KR101140391B1 - Preparation of adipocyte for screening anti-obesity material using heme oxygenase-1 and use of the same - Google Patents

Abstract

PURPOSE: A method for screening a material containing a material with anti-obesity or anti-inflammatory activities using HO-1 protein is provided. CONSTITUTION: A method for reducing adipocyte differentiation comprises a step of overexpressing heme oxidase-1 genes in heme oxidase-1 gene-overexpressing adipocytes prepared by introducing a recombinant vector containing heme oxidase-1 gene with a base sequence of sequence number 1 into precursor adipocyte cell line. A method for searching an anti-obesity candidate from natural products comprises: a step of treating the natural products to the heme oxidase-1 gene overexpressing adipocytes; a step of measuring expression level of the heme oxidase-1 gene; and a step of selecting a natural product as an anti-obesity candidate in case that the heme oxidase-1 gene expression is reduced.

Description

Preparation of adipocyte for screening anti-obesity material using Heme oxygenase-1 and use of the same}

The present invention provides a method for screening a substance containing anti-obesity or anti-inflammatory activity by verifying the anti-obesity-related function of HO-1 protein and preparing a precursor adipocyte line incorporating a ho-1 gene expression control system and using it as a screening system. It is about.

In recent years, the physical labor of modern people has been reduced due to the improvement of dietary life due to industrial development and income increase, and the convenience of living according to industrial development. Therefore, according to 2004 National Health and Nutrition Survey, 30.6% means overweight (BMI-Body Mass Index), which is calculated as weight (kg) divided by height (m) squared: 25.0 to 29.9) or obesity (BMI: 30.0 or higher) ) And the trend is increasing day by day.

According to the World Health Organization (WHO), overweight or obese population worldwide is 1.2 billion people, and the incidence of various diseases is increasing, raising interest in obesity.

In the case of obesity, diabetes, hypertension, myocardial infarction from skin aging is deeply associated with the development of various diseases. An important cause of disease development from such obesity is the induction of inflammation. Therefore, if you discover the target protein that can control the inflammation caused by obesity and the mechanism of action can be a very efficient system for discovering the active ingredient from natural materials.

In using an anti-obesity related cell lines As an in vitro research system, a model using differentiation of 3T3L1 adipocytes, precursor adipocytes, is well known. The expression of adipokine genes is increased during the differentiation of precursor adipocytes, and the role of PPAR gamma, C / EBP alpha and beta as a transcriptional regulatory protein involved is reported to be important (Vernochet C, Davis KE, Scherer PE, Farmer). SR. (2010) Endocrinology 151 (2) 586-594; Tomaru T, Steger DJ, Lefterova MI, Schupp M, Lazar MA. (2009) J. Biol. Chem. 284 (10) 6116-6125; Evans JL, Lin JJ, Goldfine ID. (2005) Diabetes Rev. 1 (3) 299-307; Hwang CS, Loftus TM, Mandrup S, Lane MD. (1997) Annu. Rev. Cell Dev. Biol. 13 231-259; Marchildon F , St-Louis C, Akter R, Roodman V, Wiper-Bergeron NL. (2010) J. Biol. Chem. 285 (17) 13274-13284.).

Expression of these transcriptional regulator proteins also increases during the differentiation of adipocytes.

Heme oxygenase-1 (HO-1) is a heme-degrading protein whose expression is induced from oxidative stress in vivo, and important functions such as antioxidant, anti-inflammatory, immune response suppression, cell survival and angiogenesis have been reported. Therefore, anti-obesity agent activity is expected to be very high in the substance that can artificially induce the expression and activity of HO-1.

Differentiation of precursor adipocytes (preadipocyte) is commonly used in the field as an in vitro model system for the study of obesity. In relation to the differentiation of precursor adipocytes, studies on the changes of adipokine expression and transcriptional regulatory proteins involved in the regulation of gene expression are being actively conducted.

Obesity is a metabolic disease caused by abnormal metabolic control processes and is closely related to the inflammatory response.

The present invention has been made in view of the above necessity, and an object of the present invention is to provide a system for applying to search for an extract containing both anti-obesity and anti-inflammatory activity.

Another object of the present invention is to screen the anti-obesity activity of natural products through the system.

Another object of the present invention is to screen the anti-inflammatory activity of natural products through the system.

