KR101356139B1 - Preparation of adipocyte for screening anti-obesity material using Heme oxygenase-1 and use of the same - Google Patents

Abstract

The present invention provides a method for screening a substance containing anti-obesity or anti-inflammatory activity by verifying the anti-obesity-related function of HO-1 protein and preparing a precursor adipocyte line incorporating a ho-1 gene expression control system and using it as a screening system. It is about.

Description

Development and application of precursor adipocytes for screening anti-obesity material using heme oxygenase-1 {Preparation of adipocyte for screening anti-obesity material using Heme oxygenase-1 and use of the same}

The present invention verifies the anti-obesity-related function of the HO-1 protein and uses the ho-1 gene expression control system as a progenitor adipocyte line and uses it as a screening method for a substance containing anti-obesity or anti-inflammatory activity. About.

The physical labor of modern people is decreasing due to the improvement of dietary life due to the recent industrial development and the increase of income, and the increase of convenience of life according to the industrial development. For this reason, according to the 2004 National Health and Nutrition Survey, 30.6% means overweight (BMI-Body Mass Index), which is calculated as weight (kg) divided by the square of height (m) -: 25.0-29.9) or obesity (BMI: 30.0 or more ), and the trend is increasing day by day.

According to the World Health Organization (WHO), there are 1.2 billion overweight or obese populations worldwide, with a higher incidence of various diseases, leading to increased interest in obesity.

In the case of obesity, it is deeply associated with the onset of various diseases such as diabetes, hypertension, and myocardial infarction from skin aging. An important cause of disease incidence from obesity is the induction of inflammation. Therefore, if the target protein that can control inflammation caused by obesity is discovered and the mechanism of action is identified, it can be a very efficient system for discovering effective ingredients from natural materials.

In using an anti-obesity related cell lines As an in vitro research system, a model using the differentiation of 3T3L1 adipocytes, which is a precursor adipocyte, is well known. The expression of adipokine genes increases during the differentiation process of progenitor adipocytes, and the roles of PPAR gamma, C/EBP alpha and beta as involved transcriptional regulatory proteins have been reported to be important (Vernochet C, Davis KE, Scherer PE, Farmer). SR. (2010) Endocrinology 151(2) 586-594; Tomaru T, Steger DJ, Lefterova MI, Schupp M, Lazar MA. (2009) J. Biol. Chem. 284 (10) 6116-6125; Evans JL, Lin JJ, Goldfine ID. (2005) Diabetes Rev. 1(3) 299-307; Hwang CS, Loftus TM, Mandrup S, Lane MD. (1997) Annu. Rev. Cell Dev. Biol. 13 231-259; Marchildon F , St-Louis C, Akter R, Roodman V, Wiper-Bergeron NL. (2010) J. Biol. Chem. 285(17) 13274-13284.).

The expression of these transcriptional regulatory proteins is also increased during the differentiation of adipocytes.

Heme oxygenase-1 (HO-1) is a heme-degrading protein that is induced by oxidative stress in vivo. Important functions such as antioxidant, anti-inflammatory, immune response suppression, cell survival and angiogenesis have been reported. Therefore, substances that can artificially induce the expression and activity of HO-1 are expected to have very high antiobesity agent activity.

Differentiation of progenitor adipocytes (preadipocytes) is an in vitro model system for studies related to obesity and is generally used in the field. In relation to the differentiation of progenitor adipocytes, studies on changes in the expression of adipokines and transcriptional regulatory proteins involved in the regulation of such gene expression are being actively conducted.

Obesity is a metabolic disease caused by abnormalities in the metabolic regulation process and is closely related to the inflammatory response.

The present invention was conceived by the above necessity, and an object of the present invention is to provide a system applied to search for an extract containing both anti-obesity and anti-inflammatory activities.

Another object of the present invention is to screen the anti-obesity activity of natural products through the system.

Another object of the present invention is to screen the anti-inflammatory activity of natural products through the system.

In order to achieve the above object, the present invention

In the method for producing a recombinant plasmid to inhibit the expression of the heme oxidase-1 gene, the plasmid vector contains an RNA promoter and the inserted gene contains the nucleotide sequence of the heme oxidase-1 gene designed to induce a hairpin structure. In order to suppress the expression of the heme oxidase-1 gene, a method for preparing a recombinant plasmid is provided.

