 26 (1): 1-7, 2012). Due to recent advances in molecular biology, methods for sorting varieties of specific plants using marker systems have been widely used.

The Random Amplified Polymorphic DNA (RAPD) marker is the first PCR-based marker. It is a marker that amplifies the amplified DNA by amplifying the portion of the genomic DNA that matches the primer consisting of about 10 mer by PCR. Unlike RFLP (Restriction Fragment Length Polymorphism) markers, the amount of amplified DNA is sufficient, so that it does not require radioactive isotopes or chemically labeled probes. Instead, ethidium bromide is treated on a separate gel to hybridize ) It is a technology that can analyze DNA mutation without process.

Sequence Chracterized Amplified Region (SCAR) markers are produced by analyzing the nucleotide sequences of amplified bands using RAPD or AFLP (Amplification Fragment Length Polymorphism) markers, and can be used as more accurate and detailed primers. Therefore, SCAR markers are publicly available markers that are not affected by the environment of the institute as compared to other PCR markers. The cleaved amplified polymorphic sequence (CAPS) is a method to view the polymorphism of a nucleotide sequence using restriction enzymes. SCAR molecular markers are relatively insensitive to the amplification environment and can be converted into co-dominant markers rich in genetic information, and have the advantage that they are not affected by introns during the production process, as compared to RAPD molecular markers.

Korean Patent No. 0977045 discloses 'Dragon Sky specific molecular genetic marker' in Korea, and Korean Patent No. 0363723 discloses 'New grass varieties Beneswon and Dongraagong special STS markers'. However, the specific SCAR markers for distinguishing the new turfgrass varieties in Korea as described in the present invention and their uses have not been disclosed.

The present invention has been made in view of the above-mentioned needs. In the present invention, in order to protect a high-quality Korean turfgrass variety, RAPD analysis, a variety-specific nucleotide sequence is analyzed, and based on the nucleotide sequence, The present inventors have completed the present invention by developing a SCAR primer useful for identification and breed protection.

In order to solve the above-mentioned problems, the present invention provides a method for screening a Korean lawn cultivar comprising the nucleotide sequence of SEQ ID NO: 2 from Zoysia japonica ) varieties.

The present invention also provides a SCAR primer set for amplifying the marker.

In addition, the present invention provides a kit for sorting varieties from Korean cultivated Korean lawn cultivars comprising the SCAR primer set.

In addition, the present invention provides a method for distinguishing varietal varieties from cultivated Korean grass varieties using the SCAR primer set.

Through the specific SCAR marker of the present invention, it is possible to effectively identify breeds, protect breeds, and test the purity of a single hybrid of the Korean turfgrass variety. In addition, it can be applied very usefully in molecular breeding research and grass breeding industry of Jangseong morning varieties of high quality Korean turfgrass with high growth rate, fast growing speed, high density and short length of maddel.

Fig. 1 shows RAPD analysis results of Korean lawns using RAPD primer (N8021 primer). M: DNA ladder, Ya: Yaji ( Zoysia japonica ), Si: Z. sinica , Ma: Z. matrella , Ju: Z. japonica , 6069: Z. japonica .
FIG. 2 is a diagram showing nucleotide sequence information of a specific band identified using a RAPD primer (N8021 primer).
FIG. 3 is a graph showing the results of PCR analysis using the SCAR molecular marker of the present invention. M: DNA ladder, Ya: Yaji ( Zoysia japonica ), Si: Z. sinica , Ma: Z. matrella , Ju: Z. japonica , 6069: Z. japonica .

In order to accomplish the object of the present invention, the present invention provides a method for screening a Korean lawn cultivar comprising the nucleotide sequence of SEQ ID NO: 2 from Zoysia japonica ) varieties.

In the marker of the present invention, the Zoysia japonica ) is a new type of Korean grass and collected as a genetic resource. It was selected as a high-quality strain with fast growth, high density, high density and short length of maddins (Korean Journal of Turfgrass Science, 26 1): 1-7, 2012). In addition, on Jan. 9, 2013, the variety varieties of Jangseongseok were applied for breeding protection. (Breed protection application number: 2013-4).

The marker may comprise the nucleotide sequence of SEQ ID NO: 2. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 2 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

The present invention also provides a SCAR primer set for amplifying the marker. The SCAR primer set Wall New Star (Zoysia while amplifying the marker from Korea cultivated grass varieties japonica ) varieties. Preferably, the oligonucleotides may be composed of the oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4.

In the SCAR primer set according to an embodiment of the present invention, the cultivated Korean grass cultivar can be Z. japonica , Z. sinica , Z. matrella or Z. japonica But is not limited thereto.