The present invention to achieve the above object

In a method for producing a recombinant plasmid for inhibiting the expression of a heme oxidase-1 gene, the plasmid vector contains an RNA promoter and the inserted gene contains a nucleotide sequence of the heme oxidase-1 gene designed to induce hairpin structure. It provides a method for producing a recombinant plasmid to inhibit the expression of heme oxidase-1 gene.

In one embodiment of the invention, the heme oxidase-1 gene preferably has a nucleotide sequence set forth in SEQ ID NO: 1, but considering the degeneracy of the genetic code, one or more substitutions, deletions, inversions to these genes All mutants having the characteristics of the ho-1 gene of the present invention through translocation, etc., are also included in the gene of the present invention, and preferably 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, more preferably 90 Genes having a homology of% or more are also included in the ho-1 gene range of the present invention.

In another embodiment of the present invention, the nucleotide sequence of the heme oxidase-1 gene designed to induce the hairpin structure is preferably, but not limited to, the nucleotide sequence of SEQ ID NO: 2 or 3.

In another aspect, the present invention provides a recombinant plasmid for inhibiting the expression of the heme oxidase-1 gene produced by the production method of the present invention, wherein the plasmid is based on a plasmid having a cleavage map as shown in FIG.

The present invention also provides a recombinant vector having a cleavage map described in FIG. 2 for overexpressing the heme oxidase-1 gene.

In another aspect, the present invention provides a method for producing heme oxidase-1 gene expression inhibiting adipocytes comprising the step of introducing a recombinant plasmid to inhibit the expression of the heme oxidase-1 gene of the present invention in a precursor adipocyte cell line.

In another aspect, the present invention provides heme oxidase-1 gene expression inhibiting adipocytes produced by the adipocyte manufacturing method.

The present invention also provides a method for increasing adipocyte differentiation by inhibiting heme oxidase-1 gene expression in the adipocytes.

The present invention also provides a method for producing heme oxidase-1 gene overexpressing adipocytes comprising introducing a recombinant vector for overexpressing the heme oxidase-1 gene of the present invention into a precursor adipocyte cell line.

In another aspect, the present invention provides heme oxidase-1 gene overexpressing adipocytes produced by the method of the present invention.

The present invention also provides a method of inhibiting adipocyte differentiation by overexpressing the heme oxidase-1 gene in the adipocyte of the present invention.

In another aspect, the present invention comprises the steps of: a) treating natural products to the adipocytes of the present invention;

b) measuring the expression level of heme oxidase-1 gene after natural product treatment in the cells; And c) when the expression of the heme oxidase-1 gene is decreased, the natural product is provided as a candidate for anti-obesity.

In the present invention, natural products mean natural plants and animals, microorganisms, or extracts thereof.

The present invention also provides an anti-obesity pharmaceutical composition comprising a white paper extract.

The present invention also provides an anti-obesity functional food composition comprising a white paper extract.

The present invention also provides an anti-inflammatory pharmaceutical composition comprising a white paper extract.

The present invention also provides an anti-inflammatory functional food composition comprising a white paper extract.

Pharmaceutical compositions containing white paper extracts of the present invention may be administered in the form of dragees, capsules, bitable capsules, tablets, drops and syrups, as well as in the form of pessaries and nasal sprays.

The formulations can be prepared, for example, by extending the active ingredient with a solvent and / or carrier, optionally using emulsifiers and / or dispersants, and optionally using organic solvents as auxiliary solvents, for example when using water as a diluent. have.

The following auxiliaries may be mentioned by way of example: water, non-toxic organic solvents such as paraffin (eg mineral oil fraction), vegetable oils (eg rapeseed oil, peanut oil, sesame oil), alcohols (eg ethyl Alcohols, glycerol), glycols (eg propylene glycol, polyethylene glycol); Solid carriers such as natural land minerals (eg highly dispersed silicic acid, silicates), sugars (eg sugars, lactose and dextrose before purification); Emulsifiers such as nonionic and anionic emulsifiers (eg polyoxyethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, alkylsulfonates and arylsulfonates); Dispersants (eg lignin, sulfite waste liquor, methylcellulose, starch and polyvinylpyrrolidone) and glidants (eg magnesium stearate, talc, stearic acid and sodium lauryl sulfate) and optional flavorings.