In one embodiment of the present invention, the heme oxidase-1 gene preferably has the nucleotide sequence shown in SEQ ID NO: 1, but considering the degenerate of the genetic code, one or more substitutions, deletions, inversions in these genes , All mutants having the characteristics of the ho-1 gene of the present invention through translocation are also included in the gene of the present invention, preferably 80% or more homology with the nucleotide sequence set forth in SEQ ID NO: 1, more preferably 90 Genes having% or more homology are also included in the scope of the ho-1 gene of the present invention.

In another embodiment of the present invention, the nucleotide sequence of the heme oxidase-1 gene designed to induce the hairpin structure is preferably a nucleotide sequence of SEQ ID NO: 2 or 3, but is not limited thereto.

In addition, the present invention provides a recombinant plasmid in order to suppress the expression of the heme oxidase-1 gene prepared by the production method of the present invention, and the plasmid has a plasmid having a cleavage map shown in FIG. 6 as a skeleton.

In addition, the present invention provides a recombinant vector having a cleavage map shown in Fig. 2 for overexpressing the heme oxidase-1 gene.

In addition, the present invention provides a method for preparing adipocytes inhibiting heme oxidase-1 gene expression, comprising introducing a recombinant plasmid to inhibit the expression of the heme oxidase-1 gene of the present invention in a precursor adipocyte line.

In addition, the present invention provides adipocytes that inhibit heme oxidase-1 gene expression prepared by the method for producing adipocytes.

In addition, the present invention provides a method of increasing adipocyte differentiation by inhibiting the expression of heme oxidase-1 gene in the adipocytes.

In addition, the present invention provides a method for preparing adipocytes overexpressing heme oxidase-1 gene, comprising the step of introducing a recombinant vector for overexpressing the heme oxidase-1 gene of the present invention into a precursor adipocyte line.

In addition, the present invention provides adipocytes overexpressing the heme oxidase-1 gene prepared by the method of the present invention.

In addition, the present invention provides a method for inhibiting adipocyte differentiation by overexpressing the heme oxidase-1 gene in the adipocytes of the present invention.

In addition, the present invention a) the step of treating the natural product to the fat cells of the present invention;

b) measuring the expression level of the heme oxidase-1 gene after treatment with the natural product in the cell; And c) when the expression of the heme oxidase-1 gene is decreased, selecting the natural product as a candidate for anti-obesity.

In the present invention, natural products mean natural animals and plants, microorganisms, or extracts thereof.

In addition, the present invention provides a pharmaceutical composition for anti-obesity comprising a white paper extract.

In addition, the present invention provides a functional food composition for anti-obesity comprising a white paper extract.

In addition, the present invention provides an anti-inflammatory pharmaceutical composition comprising a white paper extract.

In addition, the present invention provides an anti-inflammatory functional food composition comprising a white paper extract.

The pharmaceutical composition containing the white paper extract of the present invention can be administered as a drug in the form of dragees, capsules, bitable capsules, tablets, drops and syrups, as well as pesari and nasal sprays.

The formulation is prepared, for example, by extending the active ingredient with a solvent and/or a carrier, optionally using an emulsifier and/or a dispersant, and optionally, an organic solvent can be used as a co-solvent when water is used as a diluent. have.

The following adjuvants may be mentioned by way of example: water, non-toxic organic solvents such as paraffin (e.g. mineral oil fraction), vegetable oils (e.g. rapeseed oil, peanut oil, homa oil), alcohols (e.g. ethyl Alcohol, glycerol), glycol (eg, propylene glycol, polyethylene glycol); Solid carriers such as natural land minerals (eg highly dispersed silicic acid, silicates), sugars (eg sugars before purification, lactose and dextrose); Emulsifiers, such as nonionic and anionic emulsifiers (eg polyoxyethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, alkylsulfonates and arylsulfonates); Dispersants (e.g. lignin, sulfite waste liquor, methylcellulose, starch and polyvinylpyrrolidone) and lubricants (e.g. magnesium stearate, talc, stearic acid and sodium lauryl sulfate) and optional flavors.

Administration is carried out in a conventional manner, preferably enterally or parenterally, in particular orally. In the case of enteral administration, in addition to containing the carriers mentioned, the tablets may also contain other additives such as sodium citrate, calcium carbonate and calcium phosphate along with various supplementary ingredients such as starch, in particular potato starch, gelatin, and the like. Further, for the purpose of tableting, a lubricant such as magnesium stearate, sodium lauryl sulfate and talc may be used. In the case of aqueous suspensions and/or elixirs intended for oral use, various taste modifiers or colorants may also be added to the active ingredient in addition to the aforementioned adjuvants.

