KR101254379B1 - Method of detecting non-hanwoo and hanwoo using denaturing high-performance liquid chromatography(dhplc) - Google Patents

Abstract

The present invention provides a PCR reaction step of amplifying a mutant of a melanocortin 1 receptor (MC1R) gene in a beef cattle using a primer pair, and treating the PCR reaction with a restriction enzyme that recognizes and cleaves the mutant of the MC1R gene. A method for determining Korean cattle and non-Korean cattle, and further comprising sex-determining Region Y (SRY) genes, comprising the steps of, and analyzing the processed products by denaturing liquid chromatography (DHPLC). The present invention relates to a method for discriminating cows and hydrogen, and to test the mixing ratio of Korean and non-Korean cattle in mixed meat. In addition, the present invention is a modified liquid liquid chromatography for discriminating Korean cattle and non-Korean cattle, including a primer pair for MC1R gene mutation amplification, a primer pair for SRY gene amplification, a primer pair for MC1R gene mutation amplification, and a restriction enzyme for MC1R gene mutation. Graphics analysis kit or denatured liquid chromatographic assay kit for discriminating Hanwoo and non-Hanwoo cattle and cow and hydrogen, and additionally, Hanwoo and Non-Hanwoo discrimination and cow and hydrogen discrimination, including primer pairs for SRY gene amplification To a chromatography analysis kit. According to the present invention, the time and cost required for analysis can be reduced, and the degree of mixing can be quantitatively determined, which is expected to be useful for preventing and controlling illegal meat distribution.

Description

METHODS OF DETECTING NON-HANWOO AND HANWOO USING DENATURING HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY (DHPLC)}

The present invention provides a PCR reaction step of amplifying a mutant of a melanocortin 1 receptor (MC1R) gene in a beef cattle using a primer pair, and treating the PCR reaction with a restriction enzyme that recognizes and cleaves the mutant of the MC1R gene. A method for determining Korean cattle and non-Korean cattle, and further comprising sex-determining Region Y (SRY) genes, comprising the steps of, and analyzing the processed products by denaturing liquid chromatography (DHPLC). The present invention relates to a method for discriminating cows and hydrogen, and to test the mixing ratio of Korean and non-Korean cattle in mixed meat. In addition, the present invention is a modified liquid liquid chromatography for discriminating Korean cattle and non-Korean cattle, including a primer pair for MC1R gene mutation amplification, a primer pair for SRY gene amplification, a primer pair for MC1R gene mutation amplification, and a restriction enzyme for MC1R gene mutation. Graphics analysis kit or denatured liquid chromatographic assay kit for discriminating Hanwoo and non-Hanwoo cattle and cow and hydrogen, and additionally, Hanwoo and Non-Hanwoo discrimination and cow and hydrogen discrimination, including primer pairs for SRY gene amplification To a chromatography analysis kit.

Since the price of beef cattle is determined by the place of production and the species, it is very important to identify the species of beef cattle. Therefore, it is necessary to accurately and quickly identify the species of beef cattle. Domestic market includes Hanwoo, Non-Hanwoo, and Mixed meat is in circulation. Conventional cattle breeds have been distinguished by their apparent differences such as horns, hair color, and skeleton, but it is almost impossible to identify cattle breeds because there is no difference in appearance. Since the conclusion of the Korea-US FTA, the volume of US beef cattle has increased, and the price of beef cattle named Hanwoo is being distributed at a higher price than other beef. As a result, there are frequent cases of illegally importing imported domestic beef and domestic non-Korean beef into Korean beef, and illegal illegal distribution of meat not only causes great damage to consumers and producers, but also causes big disruptions to the domestic Korean beef business development plan. It is a cause of weakening the competitiveness of the Hanwoo industry. Therefore, consumers want accurate labeling of the place of production and species for reasons such as mad cow disease in imported meat and legitimacy of commodity prices.As a result, differentiation of beef cattle breeds is based on the establishment of distribution order in the beef market and protection of Korean cattle breeders. It is emerging as a necessary task.

As a conventional method for discriminating Korean cattle, immunoassay (ELISA) and isoelectric focusing (IEF) have been used. However, since the above methods detect specific proteins according to protein composition and structural differences between the breeding species, identification of the breeding species is possible, but it is impossible to distinguish between breeds within the same breed.

To improve this, a random amplified polymorphic DNA (RAPD) technique using PCR (polymerase chain reaction) has been developed. The PCR-RAPD has been used for discriminating beef cattle breeds and breeding of various meats in Korea, and detecting specific RADP markers of Holstein cow breeds distinguished from Korean cattle, and has been widely applied to genetic analysis and breed identification of animals abroad. The PCR-RAPD uses a primer that binds to several places on the genome and generates several fragments when PCR is performed using a short primer of about 10bp. When these fragments are identified using electrophoresis, each animal breed forms a unique band, which can be used as a breed-specific RAPD marker to distinguish breeds. However, the RAPD technique has a problem in the practical use to distinguish Hanwoo cultivar because of its high sensitivity to PCR amplification conditions and its low reproducibility and accuracy.

On the other hand, the species of the cow is judged by the groping, due to the differences between the groping genes biosynthesis of eumelanin or feomelanin, which causes a difference in the groping. In the case of the invention of examining the genotype of the existing groping genes for discriminating Korean cattle and cows, it is most common to determine the restriction fragment length polymorphism (PCR-RFLP) using restriction enzymes after PCR using agarose gel electrophoresis. The PCR-RFLP method has the advantages of higher reproducibility and accuracy than the PCR-RADP method. However, the analysis step is complicated and the analysis time and cost are high. Due to the difference, it was difficult to effectively discriminate the hybrids of Hanwoo and Non-Hanwoo based on the results of electrophoresis, and the mixed ratio of Hanwoo and Non-Hanwoo could not be determined. .

On the other hand, among the many factors that affect the quality of meat, the sex of the livestock can be evaluated as one of the main factors for quality determination. In other words, there is a difference in meat quality due to physiological differences such as sex hormone secretion according to the sex of the carnivorous animal. In 2005, Hanwoo carcass carcass quality analysis showed that the prevalence of high-quality meat of Grade 1 or higher was very good at 66.5% of females, while that of non-rated males was 4.4%, which was markedly poor (Livestock Rating Institute, 2005). Males showed better meat grades than females, but meat grades such as intramuscular fat scores were significantly lower than females. As such, the difference in meat quality by sex is due to the difference in endocrine system and metabolism, which is different according to gender. Gender differences affect not only intramuscular fat but also the tenderness of meat. It is generally known that females are relatively softer. At present, Korea's meat grade mainly depends on local province, but according to consumers' preferences and preferences, the year is likely to affect meat grade as in foreign countries. Therefore, in order to establish a healthy and correct distribution system of beef cattle in the domestic beef market, it is necessary to develop beef cattle discrimination technology that can discriminate the sex of beef cattle scientifically.