Administration is carried out in a conventional manner, preferably enterally or parenterally, especially orally. For enteral administration, in addition to containing the mentioned carriers, tablets may also contain other additives such as sodium citrate, calcium carbonate and calcium phosphate together with various supplemental ingredients such as starch, in particular potato starch, gelatin and the like. Glidants such as magnesium stearate, sodium lauryl sulfate and talc can also be used for tableting purposes. In the case of aqueous suspensions and / or elixirs intended for oral use, various taste modifiers or coloring agents may also be added to the active ingredient in addition to the aforementioned auxiliaries.

For parenteral administration, solutions of the active ingredient using suitable liquid carrier materials can be used. In the case of intravenous administration, in order to achieve an effective result, it has been found to be usually advantageous to administer in an amount of about 0.01 to 10.0 mg, preferably about 0.01 to 5.0 mg per body weight, and in the case of intestinal administration About 0.01 to 20 mg, preferably about 0.01 to 10 mg per body weight per day.

However, in some cases, contrary to the indicated doses, it may be necessary to use depending on the weight of the experimental animal or patient or the nature of the route of administration and the individual response or interval of administration to the animal species and medicament. For example, in some cases it may be sufficient to use less than the aforementioned minimum amount, while in other cases it may be necessary to exceed the above upper limit. In the case of relatively high doses, it may be desirable to divide a given amount into several individual doses throughout the day. When used in human medicine, the same range of dosages is provided, with the above description also applied as well.

In order to enhance the prophylactic or therapeutic action against an anti-obesity disease, different orally effective anti-obesity agents are often used in combination.

Thus, the compositions used according to the invention can be prepared by known methods, for example tablets, capsules, dragees, pills, suppositories, granules, aerosols, syrups, solutions, solids and creams, emulsions and suspensions, and pharmaceuticals. It can be prepared in a conventional formulation such as a solution using an inert non-toxic carrier and additives or solvents are acceptable. In such formulations, the therapeutically effective compound is in each case preferably a concentration of about 0.1 to 80% by weight, preferably 1 to 50% by weight, ie sufficient to achieve a dosage within the specified range, in the total mixture. Exists as.

In addition, the present invention can be used as a main ingredient or additives and auxiliaries of the food in the manufacture of the white paper extract of the present invention in various functional foods and health functional food.

In the present invention, the "functional food" means a food that has improved the functionality of the general food by adding the extract of the present invention to the general food. Functionality can be roughly divided into physical properties and physiological functions. When the extract of the present invention is added to general foods, the physical properties and physiological properties of general foods will be improved, and the present invention comprehensively describes foods having such improved functions as 'functional foods'. 'Is defined.

In addition to the above, the functional food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic and natural flavors, coloring and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, alginic acid And salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like.

In addition, the functional food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice beverages and vegetable beverages. These components can be used independently or in combination. The proportion of such additives is not so critical but is usually chosen in the range of 0.01 to 20 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the present invention will be described.

The present invention verifies the effect of inhibiting adipocyte differentiation of heme oxygenase-1 (HO-1) to prepare precursor adipocytes with artificially regulated HO-1 expression, and this system contains an anti-obesity and anti-inflammatory activity simultaneously. It is intended to apply to search for ingredient extracts.

As can be seen through the present invention, the expression of heme oxygenase-1 (HO-1) can be screened to have anti-obesity and / or anti-inflammatory activity in natural products through the precursor adipocytes that are artificially regulated.

1 is a diagram showing the production of shRNA HO-1 gene recombinant plasmid.
1 is a result of preparing a recombinant plasmid to inhibit the expression of ho-1 gene. The pSUPER plasmid vector contains an RNA promoter and the inserted gene contains the nucleotide sequence of a portion of the ho-1 gene designed to induce hairpin structure. The pSUPER-HO-1 plasmid DNA introduced into the cell is produced in the form of RNA of hairpin structure, cleaved by dicer, and then the fragment is converted into a single helix and generated from the ho-1 gene of the actual chromosome. It forms a double helix form of complementary bonds with RNA. This RNA structure is recognized as an abnormal form and degraded, preventing the synthesis of HO-1 protein in the cell.
Figure 2 is a diagram showing the production of HO-1 gene expression recombinant plasmid.
PcDNA3 shown in Figure 2 is an expression vector produced for the purpose of gene expression in animal cells. It contains a typical cytomegalovirus (CMV) promoter that can strongly induce gene expression and contains Ampicillin and Neomycin resistance genes. Ampicillin resistance gene is used as a selection marker for screening bacteria into which the plasmid DNA is introduced, and neomycine resistance gene is used as a selection marker for screening animal cells into which the plasmid DNA is introduced. There are also multiple cloning sites for cloning foreign genes.
Figure 3 is a figure showing the production of HO-1 gene expression control adipocytes and analysis of the inhibition of adipocyte differentiation of HO-1.
Figure 4 shows the increase in the expression of C / EBPa in adipocyte differentiation process (Fig. 4a) and the decrease in the expression of C / EBPa in shRNA HO-1 expressing adipocytes (Fig. 4b). (
5 is a diagram showing the anti-inflammatory and adipocyte differentiation inhibitory effect of HO-1 dependent white paper ethanol extract.
Figure 6 shows a cleavage map for the pSUPER plasmid vector.