* For parenteral administration, a solution of the active ingredient using a suitable liquid carrier material may be used. In the case of intravenous administration, it has been found to be generally advantageous to administer in an amount of about 0.01 to 10.0 mg, preferably about 0.01 to 5.0 mg per body weight per day in order to achieve an effective result. It is about 0.01 to 20 mg, preferably about 0.01 to 10 mg per body weight per day.

However, in some cases, unlike the indicated amount, it is necessary to use it according to the body weight of the experimental animal or patient or the nature of the route of administration, and the individual response to the animal species and drug or the administration interval. For example, in some cases it may be sufficient to use less than the aforementioned minimum amount, while in other cases it is necessary to exceed the aforementioned upper limit. When administering relatively large doses, it may be desirable to divide the defined amount into several individual doses over the course of the day. When used in human medicine, the same range of dosages is provided, and the above description also applies.

In order to enhance the prophylactic or therapeutic action for anti-obesity diseases, different anti-obesity agents, which are effective orally, are often used in combination.

Accordingly, the composition used according to the present invention can be prepared by known methods, for example, tablets, capsules, dragees, pills, suppositories, granules, aerosols, syrups, solutions, solid and cream emulsions and suspensions, and pharmaceuticals. It can be prepared in a conventional formulation such as a solution using an acceptable inert non-toxic carrier and additives or solvents. In such formulations, the therapeutically effective compound is in each case preferably in a concentration of about 0.1 to 80% by weight, preferably 1 to 50% by weight, in the total mixture, i.e. in an amount sufficient to achieve the dosage within the specified range. Exists as.

In addition, in the present invention, the white paper extract of the present invention can be used as a main ingredient or additive and adjuvant of food in the manufacture of various functional foods and health functional foods.

In the present invention, the term'functional food' refers to a food in which the functionality of a general food is improved by adding the extract of the present invention to a general food. Functionality can be broadly classified into physical properties and physiological functions. When the extract of the present invention is added to a general food, the physical properties and physiological functions of the general food will be improved. It is defined as'.

In addition to the above, the functional food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavors and natural flavoring agents, coloring agents and heavy ingredients (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid. And salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like.

In addition, the functional food composition of the present invention may contain flesh for the production of natural fruit juice and fruit juice beverages and vegetable beverages. These components may be used independently or in combination. Although the proportion of these additives is not so important, it is generally selected from 0.01 to 20 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the present invention will be described.

The present invention verifies the effect of inhibiting adipocyte differentiation of heme oxygenase-1 (HO-1) to produce precursor adipocytes in which HO-1 expression is artificially regulated, and this system is effective in simultaneously containing anti-obesity and anti-inflammatory activities. It is intended to be applied to search for component extracts.

As can be seen through the present invention, it is possible to screen those having anti-obesity and/or anti-inflammatory activity among natural products through precursor adipocytes in which the expression of heme oxygenase-1 (HO-1) is artificially regulated.

1 is a diagram showing the preparation of the shRNA HO-1 gene recombination plasmid.
1 is a result of preparing a recombinant plasmid to suppress the expression of the ho-1 gene. The pSUPER plasmid vector contains an RNA promoter, and the inserted gene contains the nucleotide sequence of a portion of the ho-1 gene designed to induce the hairpin structure. The pSUPER-HO-1 plasmid DNA introduced into the cell is produced in the form of hairpin-like RNA, cut by dicer, and the fragment is converted into a single helix, which is actually produced from the ho-1 gene of the chromosome in the cell. It forms a double helix form of complementary bonds with RNA. This RNA structure is recognized as an abnormal form and degraded, preventing the synthesis of HO-1 protein in the cell.
2 is a diagram showing the preparation of a recombinant plasmid expressing HO-1 gene.
PcDNA3 shown in FIG. 2 is an expression vector designed for gene expression in animal cells. It contains a typical cytomegalovirus (CMV) promoter, which can strongly induce gene expression, and contains Ampicillin and Neomycin resistance genes. Ampicillin resistance gene is used as a selection marker to select bacteria into which the corresponding plasmid DNA has been introduced, and neomycine resistance gene is used as a selection marker to select animal cells into which the corresponding plasmid DNA has been introduced. There are also multiple cloning sites for cloning foreign genes.
3 is a diagram showing the production of HO-1 gene expression-regulated adipocytes and analysis of the function of HO-1 to inhibit adipocyte differentiation.
4 is a diagram showing an increase in the expression of C/EBPα in the adipocyte differentiation process (FIG. 4a) and a decrease in the expression of C/EBPα in shRNA HO-1 expressing adipocytes (FIG. 4B). (
5 is a diagram showing the anti-inflammatory and adipocyte differentiation inhibitory effects of the ethanol extract of HO-1 dependent white paper.
6 is a diagram showing a cleavage map for the pSUPER plasmid vector.