Previous studies on sex discrimination in mammals have focused on a variety of sex discrimination techniques in prenatal fetuses or embryos. Recently, according to the development of molecular genetic techniques, it is discriminated on the chromosome through the FISH (flourescent in situ hybridization) technique using the Y chromosome-specific probe or the fertilized egg using the Y chromosome-specific gene by the PCR technique in a simpler and faster way. Techniques for determining sex have been reported by several researchers (Asen and Medrano, 1990; Itagaki et al., 1993; Kudo et al., 1993; Hwang et al., 1995; Park et al., 2001; Cho et al., 2005). However, regarding the sex discrimination of beef cattle, a simple and efficient genetic discrimination technique is not specifically provided.

Therefore, in order to solve the above problems, the present inventors, when analyzed by denatured high performance liquid chromatography using a newly designed primer pair, the discrimination between Korean cattle and non-Korean cattle, Korean beef and non-Korean cattle in mixed meat The present invention has been completed by finding that the mixing ratio can be determined, and further, the cow and the hydrogen can be discriminated at once.

An object of the present invention is a PCR reaction step of amplifying a mutant of a melanocortin 1 receptor (MC1R) gene of a beef cattle using a primer pair, and the PCR reaction as a restriction enzyme that recognizes and cleaves the mutant of the MC1R gene. It is to provide a method for discriminating Korean cattle and non-Korean cattle comprising the step of treating, and analyzing the processed product through modified liquid chromatography (DHPLC).

An object of the present invention, before or after the PCR reaction step, further comprising a PCR reaction step of amplifying sex-determining region Y (SRY) gene using a primer pair Hanwoo and non-Korean beef and cow and hydrogen It is to provide a way to determine.

An object of the present invention is to provide a primer pair for amplifying the MC1R gene variant comprising a front primer of the nucleotide sequence shown in SEQ ID NO: 3 and a rear primer of the nucleotide sequence shown in SEQ ID NO: 4.

An object of the present invention is to provide a primer pair for SRY gene amplification comprising a forward primer of the nucleotide sequence of SEQ ID NO: 5 and a rear primer of the nucleotide sequence of SEQ ID NO: 6.

SUMMARY OF THE INVENTION An object of the present invention is to provide a denatured liquid chromatography assay kit for discriminating Hanwoo and Hanwoo including a MC1R gene variant amplification primer pair and a restriction enzyme for MC1R gene variant cleavage.

An object of the present invention is to analyze the denatured liquid chromatographic analysis for the determination of cow and hydrogen cattle and cow and hydrogen, including the primer pair for MC1R gene mutation amplification, restriction enzyme for MC1R gene mutation cleavage, and primer pair for SRY gene amplification To provide a kit.

An object of the present invention is a PCR reaction step of amplifying a mutant of a melanocortin 1 receptor (MC1R) gene of a mixed meat using a primer pair, and a restriction enzyme that recognizes and cleaves the PCR reaction of a mutant of the MC1R gene. It is to provide a method for assaying the mixing ratio of Hanwoo and non-Hanwoo in mixed meat comprising the step of treating with, and analyzing the processed product through modified liquid chromatography (DHPLC).

It is an object of the present invention to provide a modified liquid chromatography chromatography kit for assaying the mixing ratio of Korean cattle and non-Korean cattle in a mixed meat comprising a MC1R gene variant amplification primer pair and a restriction enzyme for MC1R gene variant cleavage.

In order to achieve the above object, in one aspect, the present invention provides a PCR reaction step of amplifying a mutant of a melanocortin 1 receptor (MC1R) gene using a pair of primers, a mutation of the MC1R gene. A method for determining Korean cattle and non-Korean cattle, comprising the steps of: processing with a restriction enzyme that recognizes and cleaves, and analyzes the processed product through denaturing liquid chromatography (DHPLC); Provided is a denatured liquid chromatography assay kit for discriminating Korean and Japanese cattle, including restriction enzymes for cutting MC1R gene mutations.

In the present invention, the term "beef" includes all varieties belonging to cattle, for example, Korean beef, non-Korean beef, mixed meat, imported meat, and crossbreed meat. In the present invention, the term "hanwoo" is a native cattle of Korean native breed, Bos taurus It is a coreanae , belonging to a small tree , and its body color is generally yellowish brown. In addition, the term "non-han beef" in the present invention means all beef except for the beef, more preferably cow, the cow is a holstein friesland native to the Netherlands and has a black and white speckled body color Holstein is included. In addition, the term "mixed meat" in the present invention refers to the beef of the mixed type of the Hanwoo and non-Hanwoo.

The present invention includes the following three steps to provide a method for distinguishing between the Hanwoo and non-Hanwoo: PCR reaction step of amplifying the mutant portion of the MC1R gene of beef cattle using a primer pair, the mutant portion of the MC1R gene of the PCR reaction product Treating with a restriction enzyme that recognizes and cleaves, and analyzing the treated product via denaturing liquid chromatography (DHPLC).

In a first step, a PCR reaction step of amplifying a mutant portion of a melanocortin 1 receptor (MC1R) gene of beef cattle using a pair of primers.

The melanocortin 1 receptor (MC1R) gene is a hormonal gene that is a hormone receptor gene that stimulates the synthesis and diffusion of melanin. Tyrosine-derived melanin, which determines the color of mammals, has two pigments, red / yellow feomelanin and brown / black eumelanin, which are used to control their synthesis and relative amounts in pigmented cells. Extension (E) and Agouti (A) loci have been shown to play an important role and the tyrosinase activity is regulated by the MC1R gene encoded by the extension locus and the tyrosinase enzyme concentration Thus, it was found that the production of pheomelanin and eumelanin is regulated. In addition, it has been found that mutations in the MC1R gene in mammals cause chromosomal aberrations, and horse sequencing revealed that a single missense mutation in this gene is associated with a Chestnut-colored groping. . In addition, pigs have been suggested to MC1R genotype characteristic by the breed and groping.

As used herein, the term "MC1R gene variant" refers to a region comprising nucleic acids showing different nucleotide sequences at the same position when comparing the MC1R genes of Hanwoo and non-Hanwoo, one or more nucleic acids including the different nucleic acids. Region, more preferably three to six nucleic acid regions comprising said different nucleic acids, and more preferably three to six nucleic acid regions comprising codons containing said different nucleic acids.

More specifically, the base sequence of the MC1R gene of the Korean cattle is SEQ ID NO: 1 and the base sequence of the MC1R gene of the non-Korean cattle is SEQ ID NO: 2, the 296th base from the 5 'end of the thymine (T) or non-Korean cattle In the case of Korean cattle, guanine (G), which is cytosine (C) and the 310th base sequence from the 5 'end of non-Korean cattle, is deleted in the case of Korean cattle.