The present invention will now be described in more detail by way of non-limiting examples. The following examples are intended to illustrate the invention and the scope of the invention is not to be construed as being limited by the following examples.

The antibody used in the present invention is C / EBP is SC61; Santa Cruz Biotechnology, Santa Cruz, CA, HO-1 is H105; Santa Cruz Biotechnology, Santa Cruz, CA, Beta-Actin is AC-15; Sigma, St. Louis, MO, iNOS is 54; Transduction laboratories, It was purchased from Lexington, KY.

Manufacturing example  1: 3 T3 - L1  Cell culture medium

Standard media include 4.00 mM L-Glutamine, 450 mg / L glucose, Sodium pyruvate (0.1 μm sterile filtered), 10% BCS (GIBCO, Cat. 26170-043,) in Dulbecco's modified Eagle medium (High glucose, Hyclone, ASA28186). Lot. 605022) and a medium containing 1% Antibiotics (Hycolne, Penicillin-Streptomycin 10,000 μg / ml) were used and the medium was stored at 4 ° C.

Induced differentiation media include Dulbecco's modified Eagle medium (High glucose, Hyclone, ASA28186), 4.00 mM L-Glutamine, 450 mg / L glucose, Sodium pyruvate (0.1 μm sterile filtered), 10% FBS, 1% Antibiotics (Hycolne, Penicillin-Streptomycin 10,000 μg / ml), 250 nM Dexamethasone (Aldrich, 861871), 100 uM 3-Isobutyl-1-Methylxanthine (Sigma, I5879), 10 μg / ml bovine pancreas-derived insulin solution (Sigma, I0516) and 1% BSA A medium containing was used.

Manufacturing example  2: Preparation of Inducible Materials

IBMX

21.25 mg 3-Isobutyl-1-Methylxanthine was added to the vial, 2 ml ddH ₂ O was added, followed by the addition of 100 μl 1N NaOH and rotation to a clear liquid. Add 7.6 ml ddH ₂ O was then added and the liquid was sterile filtered with a 0.45 μm filter and stored at −80 ° C. (stable for several months): thawed and stored at 4 ° C.

Dexamethasone

4 mg Dexamethasone was added to the vial, dissolved in 20.38 ml ddH 2 O, and the liquid was sterilized with a 0.45 μm filter and stored at -80 ° C.

Manufacturing example  3: bovine pancreas-derived insulin solution

1 ml insulin (10 mg / ml) was added to the vial and mixed with 9 ml 0.0125 N HCl (pH 2.0). The liquid was sterile filtered with a 0.45 μm filter and stored at −80 ° C.

Manufacturing example  4: Maintenance Maintenance ) Badge

Dulbecco's modified Eagle's medium (High glucose, Hyclone, ASA28186), 4.00 mM L-Glutamine, 450 mg / L glucose, Sodium pyruvate (0.1 μm sterile filtered), 10% FBS, 1% Antibiotics (Hycolne, Penicillin-Streptomycin 10,000 μg / ml), a medium containing 1 mg / ml insulin solution (final concentration: 10 μg / ml) was used and the medium was stored at 4 ° C.

Experimental Example  1: of cultured cells Oil Red  O dyeing

After culturing in the tissue culture plate and processing the cultured cells as described above, remove the plate (35-mm) from the incubator to remove the medium and then add ~ 2 ml of PBS to wash the cells and completely remove the PBS 2 ml of 10% formalin (RT) was added and incubated at room temperature for 10 minutes.

The formalin was then removed and 2 ml fresh promalin was added and incubated for at least 1 hour (cells can be maintained for several days in formalin before staining). It was then covered with aluminum foil and wrapped with parafilm to protect the cells from drying.