Hereinafter, the present invention will be described in more detail through non-limiting examples. However, the following examples are described with the intention of illustrating the present invention, and the scope of the present invention is not to be construed as being limited by the following examples.

The antibody used in the present invention is C/EBP, SC61; Santa Cruz Biotechnology, Santa Cruz, CA, HO-1 is H105; Santa Cruz Biotechnology, Santa Cruz, CA, AC-15 for beta-actin; Sigma, St. Louis, MO, iNOS, 54; Transduction Laboratories, Purchased from Lexington, KY.

Manufacturing example 1:3 T3 - L1 Cell culture medium

Standard medium is Dulbecco's modified Eagle medium (High glucose, Hyclone, ASA28186), 4.00mM L-Glutamine, 450mg/L glucose, Sodium pyruvate (0.1㎛ sterilized filtered), 10% BCS (GIBCO, Cat. 26170-043, Lot. 605022) and 1% Antibiotics (Hycolne, Penicillin-Streptomycin 10,000 µg/ml) were used, and the medium was stored at 4°C.

The induced differentiation medium was Dulbecco's modified Eagle medium (High glucose, Hyclone, ASA28186), 4.00mM L-Glutamine, 450mg/L glucose, Sodium pyruvate (0.1㎛ sterilized filtered), 10% FBS, 1% Antibiotics (Hycolne, Penicillin-Streptomycin 10,000㎍/ml), 250 nM Dexamethasone (Aldrich, 861871), 100uM 3-Isobutyl-1-Methylxanthine (Sigma, I5879), 10㎍/ml bovine pancreatic insulin solution (Sigma, I0516) and 1% BSA A medium containing was used.

Manufacturing example 2: Preparation of derived material

IBMX

21.25mg 3-Isobutyl-1-Methylxanthine was added to the vial, 2ml ddH ₂ O was added, and 100µl 1N NaOH was added and rotated to make a transparent liquid. After that, Add 7.6ml ddH ₂ O was added, and the liquid was sterilized through a 0.45 μm filter and stored at -80°C (stable for several months). After thawing, it was stored at 4°C.

Dexamethasone

After 4mg Dexamethasone was added to the vial and dissolved in 20.38ml ddH2O, the liquid was sterilized and filtered through a 0.45㎛ filter and stored at -80℃.

Manufacturing example 3: Insulin solution derived from bovine pancreas

1 ml insulin (10 mg/ml) was added to the vial, and mixed with 9 ml 0.0125 N HCl (pH 2.0). The liquid was sterilized through a 0.45 μm filter and stored at -80°C.

Manufacturing example 4: Maintenance ( Maintenance ) Badge

Dulbecco's modified Eagle medium (High glucose, Hyclone, ASA28186), 4.00mM L-Glutamine, 450mg/L glucose, Sodium pyruvate (0.1㎛ sterile filtered), 10% FBS, 1% Antibiotics (Hycolne, Penicillin-Streptomycin 10,000㎍/ ml), 1 mg/ml insulin solution (final concentration: 10 μg/ml) was used, and the medium was stored at 4°C.

Experimental example 1: of cultured cells Oil Red O dyeing

After culturing in a tissue culture plate and treating the cultured cells as described above, take out the plate (35-mm) from the incubator to remove the medium, add ~2 ml of PBS to wash the cells, and completely remove the PBS. 2 ml of 10% formalin (RT) was added and incubated for 10 minutes at room temperature.

After that, the formalin was removed, 2 ml of fresh promalin was added, and incubated for at least 1 hour or longer (cells can be maintained in formalin for several days before staining). Then, to protect the cells from drying, they were covered with aluminum foil and wrapped with parafilm.

Then, the formalin was removed with a pipette, and the cells were washed twice with 2 ml of ddH2O, and then the cells were washed with 2 ml of 60% isopropanol for 5 minutes at room temperature, and then the cells were completely dried at room temperature. If necessary, the cells were dried using a hair dryer.