Thus, the MC1R gene variant of the present invention comprises one or more nucleic acids or / and 310th nucleotide sequences, including the 296th base sequence from the 5 'end of the SEQ ID NO: 1 (Korean cattle) and SEQ ID NO: 2 (non-Korean cattle) MC1R gene To one or more nucleic acids, more preferably 3 to 6 nucleic acid regions comprising the 296 nucleotide sequence from the 5 'end of the SEQ ID NO: 1 (Korean cattle) and SEQ ID NO: 2 (non-Korean cattle) MC1R genes; and / or Refers to three to six nucleic acid regions including the 310th base sequence. SEQ ID NO: 1 (Korean cattle) and SEQ ID NO: 2 (non-Korean cattle) From the 5 'end of the MC1R gene 296 base sequence is contained in the 99th codon and 310 base sequence is included in the 104th codon, more preferably SEQ ID NO: 3 to 6 nucleic acids comprising the 99th codon of the 1 (Korean cattle) and SEQ ID NO: 2 (non-Korean cattle) MC1R gene, and / or 3 to 6 nucleic acids comprising the 104th codon, most preferably MC1R The gene variant portion is the 99th codon from the 5 'end of the MC1R genes of SEQ ID NO: 1 (Korean cattle) and SEQ ID NO: 2 (non-Korean cattle), and three sequential 3' sequences (corresponding to the 100th codon), that is, 99- The 100th codon or / and the 104th codon, followed by three base sequences in the 5 'direction (corresponding to the 103rd codon), that is, the 103rd to 104th codon. The 99th codon of Korean cattle is CTG, but the codon of non-Korean cattle is CCG, the 104th codon of Korean cattle is GTG, but the 104th codon of Korean cattle is GGT. In addition, the 99-100th codon of the Korean cattle is CTGCTG, but the non-Korean cattle is CCGCTG, the 103-104th codon of the Korean cattle is GCCGTG, but the non-Korean cattle is GCCGGT.

In the first step, the MC1R gene including the MC1R gene mutation unit is amplified using a primer pair that specifically binds to the MC1R gene.

As used herein, the term "primer" refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming a base pair and a base pair of complementary nucleic acids, and strand copying of the nucleic acid template. By a short nucleic acid sequence that serves as a starting point for. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures.

The term "MC1R gene mutant amplification primer" in the present invention is a substance that specifically binds to and amplifies the MC1R gene including the MC1R gene mutant, so that different nucleotide sequences between Hanwoo and non-Hanwoo can be determined by analysis. It means a primer to.

More preferably, it refers to a front primer comprising a part or all of the nucleotide sequence described in SEQ ID NO: 3 and a rear primer comprising a part or all of the nucleotide sequence described in SEQ ID NO: 4. Most preferably, it refers to the front primer of the nucleotide sequence of SEQ ID NO: 3 and the rear primer of the nucleotide sequence of SEQ ID NO: 4.

 According to a specific experimental example of the present invention, the primer pair of the present invention is designed to suit the DHPLC, compared with the conventionally used primer pairs, it can be seen that it can be more accurately discriminated between Korean cattle and non-Korean cattle bar bar effect Was remarkable. According to a specific embodiment of the present invention, when the primer pair of SEQ ID NO: 7 and SEQ ID NO: 8 used in the prior art as shown in FIG. Although it is possible to discriminate cows as Korean cattle based on the fact that they should be detected as a cow, the primer pairs of SEQ ID NO: 3 and SEQ ID NO: 4 according to the present invention are correctly identified as cows, and their accuracy and sensitivity are superior to those of conventional primers. Shows.

Such primers may incorporate additional features that do not change the basic properties. That is, the nucleic acid sequence can be modified using many means known in the art. Examples of such modifications include methylation, encapsulation, substitution of nucleotides to one or more homologs and uncharged linkages such as phosphonates, phosphoroesters, phosphoramidates or carbamates, or phosphorothioates or phosphorodithioates. Modification of the nucleotides to charged linkers, etc. is possible. Nucleic acids may also include one or more of nucleases, toxins, antibodies, signal peptides, proteins such as poly L-lysine, insertion agents such as acridine or psoralen, chelating agents such as metals, radioactive metals, iron oxidizing metals, and alkylating agents. It may have additional covalently linked residues.

In addition, the primer nucleic acid sequence of the present invention can be modified using a label that can provide a detectable signal directly or indirectly. The primer can include a label that can be detected using spectroscopy, photochemistry, biochemistry, immunochemistry or chemical means. Useful labels include ³² P, fluorescent dyes, electron dense reagents, enzymes (commonly used in ELISAS), biotin or hapten and proteins for which antiserum or monoclonal antibodies are available.

The primers of the present invention are suitable for cloning and restriction enzyme digestion of appropriate sequences and phosphoester ester methods such as Narang (1979, Meth, Enzymol. 68: 90-99), diethylphosphoramidie such as Beaucage, etc. Chemical synthesis using any other well known methods, including direct chemical synthesis such as the solids method (1981, Tetrahedron Lett. 22: 1859-1862), and the solid support method of US Pat. No. 44,58066.

Using the primer pair, a PCR reaction is performed to amplify a mutant portion of the melanocortin 1 receptor (MC1R) gene of beef cattle, and the PCR reaction is performed at a temperature, a time, and a substance as known in the art. May be carried out by determining reaction conditions including the like.

Step 2 involves treating the PCR reaction of step 1 with a restriction enzyme that recognizes and cleaves a variant of the MC1R gene.

As described above, due to the nucleotide sequence difference between the Hanwoo and the non-Hanwoo, the patterns of the gene fragments that are cleaved when the same restriction enzyme is treated appear differently. In the present invention, the term "restriction enzyme" includes all of the endonucleases that recognize a mutation of the MC1R gene and target the double-chain, and more specifically, SEQ ID NO: 1 (Korean beef) and SEQ ID NO: 2 (non Hanwoo) all of the endonucleases which recognize the substitution of the 296th sequence and / or the deletion of the 310th sequence from the 5 'end of the MC1R gene and target the double chain are cut, more specifically SEQ ID NO: Endonuclease which recognizes the presence or absence of nucleic acid substitution at the 103-104th codon position of 1 and 2 and the nucleic acid substitution at the 99th codon position and targets it, and cuts the double chain is included, Preferably it is MspA1I or Msp There may be 1, but most preferably, both MspA1I and Msp 1 are used.

More specifically, MspA1I recognizes six sequences comprising A or C, T or G and cleaves a central portion to form a fragment (5′-C (A or C) G ↓ C (G or T) G -3 '; where ↓ cuts). In the case of MC1R gene of Hanwoo, MspA1I is not recognized because the 99th and 100th codon sequences are CTG and CTG, respectively. However, in the case of the MC1R gene of non-Korean cattle, the nucleotide sequences of the 99th codon and the 100th codon are CCG and CTG, respectively, so that MspA1I recognizes and cuts a portion thereof to form a fragment. In addition, both the MC1R genes of Hanwoo and non-Hanwoo include the CAGCAG sequence (sequence 342-347 of SEQ ID NO: 1, 343-348 nucleotides of SEQ ID NO: 2) to form a cleavage fragment by MspA1I restriction enzyme. As a result, due to the difference in the presence of the cleavage site of the MspA1I, amplification of a portion of the MC1R gene of Hanwoo and non-Hanwoo by PCR and processing the PCR product using the specific restriction enzymes of the Hanwoo MC1R gene The PCR product forms two truncated fragments, while the PCR product of the MC1R gene of the non-Korean cattle is cleaved to form fragments of three or more bands, thereby distinguishing between Korean and non-Korean cattle.

