KR101444237B1 - 배추과 세균병균 검출용 프라이머 세트 - Google Patents
배추과 세균병균 검출용 프라이머 세트 Download PDFInfo
- Publication number
- KR101444237B1 KR101444237B1 KR1020110124590A KR20110124590A KR101444237B1 KR 101444237 B1 KR101444237 B1 KR 101444237B1 KR 1020110124590 A KR1020110124590 A KR 1020110124590A KR 20110124590 A KR20110124590 A KR 20110124590A KR 101444237 B1 KR101444237 B1 KR 101444237B1
- Authority
- KR
- South Korea
- Prior art keywords
- xanthomonas campestris
- campestris
- cabbage
- primer set
- present
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/64—Xanthomonas
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 Xanthomonas campestris에 의한 배추과 세균병을 진단할 수 있는 종 특이성 프라이머에 관한 것으로, 보다 상세하게는 Xanthomonas campestris에 의한 배추과 세균병을 진단할 수 있는 프라이머 세트 및 이를 이용한 진단방법에 관한 것이다. 본 발명의 Xanthomonas campestris에 의한 배추과 세균병 진단용 프라이머 세트를 이용할 경우, Xanthomonas campestris에 의한 배추과 세균병을 진단할 수 있어, 상기 박테리아에 대한 진단법 보급으로 인한 진단 비용 및 노력 절감 효과가 있으며, 이로부터 배추과 세균병균(Xanthomonas campestris) 으로 인해 농업 현장에서 발생하는 문제를 해결하고, 양질의 배추과 작물 품종 육종에 기여할 수 있다.
Description
본 발명은 Xanthomonas campestris에 의한 배추과 세균병을 진단할 수 있는 종 특이성 프라이머에 관한 것으로, 보다 상세하게는 Xanthomonas campestris에 의한 배추과 세균병을 진단할 수 있는 프라이머 세트 및 이를 이용한 진단방법에 관한 것이다.
박테리아 진단법으로 과거에는 전자현미경과 혈청학적 방법(ELISA)을 주로 사용하였다. 전자현미경을 이용한 방법은 박테리아의 존재를 확인할 수는 있지만 형태적 특징으로 종을 진단하기는 불가능하다. 혈청학적 방법 중 효소 결합 면역흡수 검정법(enzyme linked immunosorbent assay ; ELISA)은 가장 일반적으로 사용하여온 진단방법이나 PCR 진단법보다 검출감도가 약 1000배 정도 낮으며, 항체와 검사시료의 예상하지 못한 비 특이적 반응으로 진단에 실패하는 경우가 종종 발생한다.
따라서 현재 박테리아의 진단에서는 높은 검출감도와 편리성을 가지고 있는 PCR 방법을 가장 일반적으로 사용되고 있다. 병원체의 PCR 진단을 위한 프라이머의 개발에 있어 중요한 점은, 첫째 박테리아 종 내에 존재하는 모든 계통 및 분리주를 검출 할 수 있어야 한다는 것이다. 이를 위하여 검출 대상 박테리아 종의 모든 계통 및 분리주에 있어서 공통되는 염기서열을 대상으로 프라이머를 설계하여야 한다. 둘째, 상이한 종 간에는 특이성이 있어야 한다는 것이다. 이를 위하여 검출 대상 박테리아 종과 유연관계가 있는 다른 박테리아가 가지고 있는 염기서열에는 반응하지 않는 프라이머를 설계하여야 한다.
배추과에는 박테리아가 존재하며, 그 중 대표적인 것으로 , 배추과 세균병균(Xanthomonas campestris)이 있다. 그러나 아직까지 상기 박테리아를 진단할 수 있는 프라이머의 조합은 보고된 바 없다.
이에 본 발명의 발명자들은 배추과에서 발생하는 박테리아 병의 진단을 위한 프라이머를 연구하던 중, 배추과에서 발생하는 대표적인 박테리아인 Xanthomonas campestris에 의한 배추과 세균병을 진단할 수 있는 프라이머 세트에 관한 본 발명을 완성하였다.
따라서 본 발명의 목적은, 서열번호 1 및 서열번호 2로 표시되는 염기서열을 가지는 배추과 세균병균(Xanthomonas campestris) 검출용 프라이머 세트를 제공하는 것이다.