1 ml of Oil Red O working solution was added and incubated at room temperature for 10 minutes.

Then, the Oil Red O solution was removed, ddH2O was immediately added, and the cells were washed 4 times with ddH2O.

Next, a picture was taken under a microscope for analysis.

After removing all moisture and drying, add 1 ml of 100% isopropanol and incubate for 10 minutes to elute the Oil Red O dye, and then pipette Oil Red O several times with isopropanol so that all Oil Red O is in solution. I made a round trip. Then, the solution was transferred to a 1.5-ml Eppendorf tube, and the OD was measured at 500 nm using 100% isopropanol as a blank.

The reagents used in this example and the preparation method thereof are as follows.

Oil Red O stock :

Sigma (Cat# O-0625), FW 408.5. Weigh 0.35 g Oil Red O was measured, added to 100 ml of isopropanol, stirred, filtered (0.2 μm), and stored at room temperature.

Oil Red O Working solution:

6 ml of the Oil Red O stock solution and 4 ml of ddH2O were mixed, maintained at room temperature for 20 minutes, and then filtered (0.2 μm).

10% Formalin ( PBS of mine):

27 ml of formalin solution (37%, Merck, Cat# K36658003) was diluted with 63 ml of ddH2O and 10 ml of 10X PBS.

100% Isopropanol (Merck, Cat# K36543834)

60% isopropanol :

Mix 6 ml of 100% isopropanol with 4 ml of ddH2O.

Example One: pSUPER - HO -1 Recombinant Plasmid Preparation

100 nmole/ml of each of the following two oligonucleotides in a 1.5 ml microtube,

Sense-gatccccgcacagggtgacagaagattcaagagatcttctgtcaccctgtgcctttttggaaa (SEQ ID NO: 2)

Antisense-agcttttccaaaaaggcacagggtgacagaagatctcttgaatcttctgtcaccctgtgcggg (SEQ ID NO: 3)

5 ml of 10X Annealing Buffer (100 mM Tris-HCl, pH 7.5, 1 M NaCl, 10 mM EDTA) was added. After that, fill 50 ml of the final volume with Nuclease-free water, heat at 100°C, wait 2 hours for the temperature to drop to 30°C, and then add 1 mg pSUPER plasmid (OligoEngine, USA) in a 1.5 ml microtube with the annealed oligonucleotide ( BamHI/XhoI restriction enzyme cut), add 1 ml of T4 DNA ligase (10 Units/ml) to this, ligation at 16°C for 14 hours, transform into E.coli and confirm, and then recombinant plasmid DNA was confirmed. Got it. For more information on the plasmid of the present invention, refer to the catalog number VEC-PBS-0004 (circular) of the pSUPER.neo vector of the manufacturer's website, www.oligoengine.com, and the protocol therefor.

Example 2: pcDNA3 - HO -1 recombinant plasmid

RNA was extracted from the A549 cell line. RNA extraction was performed using a Trizol RNA extraction kit (Invitrogen 15596-018). Using the extracted RNA as a template, HO-1 cDNA was synthesized by RT-PCR. For cDNA synthesis, use 2 mg Total RNA, 1 ml Oligo dT (1mM), 4 ml dNTP (each 2.5mM), 20 units of M-MLV reverse transcriptase (Promega #M1701), and DEPC water to adjust the final volume of the reaction to 20 ul. Fit. The reaction was carried out at 70° C. for 15 minutes and at 42° C. for 60 minutes to obtain cDNA.

HO-1 cDNA generation proceeds with the following reaction. Prepare a mixture of 2 mg cDNA, 10 mM primer (forward and reward, respectively), 2.5 unit of i-MAX II DNA polymerase (Intron biotechnology #25261), and 4 ml dNTP (2.5 mM each) in a PCR tube. PCR reaction conditions are set at 95°C, 5 min, (95°C, 30 sec; 55°C, 30 sec; 72°C, 1 min 30 cycles), 72°C, 10 min. The base sequence of the HO-1 primer used at this time is as follows; Forward HindIII-HO-1 5'-aagcttatggagcgtccgcaacccga-3' (SEQ ID NO: 4), Reward XhoI-HO-1 5'-ctcgagagttcatggccctgggagcc-3' (SEQ ID NO: 5).