In addition, Msp 1 recognizes the 5'-CCGG-3 'sequence and cleaves between the first base sequence C and the second base sequence C to form a fragment (part where 5'-C ↓ CGG-3'; ↓ cleaves). . In the case of the MC1R gene of non-Korean cattle, the base sequence of the 103rd-104th codon is GCCGGT. Thus, a fragment is formed by cleaving between the second and third nucleotide sequences C of the 103rd codon. However, in the case of the MC1R gene of Hanwoo, Msp 1 is not recognized because the base sequence of the 103rd-104th codon is GCC # GT (# represents the deleted sequence) because the G base sequence of the 104th codon is deleted. As such, due to the difference in the presence of the cleavage site of Msp 1, amplification of a portion of the MC1R gene of Hanwoo and non-Hanwoo by PCR, and then processing the PCR product using the specific restriction enzyme PCR of the Hanwoo MC1R gene The product does not form a truncated fragment, while the PCR product of the MC1R gene of the non-Korean cattle is cleaved to form fragments so that two bands can be distinguished from the Hanwoo and non-Korean cattle.

However, in general, the 310th nucleic acid of the Hanwoo MC1R gene (SEQ ID NO: 1) is deleted, but if the 310th nucleic acid is not deleted in about 17% of Korean cattle, there is a possibility that the Korean cattle may be identified as non-cow. . Therefore, the use of both Msp 1 and MspA1I can determine the Korean cattle and non-Korean cattle most accurately.

Step 3 includes analyzing the restriction enzyme treatment product via denaturing liquid chromatography (DHPLC).

The discrimination method of Hanwoo and Non-Hanwoo by the conventional PCR-RFLP method and PCR-RADP method is not only complicated analysis step but also time-consuming and expensive. Is present. Therefore, the inventors of the present invention, while studying a method for discriminating Korean cattle more conveniently than the above methods, applying the PCR-DHLPC method can be analyzed immediately without purifying the PCR product, thereby reducing the time and cost required for analysis. The present invention was completed by discovering that it can be analyzed in a short time of about 10 minutes per sample, and furthermore, labor and time can be saved since it is possible to process a large amount of samples as well as automation.

In addition, as described in the specific examples of the present invention, the sensitivity of the PCR-DHLPC method was 10 times better than that of PCR-RFLP, and the amplification product was amplified after PCR amplification of beef cattle of the same subject. Comparison of sensitivity using rose gel electrophoresis and denaturation high performance liquid chromatography showed that agarose gel electrophoresis was detectable up to 0.1 ng / μl (lane 3) level (Fig. 2) in case of denaturation high performance liquid chromatography. Detectable up to ng / μl levels (FIG. 3). In addition, even when 10% of non-cow cattle were mixed in the mixed meat, it was found that the mixing was distinguished (FIG. 5), and the effect was remarkable.

In the present invention, PCR-DHLPC is an application of IP-RPC (ion pair reversed phase chromatography), a heterozygote that is formed when the double-stranded DNA amplified by PCR is completely denatured and slowly cooled again. Heteroduplex is an analytical method that detects gene homology, including the insertion, removal and substitution of one or more sequences, using the fact that the residence time on the column is shorter than that of the homoduplex.

More specifically, as described above, there is a difference in the base sequence of the MC1R gene of Korean cattle and non-Korean cattle. Using this product, PCR products of Hanwoo and PCR products of non-Hanwoo are mixed and thermally cooled, resulting in heterozygotes. The heterozygote on DHPLC generates bubbles in the non-complementary sequence, so the retention time is different when compared to homozygotes, resulting in a graph of different patterns on DHPLC. It is a principle that can be distinguished. That is, when mixed with the MC1R control of Hanwoo, the homozygote is produced in the case of Hanwoo, and a single peak graph is generated.

In addition, DHPLC analysis can be performed in a manner as described above for fragments treated with restriction enzymes of the PCR products of Hanwoo and Non-Hanwoo. As described above, since the length of the fragments of the Hanwoo and the non-Hanwoo is different, the retention time is different, and as a result, a graph of another pattern is drawn on the DHPLC, thereby distinguishing the Hanwoo and Non-Hanwoo.

According to a specific embodiment of the present invention, the DNA samples of Hanwoo, dairy cows and mixed meats were treated with MspA1I restriction enzyme and analyzed by DHPLC. As a result, Hanwoo samples appeared as peaks at 104 bp and 186 bp, and cow samples appeared as peaks at 104 bp and 138 bp. , Mixed meats were peaked at 104 bp, 138 bp, and 186 bp to distinguish Korean beef, non-Korean beef, and mixed meat (FIG. 4A).

In addition, the DNA samples of Hanwoo, dairy cows and mixed meats were treated with Msp 1 restriction enzyme and analyzed by DHPLC. The Hanwoo samples showed peaks at 290 bp, the cows samples peaked at 141 bp and 149 bp, and the mixed meats 290 bp and 141 bp. , Peaked at 149 bp to distinguish between Hanwoo, non Hanwoo, and mixed meat (Fig. 4b).

In another aspect, the present invention relates to a method for discriminating between cows and bulls, as well as a method for discriminating between cows and bulls, and a kit used therein. More specifically, the kit is a denatured liquid chromatography for discriminating Korean cattle and non-Korean cattle, including cows and hydrogen, including a primer pair for MC1R gene mutation amplification, a restriction enzyme for cleavage of MC1R gene mutation, and a primer pair for amplification of SRY gene. It is a chromatography analysis kit.

In order to discriminate between cows and hydrogens, the present invention provides a sex-determining region Y (SRY) gene specific for the genes before, simultaneously, or after the PCR step included in the method for discriminating between Korean cattle and Korean cattle. The method further includes a PCR reaction step of amplifying by using a primer pair.

More preferably, the PCR reaction step is a multiplex-PCR step of simultaneously amplifying the mutant of the MC1R gene and the mutant of the SRY gene of each cattle with each primer pair.

In order to discriminate between male and female cattle by performing multiplex-PCR, and to discriminate between male and female, hydrogen production, the following difficulties occur in the preparation of primers. First, primers for multiplex-PCR have distinct differences in the size of PCR products for each gene obtained after performing multiplex-PCR, and can be formed as separate bands upon gel electrophoresis. Should be Second, primers for multiplex-PCR do not make each primer bind nonspecifically to DNA other than the gene at the same extension temperature and annealing temperature, resulting in a nonspecific PCR product, making the results unclear. Should not. Due to the difficulty in producing the primers, it was not easy to quickly and accurately discriminate between cows and cows and cows and cows.

Thus, the present inventors have developed a primer pair for amplification of a variant region of the SRY gene with the above-described primer pair for multiplex-PCR, which includes a front primer comprising a part or all of SEQ ID NO: 5, and SEQ ID NO: 6 It is a primer which comprises a part or all, More preferably, it is a primer pair containing the front primer described by the base sequence of SEQ ID NO: 5, and the back primer described by the base sequence of SEQ ID NO: 6.

As used herein, the term "SRY gene" is a genetic site of discrimination between sexes. The Y chromosome of the mammalian chromosome is a male chromosome and is not found in female mammals. In the present invention, the SRY gene is not amplified in the cow but can only be amplified in hydrogen. It is a property.