After removing the formalin with a pipette and washing the cells twice with 2 ml of ddH 2 O, the cells were washed with 2 ml of 60% isopropanol for 5 minutes at room temperature, and then completely dried at room temperature. If necessary, the cells were dried using a hair dryer.

1 ml of Oil Red O working solution was added and incubated at room temperature for 10 minutes.

The Oil Red O solution was then removed and immediately ddH 2 O was added and cells were washed 4 times with ddH 2 O.

Next, a photograph was obtained under a microscope for analysis.

Then remove all moisture and dry, add 1 ml of 100% isopropanol and incubate for 10 minutes to elute the Oil Red O dye, then pipet Oil Red O several times with isopropanol so that all Oil Red O is in solution. It was reciprocated. The solution was then transferred to a 1.5-ml Eppendorf tube and the OD was measured at 500 nm using 100% isopropanol as a blank.

Reagents used in this example and a preparation method thereof are as follows.

Oil Red  O stock :

Sigma (Cat # O-0625), FW 408.5. Weigh 0.35 g Oil Red O was weighed in 100 ml of isopropanol, stirred, filtered (0.2 μm) and stored at room temperature.

Oil Red  O Working  solution:

6 ml of the Oil Red O stock solution and 4 ml of ddH 2 O were mixed and maintained at room temperature for 20 minutes, followed by filtration (0.2 μm).

10% Formalin ( PBS  of mine):

27 ml formalin solution (37%, Merck, Cat # K36658003) was diluted with 63 ml ddH2O and 10 ml 10X PBS.

100% isopropanol (Merck, Cat # K36543834)

60% Isopropanol :

Mix 6 ml of 100% isopropanol with 4 ml of ddH2O.

Example  One: pSUPER - HO -1 recombinant plasmid preparation

Put 100 nmole / ml of the following two oligonucleotides into 1.5 ml microtube, respectively,

Sense-gatccccgcacagggtgacagaagattcaagagatcttctgtcaccctgtgcctttttggaaa (SEQ ID NO: 2)

Antisense-agcttttccaaaaaggcacagggtgacagaagatctcttgaatcttctgtcaccctgtgcggg (SEQ ID NO: 3)

5 ml of 10 × Annealing Buffer (100 mM Tris-HCl, pH 7.5, 1 M NaCl, 10 mM EDTA) was added. Then, 50 ml of the final volume was filled with Nuclease-free water, heated at 100 ° C, waited for 2 hours until the temperature dropped to 30 ° C, and the annealed oligonucleotide was added to 1 mg pSUPER plasmid (OligoEngine, USA) in 1.5 ml microtube ( After cutting with BamHI / XhoI restriction enzyme), add 1 ml of T4 DNA ligase (10 Units / ml) to ligation at 16 ° C for 14 hours, transform it into E. coli, and confirm the recombinant plasmid DNA. Got it. For further details on the plasmids of the present invention, refer to the catalog number VEC-PBS-0004 (circular) of the pSUPER.neo vector on the manufacturer's website, www.oligoengine.com and the protocol thereof.

Example  2: pcDNA3 - HO -1 recombinant plasmid

RNA was extracted from the A549 cell line. RNA extraction was used Trizol RNA extraction kit (Invitrogen 15596-018). Using extracted RNA as a template, HO-1 cDNA was synthesized by RT-PCR method. cDNA synthesis was performed with 2 mg Total RNA, 1 ml Oligo dT (1 mM), 4 ml dNTP (each 2.5 mM), 20 units of M-MLV reverse transcriptase (Promega # M1701), and the final volume of the reaction up to 20 ul with DEPC water. Fit. CDNA was obtained by reaction at 70 ° C. for 15 min and at 42 ° C. for 60 minutes.

HO-1 cDNA production proceeds as follows. Prepare a mixture of 2 mg cDNA, 10 mM primer (forward and reward respectively), 2.5 units of i-MAX II DNA polymerase (Intron biotechnology # 25261) and 4 ml dNTP (2.5 mM each) in a PCR tube. PCR reaction conditions were set to 95 ℃, 5 min, (95 ℃, 30 sec; 55 ℃, 30 sec; 72 ℃, 1 min 30 cycles), 72 ℃, 10 min. The HO-1 primer base sequence used at this time is as follows; Forward HindIII-HO-1 5'-aagcttatggagcgtccgcaacccga-3 '(SEQ ID NO: 4), Reward XhoI-HO-1 5'-ctcgagagttcatggccctgggagcc-3' (SEQ ID NO: 5).