본 발명의 다른 목적은, (a) 시료로부터 박테리아의 DNA를 분리하는 단계; (b) 상기 DNA를 주형으로 상기 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및 (c) 상기 PCR 산물을 크기별로 분리하는 단계를 포함하는 차나무세균궤양병을 진단 하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은, (a) 시료로부터 박테리아의 DNA를 분리하는 단계; (b) 상기 DNA를 주형으로 상기 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및 (c) 상기 PCR 산물을 크기별로 분리하는 단계를 포함하는 배추과 세균병균(Xanthomonas campestris)을 검출 하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은, 본 발명의 프라이머 세트를 포함하는 배추과 세균병균(Xanthomonas campestris) 검출용 키트를 제공하는 것이다.
상기와 같은 목적을 달성하기 위하여 본 발명은 서열번호 1 및 서열번호 2로 표시되는 염기서열을 가지는 배추과 세균병균(Xanthomonas campestris) 검출용 프라이머 세트를 제공한다.
본 발명의 다른 목적을 달성하기 위하여 본 발명은 (a) 시료로부터 박테리아의 DNA를 분리하는 단계; (b) 상기 DNA를 주형으로 상기 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및 (c) 상기 PCR 산물을 크기별로 분리하는 단계를 포함하는 Xanthomonas campestris에 의한 배추과 세균병을 진단 하는 방법을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여 본 발명은 (a) 시료로부터 박테리아의 DNA를 분리하는 단계; (b) 상기 DNA를 주형으로 상기 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및 (c) 상기 PCR 산물을 크기별로 분리하는 단계를 포함하는 배추과 세균병균(Xanthomonas campestris)을 검출 하는 방법을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여 본 발명은 본 발명의 프라이머 세트를 포함하는 배추과 세균병균(Xanthomonas campestris) 검출용 키트를 제공한다.
이하, 본 발명을 상세히 설명한다.
본 발명은 Xanthomonas campestris에 의한 배추과 세균병 진단용 프라이머 세트에 관한 것이다.
즉, 본 발명은 Xanthomonas속 세균의 23S rRNA 유전자를 비교하여 배추과 세균병균(Xanthomonas campestris) 특이적 primer를 선발하였다.
본 발명의 프라이머 쌍은 Xan23S-F35(서열번호 1; TCCTCTACCGCGCATAAAACCG), Xan23S-R27(서열번호 2; CAGTATCTTGCAGTGAATTCATAGCTGCTT)이며, 배추과 세균병균(Xanthomonas campestris)만을 특이적으로 검출하는 특징이 있다.
본 발명의 프라이머 세트를 이용하여 진단할 수 있는 박테리아는 배추과 세균병균(Xanthomonas campestris)이다. 보다 구체적으로 진단가능한 박테리아는 Xanthomonas campestris pv. campestris, Xanthomonas campestris pv. incanae, Xanthomonas campestris pv. raphani, Xanthomonas campestris pv. armoracieae, Xanthomonas campestris pv. barbareae, Xanthomonas campestris pv. aberrans일 수 있다.
한편, 본 발명은,
(a) 시료로부터 박테리아의 DNA를 분리하는 단계;
(b) 상기 DNA를 주형으로 상기 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및
(c) 상기 PCR 산물을 크기별로 분리하는 단계를 포함하는 Xanthomonas campestris에 의한 배추과 세균병 진단 방법을 제공한다.
상기 (a) 단계에서 DNA의 추출은 당업계에서 통상적으로 사용되는 방법에 따라 수행될 수 있으며, 상업적으로 판매되는 DNA 추출 키트를 이용하여 수행할 수 있다.