Example 3: ho -1 gene expression system ( ho -1 gene overexpression system in pcDNA3 and ho -1 gene Production of a precursor fat cell line (stable cell line) incorporating knockdown system in pSUPER) into chromosomes

It was produced in the following order.

1) A 3x10 ⁵ /6-well 3T3L1 precursor adipocyte line was plated.

2) When 16 hours elapsed after plating, a transfection experiment in which plasmid DNA was introduced into the cell line was started. Transfection was performed by using a reagent of FuGENE-6 (Roche company).

It is carried out in a sterile bench and the experiment process is as follows.

250 ml of OPTI-MEM (phenol-red free) culture solution was added to a sterilized 1.5 ml microtube, followed by 9 ml of FuGENE-6, followed by tapping. 3 mg of pcDNA3, pcDNA3-HO-1, pSUPER, or pSUPER-HO-1 plasmids were each added, followed by tapping.

It was reacted at room temperature for 30 minutes.

The reaction was treated in the cell line in each prepared 6-well.

3) After 24 hours, the precursor fat cell line was washed twice with phosphate buffer saline (PBS) solution and treated with 0.35 ml trypsin-EDTA. After reacting for 1 minute in a CO2 cell incubator, when all attached cells were detached, 3 ml of the cell culture solution was treated to lose the activity of trypsin-EDTA.

After gently suspending each cell line, it was transferred to a culture dish (diameter 100 mm) in the following ratio (1 ml of the above detached cell line suspension culture + 9 ml of a new culture solution).

4) After incubation for 24 hours, 500 mg/ml neomycin was treated to select a cell line containing the introduced ho-1 gene recombinant plasmid (neomycin resistance gene present). When 50% of the cultured cell lines died 5 days after the first treatment, the cells were washed with PBS and replaced with a new culture solution (containing 500 mg/ml neomycin). This process was repeated every 2 days, and after 2 weeks, clones having a cell population (colony type) that survived were separated and proliferated. RNA or protein was extracted from each clone, and the expression of HO-1 was confirmed by RT-PCR or western blotting, and the desired stable cell clone was finally obtained.

Example 4: Preparation of white paper extract and evaluation of anti-obesity activity

Preparation of white paper extract

Commercially available dry white paper was cut and pulverized to obtain a powdery form. 1 L of 70% ethanol was added as an extraction solvent to 50 g of the obtained white paper powder sample, put in a stirrer (manufacturer: Heidolph, standard: MR 3001, MR3001K), and stirred at 300 rpm for 3 hours to extract. After the extraction solution was filtered under reduced pressure using filter paper, the recovered filtrate was concentrated under reduced pressure at 45° C. with a concentrator (Heidolph, LABOROTA 4000) to prepare a white paper extract.

Of white paper extract Anti-obesity Activity evaluation

The anti-obesity activity of the ethanol extract of white paper was determined by analyzing the effect on the degree of differentiation of adipocyte precursor cell lines. Under the conditions for starting differentiation of the adipocyte precursor cell line, ethanol extract of white paper was treated together. To measure the differentiation of adipocytes, the oil red O staining method was used to directly check on a microscope and then photographs were taken. The degree of differentiation was quantitatively compared and analyzed by measuring the absorbance at 500 nm using a spectrophotometer.

Differentiation conditions of the adipocyte precursor cell line are as follows.

1) 1 x 10 ⁶ /6-well 3T3-L1 cell line was plated (using standard culture medium).

2) It was cultured to have a confluent distribution.

3) After washing with PBS, the medium was changed. (Use of differentiation medium)

4) Incubated for 2 days.

5) After washing with PBS, the medium was changed. (Use of maintenance culture medium)

6) After that, it was incubated for 12 days. (Replace the maintenance medium every 2 days with a new one)

7) Oil red O staining was performed to observe the differentiation of adipocytes, and the degree of differentiation was measured at 500 nm using a spectrophotometer.

Immunoblotting in b of FIG. 3 is a result of confirming the change in ho-1 expression at the protein level by preparing a stable cell line in which the two types of ho-1 gene expression plasmids prepared above were introduced into the chromosome of 3T3L1 adipocytes. The analysis of HO-1 protein expression was performed using the Immunoblotting method. Each cell line was washed with PBS buffer, treated with 200 ml of lysis buffer (10 mM Tris-Cl, 1% Triton X-100, pH 7.6), reacted for 5 minutes at room temperature, and then centrifuged at 12000 rpm for 10 minutes. The supernatant was collected.