Example  3: ho -1 gene expression system ( ho -One gene overexpression system in pcDNA3  And ho -One gene knockdown system in pSUPER Precursor fat cell line (stable) cell line Production

It was produced in the following order.

1) 3 × 10 ⁵ / 6-well 3T3L1 precursor adipocyte lines were plated.

2) 16 hours after plating, transfection experiments were started in which plasmid DNA was introduced into cell lines. Transfection was performed by using FuGENE-6 (Roche) reagent.

It is carried out in a sterile bench and the procedure is as follows.

250 ml of OPTI-MEM (phenol-red free) culture was placed in a sterile 1.5 ml microtube, followed by tapping with 9 ml of FuGENE-6. 3 mg of pcDNA3, pcDNA3-HO-1, pSUPER, or pSUPER-HO-1 plasmid, respectively, were added and then tapped.

The reaction was carried out at room temperature for 30 minutes.

Reactions were treated with cell lines in each prepared 6-well.

3) After 24 hours, the precursor fat cell line was washed twice with phosphate buffer saline (PBS) solution and treated with 0.35 ml trypsin-EDTA. After reacting for 1 minute in the CO2 cell incubator, when all the attached cells were detached, 3 ml of cell culture solution was treated to lose the activity of trypsin-EDTA.

Each cell line was gently suspended, and then transferred to a culture dish (diameter 100 mm) in the following ratio (1 ml of the above-mentioned desorption cell line suspension culture + 9 ml of fresh culture).

4) After incubation for 24 hours, 500 mg / ml neomycin was treated to select cell lines containing the introduced ho-1 recombinant plasmid (with a neomycin resistant gene). When 50% of the cultured cell lines died after 5 days of the first treatment, the cells were washed with PBS and replaced with fresh culture (containing 500 mg / ml neomycin). This procedure was repeated every two days, and after 2 weeks, clones each having a population of viable cells (colony form) were isolated and propagated. RNA or protein was extracted from each clone to confirm the expression of HO-1 by RT-PCR or western blotting method, and finally desired stable cell clones were obtained.

Example  4: Preparation of white paper extract and evaluation of anti-obesity activity

Preparation of White Paper Extract

Commercially available white paper was chopped and pulverized to obtain a powder. 1 g of 70% ethanol was added to 50 g of the obtained white paper powder sample as an extraction solvent, and the mixture was added to a stirrer (manufacturer: Heidolph, specification: MR 3001, MR3001K), followed by stirring at 300 rpm for 3 hours. The extract was filtered under reduced pressure using filter paper, and the recovered filtrate was concentrated under reduced pressure at 45 ° C. with a concentrator (Heidolph, LABOROTA 4000) to prepare a white paper extract.

Of white paper extract Anti-obesity  Active evaluation

Anti-obesity activity of white ethanol extract was determined by analyzing the effect on the differentiation of fat precursor cell lines. White paper ethanol extracts were treated together at the start of differentiation of adipose precursor cell lines. As a measure of adipocyte differentiation, photographs were taken directly on a microscope using Oil Red O staining, and the degree of differentiation was quantitatively analyzed by measuring absorbance at 500 nm using a spectrophotometer.

Differentiation conditions of adipose precursor cell lines are as follows.

1) 1 x 10 ⁶ / 6-well 3T3-L1 cell line was plated (using standard culture).

2) Cultured to have a confluent distribution.

3) The medium was changed after washing with PBS. (Using differentiation medium)

4) Incubated for 2 days.

5) The medium was changed after washing with PBS. (Use maintenance medium)

6) Then incubated for 12 days. (Replace the maintenance broth with a new one every two days)

7) Oil red O staining was used to observe the differentiation of adipocytes and the degree of differentiation was measured at 500 nm using a spectrophotometer.

In Figure 3 b Immunoblotting is a result of confirming the ho-1 expression changes at the protein level by preparing a stable cell line in which the two types of ho-1 gene expression plasmids prepared above are introduced into the chromosome of 3T3L1 adipocytes. Analysis of HO-1 protein expression was performed using the Immunoblotting method. Each cell line was washed with PBS buffer and treated with 200 ml of lysis buffer (10 mM Tris-Cl, 1% Triton X-100, pH 7.6) for 5 minutes at room temperature, followed by centrifugation at 12000 rpm for 10 minutes. The supernatant was collected.