상기 (b) 단계에서 PCR은 분리된 DNA를 주형으로 하고, 본 발명의 프라이머쌍이 효소를 이용하여 상보적 DNA 가닥을 합성하여 PCR 반응을 수행한다. PCR 반응은 PCR 반응에 필요한 당업계에 공지된 여러 성분을 포함하는 PCR 반응 혼합액을 이용하여 수행될 수 있다. 상기 PCR 반응 혼합액에는 역전사 반응에 의해서 합성된 상보적 DNA와 본 발명에서 제공되는 PCR 프라이머 세트 이외에 적당량의 DNA 중합효소, dNTP, PCR 완충용액 및 물(dH2O)을 포함한다. 상기 PCR 완충용액은 트리스-HCl(Tris-HCl), MgCl2, KCl 등을 포함한다. 본 발명의 프라이머 세트는 상기 프라이머 조합 Ⅰ 또는 상기 프라이머 조합 Ⅰ 및 Ⅱ를 동시에 포함하는 프라이머 세트일 수 있다. 또한, 이 때 MgCl2 농도는 증폭의 특이성과 수량에 크게 영향을 준다. 일반적으로 Mg2 +가 과량인 경우는 비특이적인 PCR 증폭산물이 증가하고, Mg2 +가 부족한 경우 PCR 산물의 산출율이 감소한다. 상기 PCR 완충용액에는 적당량의 트리톤 X-100(Triton X-100)이 추가로 포함될 수도 있다. 또한 PCR은 94 내지 95℃에서 주형 DNA를 전 변성시킨 후, 변성(denaturation); 결합(annealing); 및 증폭(extension)의 사이클을 거친 후, 최종적으로 72℃에서 연장(elongation)시키는 일반적인 PCR 반응 조건에서 수행될 수 있다. 상기에서 변성 및 증폭은 94 내지 95℃ 및 72℃에서 각각 수행될 수 있으며, 결합시의 온도는 프라이머의 종류에 따라 달라질 수 있으나, 바람직하게는 58 내지 68℃이며, 보다 바람직하게는 65℃이다. 각 단계의 시간과 싸이클 수는 당업계에 일반적으로 행해지는 조건에 따라 정해질 수 있다.
또한, 상기 (c) 단계에서는 당업계에서 널리 공지된 방법에 따라 PCR 산물을 크기별로 분리할 수 있다. 바람직하게는 아가로스 겔(agarose gel) 또는 폴리아크릴아미드 겔(polyacrylamide gel) 전기영동 또는 형광분석장치(ABI prism 3100 genetic analyzer-electropherogram)에 의해 확인할 수 있다. 이 때, 형광분석장치를 이용하기 위해서는 당업계에 공지된 형광 다이(dye)를 붙인 프라이머쌍을 이용하여 상기 (b)단계에서 PCR을 수행한다. PCR 증폭 결과는 바람직하게는 아가로스 겔 전기영동에 의해 확인할 수 있다. 전기영동 후 에디듐 브로마이드(ethidium bromide) 염색으로 전기영동 결과를 분석할 수 있다. 일반적인 역전사 반응, PCR 수행 및 그 결과 분석 방법에 대해서는 당업계에 잘 알려져 있다
아울러 본 발명은 본 발명의 프라이머 세트를 이용하여 배추과 세균병균(Xanthomonas campestris)을 검출하는 방법에 관한 것이다.
보다 구체적으로, 본 발명은,
(a) 시료로부터 박테리아의 DNA를 분리하는 단계;
(b) 상기 DNA를 주형으로 상기 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및
(c) 상기 PCR 산물을 크기별로 분리하는 단계를 포함하는 Xanthomonas campestris에 의한 배추과 세균병 진단 방법을 제공한다.
상기 (a) 단계 내지 (c) 단계는 상기 기재한 바와 동일하다.
아울러, 본 발명은 상기 프라이머 세트를 포함하는 Xanthomonas campestris에 의한 배추과 세균병 진단용 키트에 관한 것이다.
또한 이에 제한되지는 않으나, 상기 키트에는 상기 프라이머 세트 이외에 PCR을 용이하게 수행할 수 있기 위하여 DNA중합효소 및 상기 기재한 조성의 완충 용액 등을 추가로 포함할 수 있으며, PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성 성분들이 본 발명의 키트에 추가적으로 포함될 수 있다.
한편, 본 발명에서 사용된 표준 재조합 DNA 및 분자 클로닝 기술은 당해 분야에 널리 공지되어 있고, 다음 문헌에 기재되어 있다 (Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987)).