According to a specific embodiment of the present invention, since the SRY gene is not amplified in the case of male and female, a peak of 343 bp does not appear, whereas a peak of 343 bp appears in the case of hydrogen, thereby distinguishing between cow and hydrogen (FIG. 4A).

In another embodiment, the present invention provides a PCR reaction step of amplifying a mutant of a melanocortin 1 receptor (MC1R) gene in a mixed meat using a primer pair, and recognizing and cleaving the mutant of the MC1R gene. A method for assaying the incorporation ratio of Korean cattle and non-Korean cattle in mixed meat, comprising the steps of treating with restriction enzymes, and analyzing the processed product by modified liquid chromatography (DHPLC), and the mixing ratio used therefor. A modified performance liquid chromatography assay kit for assay.

According to a specific embodiment of the present invention, since the shape of the result graph in the modified liquid chromatography is changed according to the mixing ratio of the Korean cattle and the non-Korean cattle in the mixed meat, it is possible to quantitatively check the degree of the mixing as well as the presence or absence of the mixing. . Therefore, the mixing ratio of mixed meats such as Korean cattle and non-Korean cattle, which have been difficult to discriminate conventionally, can also be determined quantitatively. For example, the quantitative value of the graph according to the mixing ratio can be obtained by using the Hanwoo control and the non-Hanwoo control as a basis, and then analyzed for an unknown sample to compare the result with the quantitative graph to obtain a quantitative value. 5: the mixing ratio is 1: 9 (cow: Korean cattle), the mixing ratio is 2: 8 (cow: Korean cattle), the mixing ratio is 3: 7 (cow: Korean cattle), and the mixing ratio is 4: 6 (cow) : Hanwoo), mix ratio of 5: 5 (cow: Hanwoo), mix ratio of 6: 4 (cow: Hanwoo), mix ratio of 7: 3 (cow: Hanwoo), mix ratio of 8: 2 (cow: Hanwoo) ), The mixing ratio is 9: 1 (cow: Korean cattle), and it can be seen that the degree of incorporation can be confirmed in%.

In another aspect, the present invention relates to a primer pair for amplifying a MC1R gene variant comprising a front primer of the nucleotide sequence of SEQ ID NO: 3 and a back primer of the nucleotide sequence of SEQ ID NO: 4.

In another aspect, the present invention relates to a primer pair for SRY gene amplification comprising a forward primer of the nucleotide sequence of SEQ ID NO: 5 and a back primer of the nucleotide sequence of SEQ ID NO: 6.

According to the present invention, the time and cost required for analysis can be reduced, and the degree of mixing can be quantitatively determined, which is expected to be useful for preventing and controlling illegal meat distribution.

Figure 1 shows that the mutiplex-PCR product was confirmed by 2% agarose gel electrophoresis. Lane L is a DNA size marker, lane 1 is MC1R gene and SRY gene (hydrogen) sample DNA, lane 2 is MC1R gene and SRY gene (cow) control sample DNA, and lane 3 represents negative control sample DNA. The fragments in lane 1 are 290 bp and 343 bp and the fragments in lane 2 are 290 bp.
Figure 2 shows the sensitivity of the SRY gene using a 10-fold dilution of 10 ng / uL of SRY gene genomic DNA by PCR-agarose gel analysis.
Figure 3 shows the sensitivity of the SRY gene using a 10-fold dilution of 10 ng / uL of SRY gene genomic DNA through DHPLC analysis.
4A shows DNA samples of Korean cattle, cows, and mixed meats treated with MspA1I restriction enzyme and analyzed by DHPLC. 1 is a size marker, 2 is a Hanwoo male, 3 is a Hanwoo female, 4 is a low male, 5 is a cow female, 6 is a mixed male, and 7 a mixed female. Hanwoo samples showed peaks at 104 bp and 186 bp, cow samples showed peaks at 48 bp, 104 bp and 138 bp, and mixed meats showed peaks at 48 bp, 104 bp, 138 bp and 186 bp. Females and males were distinguished by a peak of 343bp.
In addition, Figure 4b is a DNA sample of Hanwoo cattle, cows and mixed meats treated with Msp 1 restriction enzyme and DHPLC analysis. 1 is Korean cattle, 2 is cow, and 3 is mixed meat. Hanwoo samples were peaked at 290 bp, cow samples peaked at 141 bp and 149 bp, and mixed meats peaked at 290 bp, 141 bp and 149 bp.
Figure 5 shows the results of DHPLC quantitative analysis of mixed meat. 1 is size marker, 2 is 1: 9 (cow: hanwoo), 3 is 2: 8 (cow: hanwoo), 4 is 3: 7 (cow: hanwoo), 5 is The mixing ratio is 4: 6 (cow: Hanwoo), the mixing ratio is 5: 5 (cow: Hanwoo), the mixing ratio is 6: 4 (dairy: Hanwoo), the ratio is 7: 3 (cow) : 9 shows the mixing ratio of 8: 2 (cow: Hanwoo), 10 shows the mixing ratio of 9: 1 (cow: Hanwoo).
Figure 6 shows the results of amplification using the MC1R primer set, PCR products confirmed by 2% agarose gel electrophoresis.
Figure 7 shows the results of RFLP after PCR using a known primer pair described in SEQ ID NO: 7 and SEQ ID NO: 8.
8 shows sequences of amplified DNA products amplified using primer pairs of SEQ ID NOs: 3, 4 and SEQ ID NOs: 5, 6 and recognition sites of restriction enzymes (MspA1I or Msp I).

Hereinafter, the present invention will be described in more detail by way of examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example  1. in the organization DNA  extraction

end. Preparation of sample

In this experiment, we used Hanwoo cancer, 1 cow of each number and cow (Holstein species), and 1 cow of each number as the standard samples. Randomly 100 samples were collected and used in this experiment. In addition, as a sample of imported beef, 10 Australian and 10 New Zealand were compared with the standard Korean beef.

I. Reagents and Instruments

DNA was extracted from tissue using PrimePrep ^™ Genomic DNA Isolation Kit from Tissue (GeNet Bio, Korea), and electrophoresis of agarose using QA-Agarose ^™ (Q-bio gene, USA). Mobile phase of denaturing high performance liquid chromatography with 0.1 M triethylammonium acetate (TEAA), pH 7 (buffer A, Transgenomic®, USA) and 0.1 M TEAA, 25% acetonitrile (buffer B, Transgenomic ?, USA) Was used.

Amplification of DNA is GeneAmp PCR system 2700 was used (Applied Biosystems, USA), multi-polymerase chain reaction (PCR) product verification was using Mupid-α (Advance, Japan) , limit check of the enzyme-treated product is WAVE ^TM 2100 system (Transgenomic, USA) was used.