Proteins were quantified from supernatants containing cytoplasmic contents. Protein quantification was performed using the Bradford (Sigma Cat # B6916) method (2 ml of sample + 2 ml of distilled water + 200 ml of Bradford reagent) using a spectrophotometer to measure the absorbance at 595 nm to correct the amount between samples. Protein quantitation was calculated using a standard curve prepared using bovine serum albumin 0.1-1.4 mg / ml).

30 mg of protein was loaded per well, and the protein was separated by electrophoresis at 120 voltage using 10% SDS-PAGE gel and transferred to nitrocellulose membrane. The protein-transported membrane was reacted at room temperature for 2 hours with a 5% milk solution diluted with HO-1 antibody or beta-actin antibody at a ratio of 1: 1000 at a ratio of 1: 1000. A 5% milk aqueous solution diluted three times with 10 ml PBS solution at 10 minute intervals and diluted 1: 3000 of secondary antibodies (anti-rabbit IgG for iNOS and HO-1 or anti-mouse IgG for beta-actin) After reacting at room temperature for 1 hour, they were washed three times in the same manner. Membrane was reacted with an aqueous solution of ECL (Ab Frontier, Cat # LF-QC0101) for 1 minute at room temperature, and then phosphorylated and confirmed on an X-ray film by fluorescence-sensitizing HO-1 protein in a dark room. Compared with the parent, pcDNA3, and pSUPER cell lines, the pcDNA3-HO-1 cell line increased HO-1 expression but significantly decreased the pSUPER-HO-1 cell line. Figure 3a is the result of analyzing the effect of the expression of ho-1 on the differentiation by differentiating the two types of the verified precursor adipocytes by the Oir red O staining (experimental method described above) and b of FIG. The staining value is measured with a spectrophotometer. When HO-1 expression was suppressed, adipocyte differentiation was significantly increased compared to control (cells into which vector plasmid was introduced), but when HO-1 expression was artificially increased, adipocyte differentiation was compared with control This shows a significantly reduced pattern. Taken together, it can be suggested that HO-1 protein inhibits the differentiation of adipocytes.

5 is a result of analyzing the effect of ethanol extract of white paper on the expression of HO-1 having a function of inhibiting adipocyte differentiation.

As shown in FIG. 5A, blank ethanol extract significantly increases HO-1 expression at the protein level in proportion to the amount treated.

Caffeine, an anti-obesity substance well known for suppressing adipocyte differentiation, does not seem to have a significant effect on the expression of HO-1.

Figure 5b shows that the expression of inducible nitric oxide synthase (iNOS), an inflammation-inducing factor in mouse RAW264.7 macrophages treated with 100 ng / ml Lipopolysaccharide (LPS) for 24 hours, was pretreated with white ethanol extract for 30 minutes. Shows a significant reduction.

Figure 5c shows that the fat cell inhibitory effect of the white paper compared to caffeine excellent results, this effect is shown to be significantly reduced in the cells suppressed ho-1 gene expression.

In the experimental procedure in Figure 5a after treating the amount of white paper ethanol extract or Caffeine (1 mM) to the 3T3-L1 adipocyte cell line and cultured the cells for 24 hours.

In the experimental procedure in Figure 5b RAW 264.7 mouse macrophages were incubated in a culture medium containing DMEM high glucose, 10% FBS, 25 mM HEPES (pH 7.4), 500 ug / ml of white paper ethanol extract for 30 minutes It was. Then, 100 ng / ml LPS was treated for 24 hours to wash the cell lines with PBS buffer, and 200 ml lysis buffer (10 mM Tris-Cl, 1% Triton X-100, pH 7.6) was reacted at room temperature for 5 minutes. After this, the supernatant was collected by centrifugation at 12000 rpm for 10 minutes.

Proteins were quantified from supernatants containing cytoplasmic contents. Protein quantification was performed using the Bradford (Sigma Cat # B6916) method (2 ml of sample + 2 ml of distilled water + 200 ml of Bradford reagent) using a spectrophotometer to measure the absorbance at 595 nm to correct the amount between samples.

Protein quantitation was calculated using a standard curve prepared using bovine serum albumin 0.1-1.4 mg / ml).