따라서, 본 발명의 Xanthomonas campestris에 의한 배추과 세균병 진단용 프라이머 세트를 이용할 경우, Xanthomonas campestris에 의한 배추과 세균병을 진단할 수 있어, 상기 박테리아에 대한 진단법 보급으로 인한 진단 비용 및 노력 절감 효과가 있으며, 이로부터 배추과 세균병균(Xanthomonas campestris) 으로 인해 농업 현장에서 발생하는 문제를 해결하고, 양질의 곡류 품종 육종에 기여할 수 있다.
도 1은 Xan23S-F35/Xan23S-R27 PCR primer의 특이성 조사 결과를 나타낸 것이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<
실시예
1>
배추과 세균병균(
Xanthomonas
campestris
) 의 선발
하기 실험 방법을 통하여, Xanthomonas속 세균에 대한 진단용 프라이머를 설계하였다. 본 발명에서 사용한 전체 DNA 분리 및 PCR 방법은 다음과 같다.
(1) 전체
DNA
분리
전체 DNA는 Qiagen 제품의 DNeasy Blood & Tissue Kit (Cat.No. 69504)을 이용하여 박테리아에서 DNA 분리 혹은 감염된 잎 조직 50㎎에서 분리한 후 최종적으로 증류수 50 ㎕에 녹인 다음 PCR 분석에 사용하였다.
(2)
PCR
PCR 반응은 분리한 전체 DNA 20 ng, 10 pmole 다운스트림 프라이머(downstream primer), 10 pmole 업스트림프라이머(upstream primer), 0.2 U Taq DNA polymerase, 10배 중합효소연쇄반응 완충액(100 mM Tris-HCl, 500 mM KCl, 15 mM MgCl2, pH 8.3) 5 ㎕를 첨가하고 증류수를 첨가하여 반응액을 50 ㎕로 만들었다.
이 반응액을 95℃ 30 초, 65℃ 60 초, 72℃ 180초로 30 회 증폭시켰으며 마지막에는 72℃에서 10 분간 처리하였다. PCR 산물은 1X TBE 완충액과 1.5 % 아가로즈 겔을 사용하여 전기영동한 후 ethidium bromide로 염색한 후 ultraviolet lamp에서 확인하였다.
<1-1>배추과 세균병균(
Xanthomonas
campestris
) 의 특이적인
PCR
primer
선발
배추과 세균병균(Xanthomonas campestris) 염기서열 탐색은 전체 염기서열을 기초로 하여 90가지 프라이머 조합을 설계하였다. 도 1에서 보듯이, 선발된 프라이머 조합을 이용하여 조사된 Xanthomonas 26종에 속하는 90 strains 중 본 PCR primer 조합은 배추과 세균병균(Xanthomonas campestris) 을 특이적으로 검출하였다. 프라이머 특이성 조사에 사용된 세균은 표 1과 같다.
균번호 | 병원균 이름 | 다른 균번호 | 기주 | 분리지역 | |
1 | 2591 | translucens pv.arrhenatheri | CFBP2056t | Arrhenatherum elatius | 스위스 |
2 | 2205 | alfalfae subsp.alfalfae | ICMP5718T | Medicago sativa | 인도 |
3 | 2935 | alfalfae subsp.citrumelonis | ICMP15808t | Citrus sp. | 미국 |
4 | 2616 | arboricola pv.celebennsis | CFBP3523t | Musa acuminata | 뉴질랜드 |
5 | 2579 | arboricola pv.corylina | CFBP1159t | Corylus maxima | 미국 |
6 | 2633 | arboricola pv.fragariae | CFBP6771t | Fragaria X ananassa | 이탈리아 |
7 | 608 | arboricola pv.juglandis | LMG747T | Jugans regia | 뉴질랜드 |
8 | 2673 | arboricola pv.poinsettiicola | ICMP6274t | Euphorbia pulcherrima | 뉴질랜드 |
9 | 2588 | translucens pv.graminis | CFBP2053t | Dactylisglomerata | 스위스 |
10 | 609 | arboricola pv.pruni | LMG852t | Prunus salicina | 뉴질랜드 |
11 | 610 | axonopodis pv.axonopodis | LMG982T | Axonopus scoparius | 콜롬비아 |
12 | 2523 | axonopodis pv.bauhiniae | ICMP5720t | Bauhinia racemosa | 인도 |
13 | 2600 | axonopodis pv.begoniae | CFBP2524t | Begonia sp. | 뉴질랜드 |
14 | 2634 | campestris pv. aberrans | CFBP6865t | Brassica oleracea L.var.capitataL . | 호주 |
15 | 2563 | axonopodis pv.cassavae | LMG8049 | Manihot esculenta | 니제르 |
16 | 2551 | axonopodis pv.cassiae | LMG675t | Cassia tora | 인도 |
17 | 2572 | axonopodis pv.clitoriae | LMG9045t | Clitoria biflara | 인도 |