All. Genomic DNA Extraction from Beef

Add 20 mg of beef cattle to a 1.5 mL centrifuge tube, add 200 uL of lysis buffer and 10 uL of proteinase K (20 mg / mL), and mix in a constant temperature bath. The reaction was carried out for a time. After centrifugation of the reaction at 12,000 rpm for 2 minutes, the supernatant was transferred to a new 1.5 mL tube, and the same amount of binding buffer was added and mixed. The collection column and the binding column were combined and the reaction was transferred to the binding column and centrifuged for 5 minutes at 12,000 rpm. All the filtrate collected in the collection column was discarded and washed with 500 uL of Washing Buffer 1 and centrifuged for 1 minute at 12,000 rpm. All the filtrate collected in the collection column was discarded and repeated with 500 uL of Washing Buffer 2. All the filtrate collected in the collection column was discarded and centrifuged at 12,000 rpm for 5 minutes to dry the binding column, and then the binding column was transferred to a new 1.5 mL tube. 100 uL of elution buffer was added and reacted for 5 minutes at room temperature, followed by centrifugation for 1 minute at 12,000 rpm, and the collected solution was stored at -20 ° C.

Example  2: multiplex - PCR Amplification of samples

end. multiplex PCR

Amplification products of each sample were obtained using PCR primer sets (primary pairs of SEQ ID NO: 3 and SEQ ID NO: 4 and primer pairs of SEQ ID NO: 5 and SEQ ID NO: 6). Each 25 uL of reaction solution (Table 2) was placed in a 0.2 mL reaction tube, and DNA was amplified under the conditions of Table 3 using a GeneAmp PCR system 2700 (Applied Biosystem, USA).

MC1R primer <set 2> (product size 290bp) order GC% Tm FP 5'- gtggagaacgtgctggtagtg -3 '
(SEQ ID NO: 3) 57.1% 54.3 ℃ RP 5'- agggcgtagaagatggagatg -3 '
(SEQ ID NO: 4) 52.4% 54.6 ℃ SRY primer (product size 343bp) order GC% Tm FP 5'- tacagatgctgaaaagcgcc-3 '
(SEQ ID NO: 5) 50.0% 55.3 ℃ RP 5'- cgaaatccgtgtagccaatg- 3 '
(SEQ ID NO: 6) 50.0% 55.2 ℃

I. Identification of Amplified Products by Agarose Gel Electrophoresis

Multiplex-PCR products were analyzed by Mupid-α (Advance, Japan) electrophoresis using a 2% (w / v) agarose gel. 2 g of agarose was placed in an Erlenmeyer flask (250 mL), and 100 mL of 5 X TBE (tris boric acid EDTA) buffer was dissolved in the microwave for 3 minutes, and the solution was poured into a gel container and hardened for 30 minutes. After the gel had solidified, the comb was removed and the gel collected. The gel was placed in an electrophoresis apparatus, filled with 0.5 X TBE buffer solution, 4 uL of amplification product and 0.8 uL of 6 X BPB (bromo phenol blue) dye were mixed, loaded 4 uL and electrophoresed at 100 V for 30 minutes. After that, the gel was removed from the electrophoresis apparatus, stained with EtBr (ethidium bromide) for 15 minutes, and washed with EtBr, which failed to bind DNA, with distilled water for 15 minutes. Finally, the gel was placed on the UV transilluminator to confirm DNA amplification (FIG. 1).

All. Digestion of Amplified Products by Restriction Enzymes (MspA1I and Msp 1)

1 uL of the restriction enzyme MspA1I (Enzynomics, Korea) was added to 20 uL of the PCR product, followed by reaction at 37 ° C. for 1 hour in a constant temperature bath. In addition, 1 uL of the restriction enzyme Msp 1 (Enzynomics, Korea) was added to 20 uL of the PCR product, followed by reaction at 37 ° C. for 1 hour in a constant temperature water bath.

la. result

PCR products amplified using the MC1R primer set were treated with the restriction enzyme MspA1I, and the result was confirmed by 2% agarose gel electrophoresis (FIG. 6). Lane L is a DNA size marker, lane 1 is Korean cattle control sample DNA, lane 2 is cow control sample DNA, and lane 3 represents mixed meat control sample DNA.

Example  3: Agarose  Gel Electrophoresis Modified high performance liquid chromatography  Sensitivity Comparison of Methods

end. After diluting 10 ng / uL of small genomic DNA in 10 coordination units to concentrations of 10 ng, 1 ng, 0.1 ng, 0.001 ng and 0.0001 ng, respectively, the amplification products of each sample were obtained using the SRY primer sets shown in Table 2. 25 uL of reaction solution (Table 4, A buffer: 0.1 M TEAA solution, pH 7.0, B buffer: 0.1 M triethylene ammonium acetate (TEAA) and 25% acetonitrile, pH 7.0) were added to a 0.2 mL reaction tube, DNA was amplified (Table 4) using the GeneAmp PCR System 2700 (Applied Biosystem, USA). The amplification products were compared for sensitivity using 2% agarose gel electrophoresis and denaturing high performance liquid chromatography, respectively.

I. Sensitivity comparison result

Denatured high performance liquid chromatography when comparing the detection sensitivity of agarose gel electrophoresis and denaturation high performance liquid chromatography on the amplification products of each sample amplified using SRY primer set by diluting 10 ng / uL of genomic DNA 10 times. It was confirmed that up to 0.01 ng can be detected (FIG. 3). On the other hand, PCR-agarose gel analysis only detected up to 0.1 ng (Fig. 2). In other words, it was observed that the modified high performance liquid chromatography was more sensitive than the PCR-agarose gel electrophoresis.

Example  4 : Modified high performance liquid chromatography  analysis

end. 10 uL of sample was analyzed for 20 minutes using denaturing high performance liquid chromatography at the flow rate of 0.75 mL / min under the conditions of Table 3 above.

I. Denatured high performance liquid chromatography analysis

Multiplex-PCR amplification products were analyzed by denaturing high performance liquid chromatography after MspA1I (Enzynomics, Korea) and Msp 1 (Enzynomics, Korea) restriction enzyme treatment, and confirmed a total of six types of chromatograms (FIGS. 4A and 4B). Could. As a result, it was possible to discriminate Korean cattle, cows, and mixed meats using modified high performance liquid chromatography, and at the same time, it was possible to discriminate between cows and cows. The result of analysis by denaturing high performance liquid chromatography after MspA1I (Enzynomics, Korea) restriction enzyme treatment is shown in Figure 4a, Hanwoo samples appear as peaks at 104bp, 186bp, cow samples are peaked at 48bp, 104bp, 138bp , Mixed meat peaked at 48bp, 104bp, 138bp, 186bp. Females and males were distinguished by a peak of 343bp. In addition, the results of analysis by denaturing high performance liquid chromatography after Msp 1 (Enzynomics, Korea) restriction enzyme treatment is shown in Figure 4b, Hanwoo samples appear as a peak at 290bp, cows samples appear as a peak at 141bp, 149bp, Mixed meats peaked at 290, 141, and 149 bp.