Wherein the SCAR primer comprises an oligonucleotide consisting of fragments of at least 16, at least 18, at least 19, at least 20, at least 21, at least 22 consecutive nucleotides in the sequence of SEQ ID NO: 3 to SEQ ID NO: 4 . In addition, the SCAR primer may also include addition, deletion or substitution of the nucleotide sequence of SEQ ID NO: 3 to SEQ ID NO: 4.

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

In the present invention, the " SCAR primer " is produced by analyzing the nucleotide sequence of RAPD (Random Amplified Polymorphic DNA) or AFLP (Amplification Fragment Length Polymorphism) marker bands. By using ASAP (Allele-Specific Associated Primer) It is used in a way to confirm. Because SCAR markers are relatively insensitive to amplification environments and can read results easily compared to other molecular markers, they are recognized as an efficient molecular markers for breed identification with reproducibility, universality and simplicity. That is, it can be used as a more accurate and detailed primer.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

In order to achieve still another object of the present invention,

A SCAR primer set according to the present invention; And a reagent for carrying out an amplification reaction. The present invention provides a kit for sorting Korean Lawngrass varieties from cultivated Korean grass varieties.

In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The manual includes instructions on the surface of the package including a brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In order to achieve still another object of the present invention,

(a) isolating genomic DNA from the lawn;

(b) performing amplification using the separated genomic DNA as a template and using the SCAR primer set according to the present invention to amplify the target sequence; And

and (c) detecting the amplification product. The present invention also provides a method for distinguishing Korean Lawn Mellitus varieties from cultivated Korean lawn varieties.

The method of the present invention comprises isolating genomic DNA from a lawn sample. A method known in the art may be used for separating the genomic DNA from the sample. For example, a CTAB method may be used, or a wizard prep kit (Promega) may be used. The target sequence can be amplified by performing amplification reaction using the separated genomic DNA as a template and using a SCAR primer set according to an embodiment of the present invention as a primer. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment of the present invention, the labeling substance may be a fluorescent, phosphorescent or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The SCAR primer set used to amplify the target sequence is as described above.

The method of the present invention comprises detecting said amplification product. The detection of the amplification product can be performed by, but not limited to, gel electrophoresis, capillary electrophoresis, DNA chip, radioactivity measurement, fluorescence measurement or phosphorescence measurement. As a method of detecting amplification products, gel electrophoresis can be performed, and gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis according to the size of the amplification product. In addition, capillary electrophoresis can be performed. Capillary electrophoresis, for example, can use the ABi Sequencer. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1. For the breeding classification of turfgrass mosque in Korea RAPD Marker  analysis

Korean grass was supposed to stop the current Great Wall with superior traits from Morning Star grass (Zoysia japonica) screening body of the grid and a positive control to collect genetic resources (Z. japonica), giant clam grass (Z. sinica), consider grass (Z. matrella and Z. japonica were extracted using the CTAB method. RAPD-PCR was performed using the RAPD primer (SEQ ID NO: 1) shown in Table 1 in order to develop the SCAR marker of the new turf variety of Korean turfgrass. The PCR reaction was first denatured at 94 ° C for 5 minutes, followed by denaturation at 94 ° C for 30 seconds, annealing at 36 ° C for 1 minute, and extension at 72 ° C for 2 minutes. Respectively. Finally, the PCR product was lengthened at 72 ° C for 7 minutes for stabilization.

A primer for RAPD analysis for developing the SCAR marker of the present invention Primer name Base sequence SEQ ID NO: 1 N8021 5'-AATCGGGCTG-3 '

The PCR products generated by the PCR reaction were electrophoresed on a 1.5% agarose gel at 100 V for 2 hours, and specific band patterns of each were confirmed as shown in FIG. As a result of the PCR reaction using N8021 (SEQ ID NO: 1), a specific band of about 600 bp amplified only in the new turfgrass species of Korean turfgrass was observed (FIG. 1).