18 | 2552 | axonopodis pv.coracanae | LMG686t | Eleusine coracana | 인도 |
19 | 2553 | axonopodis pv.cyamopsidis | LMG691t | Cyamopsistetragonolobus | 인도 |
20 | 2554 | axonopodis pv.desmodii | LMG692t | Desmodiumdichotomum | 인도 |
21 | 2612 | translucens pv.cerealis | CFBP2541t | Bromus inermis | 카나다 |
22 | 2573 | axonopodis pv.desmodiilaxiflori | LMG9046t | Desmodium laxiorum | 인도 |
23 | 2556 | axonopodis pv.desmodiirotundifolii | LMG694t | Desmodium styracifolium | 인도 |
24 | 2557 | axonopodis pv.dieffenbachiae | LMG695t | Anthurium sp. | 브라질 |
25 | 2558 | axonopodis pv.erythrinae | LMG698t | Erythrina variegata | 인도 |
26 | 2196 | axonopodis pv.glycines | ICMP5732t | Glycine max | 수단 |
27 | 2560 | axonopodis pv.lespedezae | LMG757t | Lespedeza sp. | 미국 |
28 | 2959 | axonopodis pv.manihotis | ICMP5741T | Glycine max | 수단 |
29 | 615 | axonopodis pv.nakataecorchori | LMG786t | Corchorus aestuans | 인도 |
30 | 2564 | axonopodis pv.patelii | LMG811t | Crotalaria juncea | 인도 |
31 | 2603 | axonopodis pv.phaseoli | CFBP2534t | Phaseolus vulgaris | 루마니아 |
32 | 2565 | axonopodis pv.phyllanthi | LMG844t | Phyllanthus niruri | 수단 |
33 | 2566 | axonopodis pv.physalidicola | LMG845t | Physalis alkekengi | 일본 |
34 | 2961 | axonopodis pv.poinsettiicola | ICMP5779T | Euphorbia pulcherrima | 인도 |
35 | 2562 | axonopodis pv.rhynchosiae | LMG8021t | Rhynchosia memnonia | 수단 |
36 | 2568 | axonopodis pv.ricini | LMG861t | Ricinus communis | 에티오피아 |
37 | 2522 | axonopodis pv.sesbaniae | ICMP367t | Sesbania sesban | Unknown |
38 | 2576 | axonopodis pv.tamarindi | LMG955t | Tamarindus indica | 인도 |
39 | 2962 | axonopodis pv.vasculorum | ICMP5757T | Saccharum officinarum | 모리셔스 |
40 | 2574 | axonopodis pv.vignaeradiatae | LMG936t | Vigna radiata | 수단 |
41 | 2570 | axonopodis pv.vignicola | LMG8752t | Vigna unguiculata | 미국 |
42 | 2610 | axonopodis pv.vitians | CFBP2538t | Lactuca sp. | 미국 |
43 | 618 | bromi | LMG947T | Bromus carinatus | 프랑스 |
44 | 2550 | axonopodis pv. cajani | LMG558t | Cajanus cajan | 인도 |
45 | 2204 | campestris pv. viticola | ICMP3867t | Vitis sp. | 인도 |
46 | 2936 | fuscans subsp.aurantifolii | ICMP15806t | Citrus limon | 아르헨티나 |
47 | 2937 | albilineans | ICMP196T | Saccharum officinarum | 피지 |
48 | 2559 | campestris pv.fici | LMG701t | Ficus religiosa | 인도 |
49 | 2621 | melonis | CFBP4644T | Cucumis melo | 브라질 |
50 | 2593 | translucens pv.phlei | CFBP2062t | Phleum pratense | 노르웨이 |
51 | 2611 | translucens pv.phleipratensis | CFBP2540t | Phleum pratense | 미국 |
52 | 2592 | translucens pv.poae | CFBP2057t | Poa trivialis | 스위스 |
53 | 2605 | translucens pv.secalis | CFBP2539t | Secale cereale | 카나다 |
54 | 2589 | translucens pv.translucens | CFBP2054T | Hordeum vulgare | 미국 |