Example  5: Mixed meat  Quantitative analysis

end. For quantitative detection according to the mixing ratio of Hanwoo cattle and cows, multiplex-PCR amplification products were mixed with MspA1I (Enzynomics, Korea) restriction enzymes by mixing genomic DNA (10 ng / uL) of Hanwoo cattle and cows and denatured high performance liquid chromatography Analyzed. Specifically, the mixing ratio is 1: 9 (cow: Korean cattle), the mixing ratio is 2: 8 (cow: Korean cattle), the mixing ratio is 3: 7 (cow: Korean cattle), and the mixing ratio is 4: 6 (cow). : Hanwoo), mix ratio of 5: 5 (cow: Hanwoo), mix ratio of 6: 4 (cow: Hanwoo), mix ratio of 7: 3 (cow: Hanwoo), mix ratio of 8: 2 (cow: Hanwoo) ), The case where the incorporation ratio is 9: 1 (cow: Korean cattle) was analyzed (FIG. 5).

I. Denatured High Performance Liquid Chromatography Results for Quantitative Analysis of Mixed Meats

As a result of multiplex-PCR denatured high performance liquid chromatography analysis of the mixed meat, the mixing ratio of Korean cattle and cows is as shown in FIG. 5, and the mixing ratio of 1: 9 (cow: Korean cattle) is 9: 1 (cow: Hanwoo) was able to determine the ratio of the mixing of the cow and cow in all the above cases, the modified high performance liquid chromatography method of the present invention can detect up to 10% of the cow when mixed in the cow Could know.

Example  6: DNA  Gene discrimination by sequencing

end. DNA amplification products obtained using only the MC1R primer set were analyzed by sequencing (ABI 3730XL DNA analyzer, Applied Biosystem, USA) and compared at the National Center for Biotechnology Information (NCBI).

I. DNA sequencing results

DNA amplification products were purified from the primer sets used in the multiplex-PCR using only the MC1R primer set. As a result, DNA and sequencing results were confirmed. In the mixed meat, the genes of the cattle and cows were mixed.

Example  7: Conventional With primer pairs  Invention of the present invention Primer pair  compare

When PCR was carried out using known primer pairs of SEQ ID NO: 7 and SEQ ID NO: 8 and primer pairs of SEQ ID NO: 3 and SEQ ID NO: 4 devised by the inventors, the accuracy of discriminating Korean cattle and non-Korean cattle was compared.

PCR of the samples was performed under the conditions of Table 5 using PCR primer sets (primary pairs of SEQ ID NO: 3 and SEQ ID NO: 4), and the amplification products thereof were obtained by RFLP. In contrast, PCR was performed under the same conditions using a PCR primer set (primary pairs of SEQ ID NO: 7 and SEQ ID NO: 8), and the amplification product was obtained by RFLP. As shown in FIG. 7, the primer pairs of SEQ ID NO. 7 and SEQ ID NO. 8 used in the prior art are cows based on the fact that two fragments of lane No. 4, which are cows, should be detected as three fragments when cleaved with MspA1I. Although it is possible to discriminate the Korean cattle, the primer pairs of SEQ ID NO: 3 and SEQ ID NO: 4 are correctly identified as cows, which shows that the accuracy and sensitivity are superior to those of the conventional primers.

<110> Dankook Industry-Academic Cooperation Foundation <120> METHOD OF DETECTING NON-HANWOO AND HANWOO USING DENATURING          HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY (DHPLC) <130> PA100246KR <160> 9 <170> Kopatentin 1.71 <210> 1 <211> 953 <212> DNA <213> Bos taurus <220> <221> gene (222) (1) ... (953) <223> Hanwoo_MC1R codon sequence <400> 1 atgcctgcac ttggctccca gaggcggctg ctgggttccc ttaactgcac gcccccagcc 60 accctcccct tcaccctggc ccccaaccgg acggggcccc agtgcctgga ggtgtccatc 120 cctgacgggc tctttctcag cctggggctg gtgagtctcg tggagaacgt gctggtagtg 180 gctgccattg ccaagaaccg caacctgcac tcccccatgt actactttat ctgctgcctg 240 gctgtgtctg acttgctggt gagcgtcagc aacgtgctgg agacggcagt catgctgctg 300 ctggaggccg tgtcctggcc acccaggcgg ccgtggtgca gcagctggac aatgtcatcg 360 acgtgctcat ctgcggatcc atggtgtcca gcctctgctt cctgggtgcc attgctgtgg 420 accgctacat ctccatcttc tacgccctgc ggtaccacag tgttgtgaca ctgccccgag 480 cgtggaggat cattgcggcc atctgggtgg ccagcatcct caccagcctg ctcttcatca 540 cctactacaa ccacaaggtc atcctgctgt gcctcgttgg cctcttcata gctatgctgg 600 ccctgatggc cgtcctctac gtccacatgc tggcccgggc ctgccagcat gcccggggca 660 ttgcctggct ccagaagagg cagcgcccca ttcatcaggg ctttggcctc aagggcgctg 720 ccaccctcac catcctgctg ggcgtcttct tcctctgctg gggccccttc ttcctgcacc 780 tctcgctcat cgtcctctgc ccccagcacc ccacctgtgg ctgcatcttc aagaacttca 840 acctcttcct ggccctcatc atttgcaacg ccattgtgga ccccctcatc tatgccttcc 900 gcagccagga gctccggaag acgctccaag aggtgctgca gtgctcctgg tga 953 <210> 2 <211> 954 <212> DNA <213> Bos taurus <220> <221> gene (222) (1) .. (954) <223> Holstein_MC1R codon sequence <400> 2 atgcctgcac ttggctccca gaggcggctg ctgggttccc ttaactgcac gcccccagcc 60 accctcccct tcaccctggc ccccaaccgg acggggcccc agtgcctgga ggtgtccatc 120 cctgacgggc tctttctcag cctggggctg gtgagtctcg tggagaacgt gctggtagtg 180 gctgccattg ccaagaaccg caacctgcac tcccccatgt actactttat ctgctgcctg 240 gctgtgtctg acttgctggt gagcgtcagc aacgtgctgg agacggcagt catgccgctg 300 ctggaggccg gtgtcctggc cacccaggcg gccgtggtgc agcagctgga caatgtcatc 360 gacgtgctca tctgcggatc catggtgtcc agcctctgct tcctgggtgc cattgctgtg 420 gaccgctaca tctccatctt ctacgccctg cggtaccaca gtgttgtgac actgccccga 480 gcgtggagga tcattgcggc catctgggtg gccagcatcc tcaccagcct gctcttcatc 540 acctactaca accacaaggt catcctgctg tgcctcgttg gcctcttcat agctatgctg 600 gccctgatgg ccgtcctcta cgtccacatg ctggcccggg cctgccagca tgcccggggc 660 attgcctggc tccagaagag gcagcgcccc attcatcagg gctttggcct caagggcgct 720 gccaccctca ccatcctgct gggcgtcttc ttcctctgct ggggcccctt cttcctgcac 780 ctctcgctca tcgtcctctg cccccagcac cccacctgtg gctgcatctt caagaacttc 840 aacctcttcc tggccctcat catttgcaac gccattgtgg accccctcat ctatgccttc 900 cgcagccagg agctccggaa gacgctccaa gaggtgctgc agtgctcctg gtga 954 <210> 3 <211> 21 <212> DNA <213> MC1R forward primer <400> 3 gtggagaacg tgctggtagt g 21 <210> 4 <211> 21 <212> DNA <213> MC1R reverse primer <400> 4 agggcgtaga agatggagat g 21 <210> 5 <211> 20 <212> DNA <213> SRY forward primer <400> 5 tacagatgct gaaaagcgcc 20 <210> 6 <211> 20 <212> DNA <213> SRY reverse primer <400> 6 cgaaatccgt gtagccaatg 20 <210> 7 <211> 20 <212> DNA <213> existing foward primer <400> 7 gtggagaacg tgctggtagt 20 <210> 8 <211> 20 <212> DNA <213> existing reverse primer <400> 8 tgaccttgtg gttgtagtag 20 <210> 9 <211> 317 <212> PRT <213> Bos taurus <220> <221> PEPTIDE (222) (1) .. (317) <223> Hostein_MC1R amino acid sequence <400> 9 Met Pro Ala Leu Gly Ser Gln Arg Arg Leu Leu Gly Ser Leu Asn Cys   1 5 10 15 Thr Pro Pro Ala Thr Leu Pro Phe Thr Leu Ala Pro Asn Arg Thr Gly              20 25 30 Pro Gln Cys Leu Glu Val Ser Ile Pro Asp Gly Leu Phe Leu Ser Leu          35 40 45 Gly Leu Val Ser Leu Val Glu Asn Val Leu Val Val Ala Ila Ala      50 55 60 Lys Asn Arg Asn Leu His Ser Pro Met Tyr Tyr Phe Ile Cys Cys Leu  65 70 75 80 Ala Val Ser Asp Leu Leu Val Ser Val Ser Asn Val Leu Glu Thr Ala                  85 90 95 Val Met Pro Leu Leu Glu Ala Gly Val Leu Ala Thr Gln Ala Ala Val             100 105 110 Val Gln Gln Leu Asp Asn Val Ile Asp Val Leu Ile Cys Gly Ser Met         115 120 125 Val Ser Ser Leu Cys Phe Leu Gly Ala Ile Ala Val Asp Arg Tyr Ile     130 135 140 Ser Ile Phe Tyr Ala Leu Arg Tyr His Ser Val Val Thr Leu Pro Arg 145 150 155 160 Ala Trp Arg Ile Ile Ala Ala Ile Trp Val Ala Ser Ile Leu Thr Ser                 165 170 175 Leu Leu Phe Ile Thr Tyr Tyr Asn His Lys Val Ile Leu Leu Cys Leu             180 185 190 Val Gly Leu Phe Ile Ala Met Leu Ala Leu Met Ala Val Leu Tyr Val         195 200 205 His Met Leu Ala Arg Ala Cys Gln His Ala Arg Gly Ile Ala Trp Leu     210 215 220 Gln Lys Arg Gln Arg Pro Ile His Gln Gly Phe Gly Leu Lys Gly Ala 225 230 235 240 Ala Thr Leu Thr Ile Leu Leu Gly Val Phe Phe Leu Cys Trp Gly Pro                 245 250 255 Phe Phe Leu His Leu Ser Leu Ile Val Leu Cys Pro Gln His Pro Thr             260 265 270 Cys Gly Cys Ile Phe Lys Asn Phe Asn Leu Phe Leu Ala Leu Ile Ile         275 280 285 Cys Asn Ala Ile Val Asp Pro Leu Ile Tyr Ala Phe Arg Ser Gln Glu     290 295 300 Leu Arg Lys Thr Leu Gln Glu Val Leu Gln Cys Ser Trp 305 310 315