Protein was quantified from the supernatant containing the cytoplasmic contents. For protein quantification, the Bradford (Sigma Cat# B6916) method was used (2 ml of sample + 2 ml of distilled water + 200 ml of Bradford reagent), and the absorbance value was measured at 595 nm using a spectrophotometer to correct the amount between samples. Protein quantification was calculated using a standard curve prepared using bovine serum albumin 0.1-1.4 mg/ml).

30 mg of protein was loaded per well, and the protein was separated by electrophoresis at 120 voltage using 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. The membrane to which the protein was transferred was reacted at room temperature for 2 hours with a 5% milk aqueous solution diluted with HO-1 antibody in a ratio of 1:1000 or beta-actin antibody in a ratio of 1:5000. A 5% milk aqueous solution diluted 1:3000 with a secondary antibody (anti-rabbit IgG for iNOS and HO-1 or anti-mouse IgG for beta-actin), washed 3 times with 10 ml aqueous PBS solution at intervals of 10 minutes After reacting at room temperature for 1 hour, it was washed 3 times in the same manner. Membrane was reacted with an ECL aqueous solution (Ab Frontier, Cat# LF-QC0101) for 1 minute at room temperature, and then the HO-1 protein was fluorescently sensitized in a dark room to be printed and confirmed on an X-ray film. Compared to the parent, pcDNA3, and pSUPER cell lines, the expression of HO-1 was increased in the pcDNA3-HO-1 cell line, but significantly decreased in the pSUPER-HO-1 cell line. Figure 3a is the result of analyzing the effect of the expression of ho-1 on differentiation by differentiating two types of the verified precursor adipocytes by the Oir red O staining method (experimental method described above). This is the value measured by the spectrophotometer. When the expression of HO-1 was inhibited, the differentiation of adipocytes was significantly increased compared to the control (cells into which the vector plasmid was introduced), but when the expression of HO-1 was artificially increased, the differentiation of adipocytes was compared with the control. This shows a remarkably reduced pattern. Taken together, it can be suggested that the HO-1 protein inhibits the differentiation of adipocytes.

5 is a result of analyzing the effect of the ethanol extract of white paper on the expression of HO-1 having a function of inhibiting differentiation of adipocytes.

As shown in Figure 5a, the ethanol extract of white paper significantly increases the expression of HO-1 at the protein level in proportion to the amount treated.

In the case of Caffeine, an anti-obesity substance, which is well known for its inhibitory effect on adipocyte differentiation, it does not appear to have a significant effect on the expression of HO-1.

Figure 5b shows that the increase in the expression of inducible nitric oxide synthase (iNOS), which is an inflammation-inducing factor, in mouse RAW264.7 macrophages treated with 100 ng/ml of Lipopolysaccharide (LPS) for 24 hours, when pre-treated with a blank ethanol extract for 30 minutes It shows a remarkably reduced result.

Figure 5c shows the excellent results compared to caffeine in the adipocyte inhibitory effect of white paper, and this effect shows a remarkably reduced pattern in the cells in which the expression of the ho-1 gene is suppressed.

In the experimental process in FIG. 5A, the cells were cultured for 24 hours after the 3T3-L1 adipocyte progenitor cell line was treated with a corresponding amount of white paper ethanol extract or Caffeine (1 mM).

In the experimental process in Figure 5b, RAW 264.7 mouse macrophages were cultured in a culture solution containing DMEM high glucose, 10% FBS, 25 mM HEPES (pH 7.4), and then treated with 500 ug/ml of white paper ethanol extract for 30 minutes. I did. Then, 100 ng/ml LPS was treated for 24 hours to wash the cell line with PBS buffer, and 200 ml of lysis buffer (10 mM Tris-Cl, 1% Triton X-100, pH 7.6) was treated and reacted at room temperature for 5 minutes. After that, the supernatant was collected by centrifugation at 12000 rpm for 10 minutes.

Protein was quantified from the supernatant containing the cytoplasmic contents. For protein quantification, the Bradford (Sigma Cat# B6916) method was used (2 ml of sample + 2 ml of distilled water + 200 ml of Bradford reagent), and the absorbance value was measured at 595 nm using a spectrophotometer to correct the amount between samples.

Protein quantification was calculated using a standard curve prepared using bovine serum albumin 0.1-1.4 mg/ml).