55 | 2617 | campestris pv.armoracieae | CFBP3838t | Iberis sp. | 탄자니아 |
56 | 620 | cassavae | LMG673T | Manihot esculenta | 말라위 |
57 | 2934 | citrisubsp.citri | ICMP15804T | Citrus aurantiifolia | 미국 |
58 | 2958 | citri subsp.malvaceaerum | ICMP217T | Gossypium sp. | 미국 |
59 | 2622 | codiaei | CFBP4690T | Codiaeum variegatum | 미국 |
60 | 621 | cucurbitae | LMG690T | Cucurbita maxima | 뉴질랜드 |
61 | 2619 | cynarae | CFBP4188T | Cynara scolymus | 프랑스 |
62 | 2674 | euvesicatoria | ICMP109T | Capsicum frutescens | 미국 |
63 | 2598 | fragariae | CFBP2157T | Fragaria ananassa | 미국 |
64 | 2960 | fuscans pv.fuscans | ICMP239T | Phaseolus vulgaris | 카나다 |
65 | 2628 | campestris pv.barbareae | CFBP5825t | Barbarea vulgaris | 미국 |
66 | 2635 | gardneri | NCPPB88T | Lycopersicon esculentum | 유고 |
67 | 2625 | hortorum pv.carotae | CFBP4997t | Daucus carota var.sativa | 헝가리 |
68 | 2624 | hortorum pv.hederae | CFBP4925T | Hedera helix | 미국 |
69 | 2602 | hortorum pv.pelargonii | CFBP2533t | Pelargonium sp. | 뉴질랜드 |
70 | 2606 | hortorum pv.taraxaci | CFBP410t | Taraxacum kok-sahgyz | 미국 |
71 | 2575 | hortorum pv.vitians | LMG938 | Lactuca sativa | 짐바브와 |
72 | 622 | hyacinthi | LMG739T | Hyacinthus orientalis | 네덜란드 |
73 | 2601 | campestris pv.incanae | CFBP2527t | Matthiola sp. | 미국 |
74 | 2203 | oryzae pv.oryzae | ICMP3125T | Oryza sativa | 인도 |
75 | 623 | oryzae pv.oryzicola | LMG797t | Oryza sativa | 필리핀 |
76 | 2629 | campestris pv.raphani | CFBP5827t | Raphanus sativus | 미국 |
77 | 2200 | pisi | ICMP570T | Pisum sativum | 일본 |
78 | 2582 | populi | CFBP1817T | Populus x canadensis cv.Regenerata | 프랑스 |
79 | 625 | populi | LMG5743T | Populus canadensis | 프랑스 |
80 | 2620 | sacchari | CFBP4641T | Saccharum officinarum | 과들르프 |
81 | 2623 | theicola | CFBP4691T | Camellia sinensis | 일본 |
82 | 619 | campestris pv.campestris | LMG568T | Brassica oleracea var.gemmifera | 영국 |
83 | 2615 | arboricola pv.populi | CFBP3123t | Populus x canadensis cv.Robusta | 네덜란드 |
84 | 2963 | translucens pv.undulosa | ICMP5755T | Triticum sp. | 카나다 |
85 | 2549 | campestris pv.mori | ICMP13199t | Morus alba | 인도 |
86 | 2561 | campestris pv.nigromaculans | LMG787t | 일본 | |
87 | 2630 | campestris pv.paulliniae | CFBP5862t | Paullinia cupana var.sorbilis | 브라질 |
88 | 2636 | perforans | NCPPB4321T | Lycopersicon esculentum | 미국 |
89 | 2555 | axonopodis pv.desmodiigangetici | LMG693t | Desmodium gangeticum | 인도 |
90 | 2613 | vasicola pv.holcicola | CFBP2543T | Sorghum vulgare | 뉴질랜드 |
이상 살펴본 바와 같이 본 발명의 Xanthomonas campestris에 의한 배추과 세균병 진단용 프라이머 세트를 이용할 경우, Xanthomonas campestris에 의한 배추과 세균병을 진단할 수 있으며, 상기 박테리아에 대한 진단법 보급으로 인한 진단 비용 및 노력 절감 효과가 있으며, 이로부터 배추과 세균병균(Xanthomonas campestris)으로 인해 농업 현장에서 발생하는 문제 해결이 가능하다. 또한, 양질의 곡류 품종 육종에 기여할 수 있다.