30 mg of protein was loaded per well, and the protein was separated by electrophoresis at 120 voltage using 10% SDS-PAGE gel and transferred to nitrocellulose membrane. The membrane to which the protein was transferred was reacted with an iNOS antibody in a ratio of 1: 1000, a HO-1 antibody in a ratio of 1: 1000, or a 5% milk solution diluted with beta-actin antibody in a ratio of 1: 5000 at 2 hours at room temperature. A 5% milk aqueous solution diluted three times with 10 ml PBS solution at 10 minute intervals and diluted 1: 3000 of secondary antibodies (anti-rabbit IgG for iNOS and HO-1 or anti-mouse IgG for beta-actin) After reacting at room temperature for 1 hour, they were washed three times in the same manner. Membrane was reacted with an aqueous solution of ECL (Ab Frontier, Cat # LF-QC0101) for 1 minute at room temperature, and then fluoresced to C / EBP alpha protein in the dark to print and confirm on an X-ray film.

In the case of Figure 5c, the experiment was carried out under the same conditions as in FIG.

Example  5: increased expression of C / E in adipocyte differentiation and shRNA HO C / in -1 expressing adipocytes EBP Decreased expression of

Figure 4a is a result of examining the expression of C / EBP alpha which is an important transcriptional regulatory protein for the expression of Adipokine genes related to differentiation during adipocyte differentiation.

At 2 days after adipocyte differentiation, the expression of C / EBP alpha began to increase and at 4 days the maximum expression was increased. The increased expression of C / EBP alpha shows a further increased result in pSUPER-HO-1 cells in which ho-1 gene expression is suppressed (FIG. 4B).

The experimental procedure differentiated the fat progenitor cell line under the conditions described in Example 4.

The cell lines were washed with PBS buffer at each hourly condition and treated with 200 ml of lysis buffer (10 mM Tris-Cl, 1% Triton X-100, pH 7.6) for 5 minutes at room temperature, followed by 10 minutes at 12000 rpm. The supernatant was collected by centrifugation. Proteins were quantified from supernatants containing cytoplasmic contents. Protein quantification was performed using the Bradford (Sigma Cat # B6916) method (2 ml of sample + 2 ml of distilled water + 200 ml of Bradford reagent) using a spectrophotometer to measure the absorbance at 595 nm to correct the amount between samples. Protein quantitation was calculated using a standard curve prepared using bovine serum albumin 0.1-1.4 mg / ml).

30 mg of protein was loaded per well, and the protein was separated by electrophoresis at 120 voltage using 10% SDS-PAGE gel and transferred to nitrocellulose membrane. Membrane from which protein was transferred was diluted with C / EBP alpha antibody at 1: 1000 ratio, HO-1 antibody at 1: 1000 ratio, or beta-actin antibody at 1: 5000 ratio, and diluted with 5% milk solution at room temperature for 2 hours. Reacted. A 5% milk aqueous solution diluted three times with 10 ml PBS solution at 10 minute intervals and diluted 1: 3000 of secondary antibodies (anti-rabbit IgG for iNOS and HO-1 or anti-mouse IgG for beta-actin) After reacting at room temperature for 1 hour, they were washed three times in the same manner. Membrane was reacted with an aqueous solution of ECL (Ab Frontier, Cat # LF-QC0101) for 1 minute at room temperature, and then fluoresced to C / EBP alpha protein in the dark to print and confirm on an X-ray film.

At 2 days after adipocyte differentiation, the expression of C / EBP alpha began to increase and at 4 days the maximum expression was increased. The increased expression of C / EBP alpha shows a further increased result in cells in which the expression of the ho-1 gene is suppressed (FIG. 4B).

Attach an electronic file to a sequence list

Claims (16)

delete delete delete delete delete delete delete delete delete delete Heme oxidase prepared by introducing a recombinant vector having a cleavage map as shown in FIG. 2 to overexpress the heme oxidase-1 gene comprising the heme oxidase-1 gene having the nucleotide sequence of SEQ ID NO: 1 in a precursor fat cell line -1 Gene Overexpression A method of overexpressing the heme oxidase-1 gene in adipocytes to reduce adipocyte differentiation compared to the control. a) heme prepared by introducing a recombinant vector having a cleavage map as shown in FIG. 2 to overexpress the heme oxidase-1 gene comprising the heme oxidase-1 gene having the nucleotide sequence shown in SEQ ID NO: 1 in a precursor fat cell line Treating natural products with oxidase-1 gene overexpressing adipocytes;
b) measuring the expression level of heme oxidase-1 gene after natural product treatment in the cells; And
c) searching for an anti-obesity candidate from natural products, comprising selecting the natural product as an anti-obesity candidate when the expression of the heme oxidase-1 gene is reduced. delete delete delete delete

Images