30 mg of protein was loaded per well, and the protein was separated by electrophoresis at 120 voltage using 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. The membrane to which the protein was transferred was reacted at room temperature for 2 hours with a 5% milk aqueous solution diluted with iNOS antibody at a ratio of 1:1000, HO-1 antibody at a ratio of 1:1000, or beta-actin antibody at a ratio of 1:5000. A 5% milk aqueous solution diluted 1:3000 with a secondary antibody (anti-rabbit IgG for iNOS and HO-1 or anti-mouse IgG for beta-actin), washed 3 times with 10 ml aqueous PBS solution at intervals of 10 minutes After reacting at room temperature for 1 hour, it was washed 3 times in the same manner. Membrane was reacted with ECL aqueous solution (Ab Frontier, Cat# LF-QC0101) for 1 minute at room temperature, and then C/EBP alpha protein was fluorescently photosensitive in the dark, and then printed and confirmed on an X-ray film.

In the case of FIG. 5C, the experiment was performed under the same conditions as in FIG. 1.

Example 5: Increased expression of C/E and shRNA in adipocyte differentiation process HO -1 expression in fat cells decreased the expression of C / EBP

4A is a result of investigation of the expression of C/EBP alpha, a transcriptional regulatory protein important for the expression of differentiation-related Adipokine genes in the process of differentiation of adipocytes.

On the 2nd day of adipocyte differentiation, the expression of C/EBP alpha started to increase, and the maximum expression was increased on the 4th day. This increase in the expression of C/EBP alpha shows a result of a further increase in pSUPER-HO-1 cells in which the expression of the ho-1 gene is suppressed (FIG. 4B).

In the experimental procedure, the adipocyte progenitor cell line was differentiated under the conditions described in Example 4.

Under each time condition, the cell line was washed with PBS buffer, treated with 200 ml of lysis buffer (10 mM Tris-Cl, 1% Triton X-100, pH 7.6), reacted at room temperature for 5 minutes, and then reacted at 12000 rpm for 10 minutes. The supernatant was collected by centrifugation. Protein was quantified from the supernatant containing the cytoplasmic contents. For protein quantification, the Bradford (Sigma Cat# B6916) method was used (2 ml of sample + 2 ml of distilled water + 200 ml of Bradford reagent), and the absorbance value was measured at 595 nm using a spectrophotometer to correct the amount between samples. Protein quantification was calculated using a standard curve prepared using bovine serum albumin 0.1-1.4 mg/ml).

30 mg of protein was loaded per well, and the protein was separated by electrophoresis at 120 voltage using 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. The membrane to which the protein has been moved is diluted with C/EBP alpha antibody at a ratio of 1:1000, HO-1 antibody at a ratio of 1:1000, or beta-actin antibody at a ratio of 1:5000 at room temperature for 2 hours. Reacted. A 5% milk aqueous solution diluted 1:3000 with a secondary antibody (anti-rabbit IgG for iNOS and HO-1 or anti-mouse IgG for beta-actin), washed 3 times with 10 ml aqueous PBS solution at intervals of 10 minutes After reacting at room temperature for 1 hour, it was washed 3 times in the same manner. Membrane was reacted with ECL aqueous solution (Ab Frontier, Cat# LF-QC0101) for 1 minute at room temperature, and then C/EBP alpha protein was fluorescently photosensitive in the dark, and then printed and confirmed on an X-ray film.

On the 2nd day of adipocyte differentiation, the expression of C/EBP alpha started to increase, and the maximum expression was increased on the 4th day. This increase in the expression of C/EBP alpha shows a result of a further increase in the cells in which the expression of the ho-1 gene is suppressed (FIG. 4B).

Attach electronic file of sequence list

Claims (8)

delete delete delete delete delete delete delete a) Heme oxidase- containing a nucleotide sequence of the hem sequence consisting of the nucleotide sequence of SEQ ID NOS: 2 and 3 to induce the hairpin structure and the nucleotide sequence of SEQ ID NO: 1 containing the RNA promoter 1, a step of treating the herbal extract to adipocytes prepared by introducing a recombinant plasmid for inhibiting gene expression into a precursor adipocyte line;
b) measuring the expression level of the heme oxidase-1 gene after treating the herbal extract to the cells; And
c) A method of confirming that a white paper extract is included in the Chinese herbal extract comprising the step of determining that the herbal extract contains a white paper extract when the expression of the heme oxidase-1 gene is increased.

Images