<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION)
<120> Primer set for detection of Xanthomonas campestris
<130> NP11-0052
<160> 2
<170> KopatentIn 2.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Xan23S-F35
<400> 1
tcctctaccg cgcataaaac cg 22
<210> 2
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Xan23S-R27
<400> 2
cagtatcttg cagtgaattc atagctgctt 30
Claims (4)
- 서열번호 1 및 서열번호 2로 표시되는 염기서열을 가지는 Xanthomonas campestris pv. campestris, Xanthomonas campestris pv. incanae, Xanthomonas campestris pv. raphani, Xanthomonas campestris pv. armoracieae, Xanthomonas campestris pv. barbareae 및 Xanthomonas campestris pv. aberrans로 이루어진 배추과 세균병균(Xanthomonas campestris)의 병원성아종(pathovar)을 공통적으로 검출하는 배추과 세균병균 검출용 프라이머 세트.
- (a) 시료로부터 박테리아의 DNA를 분리하는 단계;
(b) 상기 DNA를 주형으로 제1항의 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및
(c) 상기 PCR 산물을 크기별로 분리하는 단계를 포함하는 Xanthomonas campestris pv. campestris, Xanthomonas campestris pv. incanae, Xanthomonas campestris pv. raphani, Xanthomonas campestris pv. armoracieae, Xanthomonas campestris pv. barbareae 및 Xanthomonas campestris pv. aberrans로 이루어진 군에서 선택된 어느 하나에 의한 배추과 세균병을 진단 하는 방법.
- (a) 시료로부터 박테리아의 DNA를 분리하는 단계;
(b) 상기 DNA를 주형으로 제1항의 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및
(c) 상기 PCR 산물을 크기별로 분리하는 단계를 포함하는 Xanthomonas campestris pv. campestris, Xanthomonas campestris pv. incanae, Xanthomonas campestris pv. raphani, Xanthomonas campestris pv. armoracieae, Xanthomonas campestris pv. barbareae 및 Xanthomonas campestris pv. aberrans로 이루어진 군에서 선택된 어느 하나의 배추과 세균병균을 검출 하는 방법.
- 제1항의 프라이머 세트를 포함하는 Xanthomonas campestris pv. campestris, Xanthomonas campestris pv. incanae, Xanthomonas campestris pv. raphani, Xanthomonas campestris pv. armoracieae, Xanthomonas campestris pv. barbareae 및 Xanthomonas campestris pv. aberrans로 이루어진 군에서 선택된 어느 하나의 배추과 세균병균 검출용 키트.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020110124590A KR101444237B1 (ko) | 2011-11-25 | 2011-11-25 | 배추과 세균병균 검출용 프라이머 세트 |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020110124590A KR101444237B1 (ko) | 2011-11-25 | 2011-11-25 | 배추과 세균병균 검출용 프라이머 세트 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20130058530A KR20130058530A (ko) | 2013-06-04 |
KR101444237B1 true KR101444237B1 (ko) | 2014-09-30 |
Family
ID=48857781
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020110124590A KR101444237B1 (ko) | 2011-11-25 | 2011-11-25 | 배추과 세균병균 검출용 프라이머 세트 |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101444237B1 (ko) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110076673A1 (en) * | 2006-09-07 | 2011-03-31 | Osterreichisches Rotes Kreuz Landesverband Oberosterreich | Detection of bacteria |
-
2011
- 2011-11-25 KR KR1020110124590A patent/KR101444237B1/ko active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110076673A1 (en) * | 2006-09-07 | 2011-03-31 | Osterreichisches Rotes Kreuz Landesverband Oberosterreich | Detection of bacteria |
Non-Patent Citations (2)
Title |
---|