Claims (15)

A PCR reaction step of amplifying beef melanocortin 1 receptor (MC1R) genes using a front primer of SEQ ID NO: 3 and a rear primer of SEQ ID NO: 4;
The PCR reaction product includes a first restriction enzyme recognizing that CTG, the 99th amino acid codon, is substituted with CCG from the 5 'end of the nucleotide sequence of SEQ ID NO: 1 or 2 of the MC1R gene, and the nucleotide sequence of SEQ ID NO: 1 or 2 Treating with a second restriction enzyme recognizing that the G base is deficient in GGT, which is the 104th amino acid codon from the 5 'end of; And
Determination method of the Hanwoo and non-Hanwoo comprising the step of analyzing the processed product by modified liquid chromatography (DHPLC).
PCR reaction step of amplifying the melanocortin 1 receptor (MC1R) gene of the mixed meat using the front primer of SEQ ID NO: 3 and the rear primer of SEQ ID NO: 4;
The PCR reaction product includes a first restriction enzyme recognizing that CTG, the 99th amino acid codon, is substituted with CCG from the 5 'end of the nucleotide sequence of SEQ ID NO: 1 or 2 of the MC1R gene, and the nucleotide sequence of SEQ ID NO: 1 or 2 Treating with a second restriction enzyme recognizing that the G base is deficient in GGT, which is the 104th amino acid codon from the 5 'end of; And
A method for assaying the mixing ratio of Korean beef and non-Korean beef in mixed meat, comprising analyzing the processed product by modified liquid chromatography (DHPLC).
delete delete delete delete The method of claim 1 or 2, wherein the first restriction enzyme is MspA1I and the second restriction enzyme is Msp1.
Claim 1, further comprising a PCR reaction step of amplifying the sex-determining Region Y (SRY) gene using a primer pair before, concurrently or after the PCR reaction step of Hanwoo and non-cow and cow and How to determine hydrogen.
The method of claim 8, wherein the PCR reaction step is a multiplex-PCR step of simultaneously amplifying the mutant portion of the MC1R gene and the SRY gene with each primer pair.
The method according to claim 8 or 9, wherein the front primer of the primer pair of the SRY gene is a primer comprising part or all of the nucleotide sequence represented by SEQ ID NO: 5, and the rear primer is part or part of the nucleotide sequence represented by SEQ ID NO: A method comprising the whole.
delete delete i) a front primer of SEQ ID NO: 3 and a back primer of SEQ ID NO: 4; And (ii) the first restriction enzyme recognizing that the 99th amino acid codon, CTG, is substituted with CCG from the 5 'end of the base sequence set forth in SEQ ID NO: 1 or 2 of the MC1R gene, and the base sequence set forth in SEQ ID NO: 1 or 2 Denatured liquid chromatography analysis kit for discriminating Korean cattle and non-Korean cattle comprising a second restriction enzyme which recognizes that the G base is deficient in GGT, the 104th amino acid codon from the 5 'end.
i) a front primer of SEQ ID NO: 3 and a back primer of SEQ ID NO: 4; And (ii) the first restriction enzyme recognizing that the 99th amino acid codon, CTG, is substituted with CCG from the 5 'end of the base sequence set forth in SEQ ID NO: 1 or 2 of the MC1R gene, and the base sequence set forth in SEQ ID NO: 1 or 2 Denatured liquid chromatography assay kit for assaying the mixing ratio of Korean cattle and non-Korean cattle in a mixed meat comprising a second restriction enzyme recognizing that the G base is deficient in GGT, the 104th amino acid codon from the 5 'end.
The analysis kit according to claim 13 or 14, wherein the cow and the hydrogen can be discriminated through denatured liquid chromatography analysis including a primer pair for SRY gene amplification.

Images