Example  2. Species specific for the breeding of turfgrass plants in Korea SCAR Marker  making

The specific band identified by RAPD analysis was inserted into the TA-cloning vector after cleavage of the gel site at the band site. E. coli (DH5?) Was transformed at 42 占 폚 using a heat-shock method to confirm the base sequence of the specific band inserted into the vector. Escherichia coli was cultured on LB agar medium containing ampicillin for 15 hours at 37 DEG C to confirm the proliferation of transformed E. coli. PCR was performed using each of the colonies arbitrarily selected and the M13 primer contained in the vector to confirm whether or not the first RAPD specific band was inserted in the amplified E. coli colonies. The PCR conditions consisted of denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and extension at 72 ° C for 50 seconds. And finally lengthened at 72 ° C for 7 minutes to stabilize the PCR products. After completion of the PCR, electrophoresis using 1% agarose gel was used to confirm the insertion of a specific band. Three colonies of the E. coli colonies identified as having specific bands were selected, and then put into each liquid LB medium containing ampicillin. After shaking culture at 37 DEG C for 15 hours, the plasmid DNA contained in E. coli was extracted. The plasmid DNA thus extracted was subjected to base sequence analysis using a base sequence analyzer (ABI 3130XL). The M13 primer was used as a primer necessary for sequencing. As a result of the nucleotide sequence analysis, the 551 bp nucleotide sequence information (SEQ ID NO: 2) of the specific band confirmed in the RAPD result of the N8021 primer was confirmed as shown in FIG.

Based on the nucleotide sequence information obtained from the RAPD analysis, specific SCAR primers capable of discriminating between the P21_6069_600F (SEQ ID NO: 3) and the P21_6069_600R (SEQ ID NO: 4) were identified as shown in Table 2.

The SCAR primer Primer name Base sequence Product size SEQ ID NO: 3 P21_6069_600F AATCGGGCTGGCGGTGACCGGAG 551 bp SEQ ID NO: 4 P21_6069_600R AATCGGGCTGCTGAATGTGCATC

The pattern of specific band using SCAR primer was tested by PCR method. The PCR conditions were: denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, extension at 72 ° C for 40 seconds, And finally lengthened at 72 ° C for 7 minutes to stabilize the PCR products. After completion of the PCR, the result of the PCR reaction was confirmed by electrophoresis using 1% agarose gel. As a result, a specific band of about 600 bp, which is consistent with the result of RAPD analysis, was confirmed only in the new turf variety of Korean turfgrass (Fig. 3).

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Specific SCAR marker for discriminating novel Korean Zoysia          japonica 'Jangseongsaetbyul' and uses <130> PN13182 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 aatcgggctg 10 <210> 2 <211> 551 <212> DNA <213> Zoysia japonica <400> 2 aatcgggctg gcggtgaccg gagcgctctg ttgctgccat gcggcctcca gcttttgcag 60 catgctgaca atccgcgact cctggtaagg tttcagaata tagtcaaacg cctccagttc 120 gaaggcctca acggcatgct ctttccaggc ggtaacgaac acaataaacg gcttatgggc 180 aaactgattg atgttttgcg ccagcaagac gccgtccagc gaaggaatat taatatccag 240 aaaaatggcg tcgacccggt tatgctgcag aaatttcagc acgtccagcc catcgtcaaa 300 ggtacccaca atctccatct gcctgtgggt tttgatgagc caggtgagct cctgttgagc 360 cagaatttca tcttcaacga taatgacttt catattactc accctgaggt aacagtgatg 420 ccgtcgcatg aacaggggag cgttcattcg ggacgtaaaa agcgatttca gtgccgggtt 480 caagacggtg aatatgcagc ccatcgccgt agagcagctt gaccctgtga tgcacattca 540 gcagcccgat t 551 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 aatcgggctg gcggtgaccg gag 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 aatcgggctg ctgaatgtgc atc 23

Claims (8)

A marker for distinguishing the Zoysia japonica cultivars from cultivated Korean turfgrass cultivars comprising the nucleotide sequence of SEQ ID NO: 2. From the cultivar Korean grass varieties of claim 1, Zoysia japonica) SCAR (Sequence Chracterized Amplified Region ) a primer set for amplifying a marker to distinguish varieties. 3. A set of SCAR primers according to claim 2, characterized in that it consists of the oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4. The method according to claim 2, wherein the cultivated Korean grass varieties are selected from the group consisting of Zoysia japonica ), Zoysia sinica , Zoysia matrella ) or stop ( Zoysia japonica ). &lt; / RTI &gt; A SCAR primer set according to any one of claims 2 to 4; And a reagent for carrying out the amplification reaction. The present invention relates to a kit for distinguishing Korean grass varieties from cultivated Korean grass varieties. 6. The kit according to claim 5, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs and a buffer. (a) isolating genomic DNA from the lawn;
(b) performing the amplification reaction using the separated genomic DNA as a template and using the SCAR primer set according to any one of claims 2 to 4 to amplify the target sequence; And
(c) detecting the amplification product. A method for distinguishing Korean turfgrass varieties from cultivated Korean turfgrass varieties. 8. The method of claim 7, wherein the detection of the amplification product is performed by gel electrophoresis, capillary electrophoresis, DNA chip, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images