GenBank Accession Number CP002789 (2011.09.20.) * |
GenBank Accession Number CP002789 (2011.09.20.)* |
Also Published As
Publication number | Publication date |
---|---|
KR20130058530A (ko) | 2013-06-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Cullen et al. | Conventional PCR and real-time quantitative PCR detection of Helminthosporium solani in soil and on potato tubers | |
Boudon et al. | Structure and origin of Xanthomonas arboricola pv. pruni populations causing bacterial spot of stone fruit trees in Western Europe | |
Peng et al. | Sensitive and direct detection of Heterodera filipjevi in soil and wheat roots by species-specific SCAR-PCR assays | |
WO2009030470A1 (de) | Verfahren zum nachweis von bakterien und pilzen | |
JPH08205900A (ja) | 酵母の凝集性判定用dna分子および凝集性判定方法 | |
Poussier et al. | Specific detection of biovars of Ralstonia solanacearum in plant tissues by nested-PCR-RFLP | |
DE69133590T2 (de) | Salmonella Genom Nukleinsäure, ihre Verwendung, besonders bei der in vitro Diagnose der Anwesenheit von Bakterien der Gattung Salmonella in Lebensmitteln | |
Messenberg Guimaraés et al. | Development of a PCR test for the detection of Curtobacterium flaccumfaciens pv. flaccumfaciens | |
Suzuki et al. | Studies in Phylogeny, Development of Rapid IdentificationMethods, Antifungal Susceptibility, and Growth Rates of Clinical Strains of Sporothrix schenckii Complex in Japan | |
Aritua et al. | Rep-PCR reveals a high genetic homogeneity among Ugandan isolates of Xanthomonas campestris pv musacearum | |
Martínez et al. | New PCR primers applied to characterize distribution of Botrytis cinerea populations in French vineyards | |
KR101444237B1 (ko) | 배추과 세균병균 검출용 프라이머 세트 | |
KR101367996B1 (ko) | 곡류세균병균 검출용 프라이머 세트 | |
KR101367997B1 (ko) | 차나무세균궤양병 원인세균 검출용 프라이머 세트 | |
Zimmermann et al. | Nested PCR (polymerase chain reaction) for detection of Xanthomonas fragariae in symptomless strawberry plants/Nested PCR zum Nachweis von Xanthomonas fragariae an symptomlosen Erdbeerpflanzen | |
CN114277166B (zh) | 一种瓜类细菌性果斑病菌的rpa检测引物、探针及检测方法 | |
DE69631413T2 (de) | Nachweis einer bakterie der pectinatus gattung | |
Ahonsi et al. | Development of SCAR markers and PCR assays for single or simultaneous species-specific detection of Phytophthora nicotianae and Pythium helicoides in ebb-and-flow irrigated kalanchoe | |
KR100560996B1 (ko) | 고추역병균 파이토프쏘라 캡시사이 진단용 디엔에이표지인자 | |
Wang et al. | Dinoflagellate community analysis of a fish kill using denaturing gradient gel electrophoresis | |
CN112176080B (zh) | 特异性检测剑麻紫色卷叶病植原体的巢式pcr引物组、试剂盒及检测方法 | |
EP0460041A1 (en) | PROBE, EQUIPMENT AND METHOD FOR DETECTING AND DIFFERENTIATING MYCOBACTERIES. | |
KR100625010B1 (ko) | 고추 및 파프리카에 발생하는 고추모틀바이러스,잠두위조바이러스2, 오이모자이크바이러스 및고추마일드모틀바이러스 진단용 프라이머 조합 | |
KR101334853B1 (ko) | 우엉세균점무늬병균 검출용 pcr 프라이머 세트 및 이를 이용한 진단용 키트 | |
KR101149437B1 (ko) | 벼흰잎마름병균의 유전자 마커, 이에 특이적인 프라이머, 및 이를 이용한 벼흰잎마름병 감염 여부 및 감염 균주의 레이스 판별 방법 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |