CN105920602B

CN105920602B - Application of NF-kappa B p65/HMGCS2 regulation pathway in preparation of medicine for regulating synthesis of ketone body

Info

Publication number: CN105920602B
Application number: CN201610495233.2A
Authority: CN
Inventors: 龙建纲; 时乐; 刘健康; 赵黛娜; 秦川; 王永耀
Original assignee: Xian Jiaotong University
Current assignee: Xian Jiaotong University
Priority date: 2016-06-28
Filing date: 2016-06-28
Publication date: 2021-07-06
Anticipated expiration: 2036-06-28
Also published as: CN105920602A

Abstract

The invention discloses an application of NF-kappa B p65/HMGCS2 regulation and control approach as a drug target in preparing drugs and health products for regulating and controlling ketone body synthesis; NF-kappa B p65 is bound by HMGCS2 promoter, the expression of the enzyme is regulated from the transcription level, and HMGCS2 influences the synthesis level of ketone body; can activate NF-kappa B p65, regulate the expression of HMGCS2 from the transcription level, further regulate the metabolism of ketone bodies, indirectly enhance the synthesis of the ketone bodies, improve the energy metabolism of nerve cells and the like, and finally play a role in preventing and treating neurodegenerative diseases.

Description

Application of NF-kappa B p65/HMGCS2 regulation pathway in preparation of medicine for regulating synthesis of ketone body

Technical Field

The invention belongs to the technical field of medicines for regulating and controlling ketone body synthesis, and relates to application of a NF-kappa B p65/HMGCS2 regulation and control approach in preparation of medicines for regulating and controlling ketone body synthesis.

Background

Ketone bodies are the collective term for acetoacetate, β -hydroxybutyrate (β -OHB) and acetone in mammals. Ketogenesis, the synthesis of ketone bodies, is a branch of mammalian metabolism. As levels of glucose metabolism decrease, levels of ketone bodies produced by the liver increase. The synthesis of ketone bodies occurs mainly in the liver, and moreover, astrocytes in the brain can also produce small amounts of ketone bodies. In the case of glucose insufficiency, ketone bodies are used as energy substrates for extrahepatic tissues.

In recent years, studies have found that ketone bodies appear early in AD as a surrogate for glucose energy supply and decline as the disease progresses. The research shows that the ketogenic diet has protective effect on neurodegenerative diseases such as Parkinson and AD. Medium chain triglycerides improve memory performance in AD patients, and memory improvement is positively correlated with beta OHB plasma levels produced by medium chain triglyceride oxidation. Further studies have shown that direct use of β OHB at concentrations consistent with ketogenic diets also has neuroprotective effects. bHB was found to protect hippocampal neurons against A β toxicity using a D-beta-hydroybutyrate (bHB) effect A β -induced AD cell model.

Through the regulation and control of some key enzymes in the ketonic process, the level of ketone bodies can be controlled, and further, the energy metabolic pathway in vivo is influenced. Wherein the process of controlling HMG-CoA formation by hydroxymethyl glutaryl-CoA synthetase (HMGCS 2) is the rate-limiting step in ketone body formation. Studies have shown that HMGCS2 is co-regulated at both the transcriptional and translational levels. At the transcriptional level, HMGCS2 is regulated by at least three pathways. One pathway involves the forkhead transcription factor FOXA2 (Forkhead box A2). FKHRL1 in the FOX family of transcription factors FKHR (forkhead in rhabdosaroma) is also involved in the regulation of the HMGCS2 transcriptional pathway. In addition, HMGCS2 transcriptional level regulation is associated with mTORC1 (mammlian target of rapamycin complex 1), PPAR α (Peroxisome promoter activated receptor α) and FGF21(Fibroblast growth factor 21). These transcription factors bind to the HMGCS2 promoter sequence and regulate the expression of the gene at the transcriptional level. At the translational level, the activity of HMGCS2 is also regulated by acetylation and succinylation. It was found that HMGCS2 contains some SIRT3 regulated acetylation sites. However, the modification and regulatory functions of these sites are not yet known.

The nuclear factor NF-kB is expressed in various cells and mainly relates to information transmission in the processes of body defense reaction, tissue injury and stress, cell differentiation, apoptosis and the like. NF-. kappa.B is in an inactive state in most cell cytoplasm, and is activated into the nucleus to affect transcription of genes when an information substance acts on a corresponding receptor. In addition, studies have demonstrated that inflammation plays an important role in fat metabolism and sugar metabolism. The production of inflammatory factors can inhibit liver fat synthesis and fatty liver formation.

Disclosure of Invention

The invention aims to provide the application of the NF-kappa B p65/HMGCS2 regulation and control approach in preparing a medicine for regulating and controlling ketone body synthesis, can be used as a molecular target for preparing ketogenic medicines and foods, and particularly can be used for preparing medicines and foods for preventing and treating neurodegenerative diseases.

The invention is realized by the following technical scheme:

the NF-kappa B p65/HMGCS2 regulation and control approach is used as a medicine target to prepare medicines and health care products for regulating and controlling ketone body synthesis.

The NF-kappa B p65/HMGCS2 regulation and control way is applied to the preparation of ketogenic drugs and health products as a drug target.

The NF-kappa B p65/HMGCS2 regulation and control approach is used as a medicine target to prepare medicines and health care products for preventing and treating neurodegenerative diseases.

The medicine and the health care product influence the combination of NF-kappa B p65 and a promoter of ketone body synthetase HMGCS2, regulate the expression of HMGCS2 from the transcription level and influence the synthesis level of ketone bodies.

The drug is a drug for activating NF-kappa B p65, enhances the expression of HMGCS2 from the transcription level and indirectly enhances the synthesis of ketone bodies.

The drug is an inflammatory factor, an expression vector or a compound drug for enhancing the expression of NF-kappa B p 65.

The drug is a drug which affects the binding site of NF-kappa B p65 and HMGCS2 promoter.

The drug enhances or inhibits the combination of NF-kappa B p65 and GGAAGACCT site on HMGCS2 promoter.

The application of a medicament for activating NF-kappa B p65 in preparing a medicament for regulating and controlling ketone body synthesis.

The application of a drug or a vector for regulating NF-kappa B p65 expression in preparing a drug for regulating the synthesis of ketone bodies.

Compared with the prior art, the invention has the following beneficial technical effects:

the NF-kappa B p65/HMGCS2 regulation and control approach provided by the invention is applied to the preparation of a medicine for regulating and controlling the synthesis of ketone bodies, NF-kappa B p65 is combined through an HMGCS2 promoter, the expression of the enzyme is regulated and controlled from the transcription level, and HMGCS2 influences the synthesis level of the ketone bodies; can activate NF-kappa B p65, regulate the expression of HMGCS2 from the transcription level, further regulate the metabolism of ketone bodies, indirectly enhance the synthesis of the ketone bodies, improve the energy metabolism of nerve cells and the like, and finally play a role in preventing and treating neurodegenerative diseases. The activation of NF-kappa B p65 can be realized by various ways, NF-kappa B p65 can be activated by molecules such as interleukin-6, and the expression of a ketobody beta OHB synthesis rate-limiting enzyme HMGCS2 can be promoted; provides a way to prevent and treat neurodegenerative diseases through relatively common medicines.

The NF-kappa B p65/HMGCS2 regulation and control approach of the invention depends on the combination of NF-kappa B p65 and HMGCS2 promoter, the experiment of the invention shows that the activity of HMGCS2 promoter can be increased by 40% by enhancing NF-kappa B p65 through IL-6, and the mRNA level of HMGCS2 is reduced by about 70% after NF-kappa BsiRNA p65 is knocked out of NF-kappa B p 65; the NF-kappa B p65 is enhanced through the combination effect of the E-box1 and the HMGCS2 promoter, thereby indirectly regulating and controlling the synthesis level of ketone bodies, so that the NF-kappa B p65/HMGCS2 regulation and control approach as a drug target can be applied to the preparation of ketogenic drugs and foods, in particular to the preparation of drugs and foods for preventing and treating neurodegenerative diseases.

Drawings

FIG. 1 is a graph of the effect of interleukin-6 on cell activity; the proliferation of cells was observed after treatment with different concentrations of IL-6.

FIG. 2-1 shows the result of detecting proteins of NF- κ B p65 activated by IL-6; FIG. 2-2 shows the fluorescence detection result of IL-6 activating NF- κ B p 65.

FIG. 3-1 is a graph showing the effect of IL-6 on the promotion of ketone body β OHB levels; FIG. 3-2 is a graph showing the effect of IL-6 on the level of mRNA for the ketone body anabolic enzyme HMGCS 2; FIGS. 3-3 are graphs showing the effect of IL-6 on protein levels of HMGCS 2; FIGS. 3-4 show the effect of IL-6 on the activity of the HMGCS2 promoter.

FIG. 4-1 shows the result of detecting HMGCS2mRNA level by NF- κ B p65 knock-out; FIG. 4-2 shows the results of detection of HMGCS2 protein level by NF- κ B p65 knock-out; FIGS. 4-3 show the results of the NF-. kappa. B p65 knock-out assay for HMGCS2 promoter activity.

FIG. 5-1 is a prediction of the potential NF-. kappa. B p65 binding site of the HMGCS2 promoter; FIG. 5-2 is a graph showing the detection of potential sites of the HMGCS2 promoter for NF- κ B p65 binding; FIGS. 5-3 are the assays of whether NF-. kappa. B p65 binds directly to the HMGCS2 promoter site.

Detailed Description

The present invention will now be described in further detail with reference to specific examples, which are intended to be illustrative, but not limiting, of the invention.

HepG2 is a liver cancer cell line and is a cell model commonly used for researching liver cells, IL-6 is a commonly used factor activated by NF-kappa B p65, transient transfection siRNA is a commonly used in-vitro knockout method, and in order to observe the influence of NF-kappa B p65 on the metabolism of liver cell ketone bodies and the action mechanism thereof, HepG2 is selected as a cell model, and the NF-kappa B p65siRNA method is adopted as a cell model for in-vitro knockout.

Effect of 1 IL-6 on cellular Activity

The confluent cells were passaged in 96-well plates, and 10 or 30ng/mL IL-6 was added after 24 hours, and cell viability was measured after incubation for 12 and 24 hours. Preparing 3- (4, 5-dimethylthiazole-2) -2, 5-diphenyl tetrazolium bromide (MTT, 5mg/ml) by using a serum-free culture medium according to the ratio of 1:10, adding the mixed solution into cells, and incubating for 1 hour in an incubator. Then, the supernatant was removed, and 100. mu.L of DMSO was added to dissolve the crystals sufficiently. The absorbance of each well was measured in an enzyme linked immunosorbent assay OD490 nm.

As shown in FIG. 1, the abscissa of the graph represents the action time of IL-6 at different concentrations, and the ordinate of the graph represents the OD value of absorbance, it can be seen that IL-6 at different concentrations has no significant effect on the proliferation of cells during the observation time.

2.1 detection of proteins with IL-6 activation of NF- κ B p65

Culturing HepG2 cells in a 100mm culture dish, discarding the culture medium when the cells grow to about 80%, adding the culture medium containing 30ng/mL IL-6 into the culture dish, adding the culture medium into a blank group, culturing for 0.5 h, separating cell nuclei and cell pulp by using a Biyunshi cell nucleus protein and cell pulp protein extraction kit, and detecting the expression condition of NF-kappa B p65 in the cells treated by the IL-6 in the cell nuclei and the cell pulp by using western blots.

As shown in FIG. 2-1, NF-. kappa. B p65 was normally distributed in the cytoplasm, and after IL-6 treatment, the cytoplasmic NF-. kappa. B p65 content was slightly increased, and the expression level of NF-. kappa. B p65 in the nucleus was increased.

2.2 fluorescent detection of IL-6 activation of NF- κ B p65

HepG2 cells were packed at 6X 10⁴Passage of cultureIn 12-well plates pre-plated with sterilized slides. The next day, medium was discarded, medium at 30ng/mL IL-6 was added to the well plate, medium was added to the blank, after 0.5 hour treatment, medium was discarded, PBS washed 2 times, 4% paraformaldehyde fixed for 15 minutes, PBS washed 3 times, 5 minutes each, 0.2% Triton100 treated for 7 minutes, PBS washed 3 times, 5 minutes each, 2% BSA blocked for 1 hour, and primary antibody incubated overnight. The next day, PBS wash 3 times for 5 minutes each, FITC-labeled goat anti-rabbit IgG 1 hour, PBS wash 3 times for 5 minutes each, DAPI treatment 10 minutes, PBS wash 3 times for 5 minutes each, anti-quenching fluorescent mounting medium mounting, and imaging under a fluorescent microscope to observe the cellular localization of NF- κ B p 65.

As shown in FIG. 2-2, NF-. kappa. B p65 was normally localized to the cytoplasm, and NF-. kappa. B p65 was activated for translocation into the nucleus when HepG2 cells were treated with IL-6 at a concentration of 30 ng/mL.

The regulation of ketone body synthesis levels by NF-. kappa. B p65 is demonstrated by the activation of NF-. kappa. B p65 by IL-6.

3.1 Effect of IL-6 on beta OHB levels

HepG2 cells were cultured in 100mm dishes until the cells grew to around 80%, the medium was discarded, medium containing 30ng/mL IL-6 was added to the dishes, the blank was added with medium, and cultured for 24 hours, and the effect of IL-6 on the level of beta OHB of the cell ketone bodies was observed. At the observation point, the intracellular β OHB level was detected using an ELISA kit.

The results are shown in FIG. 3-1, with the abscissa being the concentration of IL-6 and the ordinate being the β OHB levels, from which it can be seen that 30ng/mL IL-6 was able to significantly elevate cellular β OHB levels.

3.2 modulation of Ketone anabolic enzyme HMGCS2mRNA levels by IL-6

HepG2 cells were cultured in 6-well plates, and when the cells grew to about 80%, the medium was discarded, and a medium containing 30ng/mL IL-6 was added to the well plates, and the blank group was added with the medium, cultured for 0.5 hour, and the effect of IL-6 on the cell ketone body metabolizing enzyme HMGCS2 was observed. Detecting the intracellular HMGCS2mRNA level by using a real-time quantitative PCR instrument at an observation point;

the upstream of the primer sequence of HMGCS2 is AAGTCTCTGGCTCGCCTGATGT; downstream is TCCAGGTCCTTGTTGGTGTAGG;

the upstream of the beta-actin primer sequence is TGCGTGACATTAAGGAGAAG; downstream is GCTCGTAGCTCTTCTCCA.

The results are shown in FIG. 3-2, with the concentration of IL-6 on the abscissa and the relative level of HMGCS2mRNA on the ordinate of the graph. As can be seen, 30ng/mL IL-6 was able to significantly elevate cellular HMGCS2mRNA levels.

3.3 modulation of Ketone anabolic enzyme HMGCS2 protein levels by IL-6

HepG2 cells were cultured in 6-well plates, and when the cells grew to about 80%, the medium was discarded, and a medium containing 30ng/mL IL-6 was added to the plates, and a blank group was added with the medium, and cultured for 24 hours, and the effect of IL-6 on the expression of the cellular ketone body metabolizing enzyme HMGCS2 protein was observed. At the observation point, intracellular HMGCS2 protein levels were detected using a western blot.

The results are shown in FIGS. 3-3, with the concentration of IL-6 on the abscissa and the relative level of HMGCS2 protein on the ordinate of the graph. It can be seen that 30ng/mL IL-6 was able to significantly elevate cellular HMGCS2 protein levels.

3.4 Effect of IL-6 on the Activity of the HMGCS2 promoter

Constructing pGL-HMGCS2 plasmid, firstly finding 2000bp base upstream of initiation codon of human HMGCS2 at NCBI, designing a pair of primers for amplifying the 2000bp promoter sequence, adding restriction endonuclease sites at two ends of the primers,

the upstream of the primer sequence is 5' -CGGGGTACCGAGTAGATTAAGAGTTGGGT-3’；

Downstream is 5' -CCCAAGCTTCTCCAGAGGAGCAAGCAGAA-3’；

The horizontal line parts are Kpn I and Hind III cutting sites respectively, and then the PCR products are linked to pGL3 vector by Kpn I and Hind III cutting to construct pGL3-HMGCS 2.

HepG2 cells were packed at 6X 10⁴The cells were passaged in 6-well plates and transfected every other day, 2.55. mu.L of LX-tremageNE HP DNA transfection reagent, 1. mu.g of pGL3-HMGCS2 plasmid and 20ng of internal reference (PRL-TK) plasmid were placed in 102. mu.L of serum-free medium, gently shaken for several times, and then mixed and continued for further incubation for 30 minutes. Then adding the mixed liquid into 6-well plates respectively, placing the plates into an incubator for culture for 24 hoursAfter this time, the medium was discarded, medium containing 30ng/mL IL-6 was added to the well plate, and the blank was added with medium and incubation was continued for 24 hours. The activity of the promoter of HMGCS2 was detected using the luciferase assay kit.

As shown in FIGS. 3-4, the activity of the HMGCS2 promoter was increased by 40% in IL-6-treated HepG2 cells.

4.1 detection of HMGCS2mRNA levels by NF- κ B p65 knockout

NF-. kappa. B p65siRNA sequences were purchased from Gimeracil, where

The sense strand 5'-CCUCCUUUCAGGAGAUGAATT-3' is a strand of a sense,

the antisense strand 5'-UUCAUCUCCUGAAAGGAGGTT-3' is a strand of DNA,

the negative control siRNA sequence is sense strand 5' -UUCUCCGAACGUGUCACGUTT-3,

antisense strand 5'-ACGUGACACGUUCGGAGAATT-3'.

HepG2 cells were packed at 6X 10⁴Transfer in 6-well plates, alternate day transfection. Respectively taking 3.5 mu LRNAimax and 7 mu L of 20 mu MsiRNA, respectively incubating in 150 mu L of serum-free culture medium for 5 minutes, uniformly mixing, gently shaking for a few times, and continuing to foster for 15-20 minutes. The mixed liquid was then added to each 6-well plate and placed in an incubator for 24 hours. Trizol is used for extracting total RNA of cells, cDNA is synthesized through reverse transcription, and PCR is quantified in real time through fluorescence to detect mRNA level change.

The results are shown in FIG. 4-1, with transfection negative control siRNA and NF-. kappa. B p65siRNA on the abscissa, and mRNA relative levels on the ordinate of the graph. As can be seen, the mRNA level of HMGCS2 was reduced by about 70% after knock-out of NF-. kappa. B p65 using NF-. kappa.BsiRNA p 65.

4.2 detection of HMGCS2 protein levels by NF- κ B p65 knockout

The transfection method is the same as 4.1, after the cells are transfected for 72 hours, extracting the total proteins of the cells, treating the cells by beta-mercaptoethanol to denature the proteins, and detecting the change of the protein levels by western blots.

The results are shown in FIG. 4-2, in which the abscissa represents transfection negative control siRNA and NF- κ B p65siRNA, and the ordinate represents protein relative level, and it can be seen from the figure that after NF- κ BsiRNA p65 knockdown NF- κ B p65, the expression of HMGCS2 is lower than that of the control group.

4.3 detection of HMGCS2 promoter Activity by NF-kappa B p65 knockout

HepG2 cells were packed at 6X 10⁴Transfer in 6-well plates, alternate day transfection. After negative control siRNA and NF-kappa B p65siRNA were transfected for 24 hours, 2.55. mu.L of LX-tremageNE HP DNA transfection reagent, 1. mu.g of pGL3-HMGCS2 plasmid and 20ng of internal reference (PRL-TK) plasmid were placed in 102. mu.L of serum-free medium, gently shaken several times, mixed and continued for incubation for 30 minutes. The mixed liquid was then added to each 6-well plate and placed in an incubator for 48 hours. The influence on the activity of the HMGCS2 promoter after NF-kappa B p65 knockout was detected by using the luciferase assay kit.

As shown in FIGS. 4-3, the level of HMGCS2 promoter activity was reduced by about 25% in HepG2 cells after NF- κ B p65 knock-out.

5.1 prediction of potential NF-. kappa. B p65 binding site for HMGCS2 promoter

A JASPAR online analysis software is utilized to find out a conserved binding site of NF-kappa B p65, and a human HMGCS2 Gene promoter sequence (Gene ID,3158) is found in NCBI, so that a potential NF-kappa B p65 binding site of the HMGCS2 promoter is predicted.

As a result, as shown in FIG. 5-1, a conserved binding site GGAATTTCC of NF-. kappa. B p65 was found by JASPAR on-line analysis. Bioinformatics analysis of the HMGCS2 promoter shows that 6 potential binding sites of NF-kappa B p65 are contained in the HMGCS2 promoter-2000-0 region. Respectively named E-box1(GGAAGACCT), E-box2(GGAAAATCA),

E-box3(GGGAAAATG)、E-box4(AGAGTTTCC)、

E-box5(GGAACACCC)、E-box6(GGAACATCA)。

5.2 detection of potential binding sites for NF-kappa B p65 with the HMGCS2 promoter

Based on the 6 potential binding sites predicted by the software, 6 pairs of primers containing 6 potential sites were designed, and the primer sequences were as follows:

PM 1: the upstream, ATTTAAAGATAAGATCATAGACCTAGATATCCT,

downstream, AGGATATCTAGGTCTATGATCTTATCTTTAAAT;

PM 2: the upstream, GGGAGACATTCATTTCATAAATCAGATGGCAGG,

downstream, CCTGCCATCTGATTTATGAAATGAATGTCTCCC;

PM 3: the upstream, AGCTGCAGGTCTTTGCATAAATGACTCCTTTAT,

downstream, ATAAAGGAGTCATTTATGCAAAGACCTGCAGCT;

PM 4: the upstream, CTACTATTAAAAGAGTCACACTTTGGTTTAGAA,

downstream, TTCTAAACCAAAGTGTGACTCTTTTAATAGTAG;

PM 5: upstream, CACAGAGAGGAGTGTCATACACCCAGTGAGAGT;

downstream, ACTCTCACTGGGTGTATGACACTCCTCTCTGTG;

PM 6: the upstream, GATGTGATACAACAACATACATCATAACCTCCT,

downstream, AGGAGGTTATGATGTATGTTGTTGTATCACATC.

Using pGL3-HMGCS2 constructed above as a template, 6 mutant vectors were amplified using Phanta Super-Fidelity DNA polymerase, and named M1(CATAGACCT), M2(CATAAATCA), M3(GCATAAATG), M4(AGAGTCACA), M5(CATACA CCC), and M6(CATACATCA), respectively.

HepG2 cells were packed at 6X 10⁴After passage in 6-well plates, 2.55. mu.L of LX-tremeGENE HP DNA transfection reagent, 1. mu.g of pGL3-Basic/pGL3-HMGCS2/M1/M2/M3/M4/M5/M6 plasmid/and 20ng of internal reference (PRL-TK) plasmid were placed in 102. mu.L of serum-free medium, mixed up by gentle shaking for 30 minutes and continued incubation. The mixed liquid was then added to 6-well plates, respectively, and placed in an incubator for 48 hours. The change in activity of the HMGCS2 promoter after detection of a potential binding site mutation using the luciferase assay kit.

As shown in FIG. 5-2, the HMGCS2 promoter and 6 mutant promoters were transfected into HepG2 cells, respectively. The promoter activity of HMGCS2 was reduced by about 80% after mutation of the potential binding site E-box1, the promoter activity of HMGCS2 was reduced by about 20% after mutation of the potential binding sites E-box3 and E-box6, and the promoter activity of HMGCS2 was not changed after mutation of the potential binding sites E-box2, E-box4 and E-box 5. From the above results, it was preliminarily determined that E-box1 is a binding site for NF- κ B p65 and HMGCS2 promoter.

5.3 detection of NF- κ B p65 binding directly to HMGCS2 promoter site

HepG2 was inoculated into 2 10cm plates and 8mL of each culture was added. When the cells were grown to a density of about 80%, 216. mu.L of 37% formaldehyde was added to a final concentration of about 1% and incubated at 37 ℃ for 10 minutes to crosslink the DNA with the adjacent proteins. 880. mu.L of Glycine Soulotion (10X) was added and left at room temperature for 5 minutes. The culture was removed by suction and washed twice with ice-bath PBS (1 mM PMSF in PBS and added before use). The cells were then scraped and collected into 1.5ml centrifuge tubes. Centrifuge at 2000rpm for 4 min at 4 ℃ and discard the supernatant. Add 300. mu.l SDS Lysis Buffer/dish cells containing protease inhibitor (same above) and pipette-stroke several times. Cells were lysed by sonication to cut the DNA to a size of approximately 200 and 1000 bp. In this experiment, the set ultrasonic power was 40% of the maximum power, exceeded 1 second, stopped for 1 second, and the gap time was 1 minute for a total of 8 cycles. The subsequent steps are carried out according to a Biyuntian ChIP detection kit. After obtaining DNA by ChIP kit, detecting the binding strength of different E-box and HMGCS2 promoter by real-time quantitative pcr.

The primer sequences of the 6 potential binding sites are:

HMGCS2P1(-1084--1203bp):

the upstream, TGAGTTAGAACACCAACAC,

downstream, TTCATGTTCCTACAGACAG;

HMGCS2P2(-844--953bp):

the upstream, GGTAGAGGAAGATTGGTGCTG,

downstream, CTGGTCCTTCTGCTTTGCTCT;

HMGCS2P3(-696--812bp):

the upstream, CATTCTGCAACTTCCTAGC,

downstream, GGTGACAGTTTGAAGCTCA;

HMGCS2P4(-426--548bp):

the upstream, CAACACTCACTCCCAACTC,

downstream, CACTCCTCTCTGTGGTGTTAG;

HMGCS2P5(-344--451bp):

the upstream, AACAACTAACACCACAGAGAG,

downstream, TGTATCACATCCCAAGGTAAC;

HMGCS2P6(-286—368bp):

the upstream, AGGGTTACCTTGGGATGTG,

downstream, CTCTGTGGCAGCCTTGATTC.

Human GAPDH as a control primer:

the upstream, TACTAGCGGTTTTACGGGCG,

downstream, TCGAACAGGAGGAGCAGAGAGCGA.

As shown in FIGS. 5-3, the binding effect of E-box1 to HMGCS2 promoter was enhanced, the other E-boxes did not bind to HMGCS2 promoter, and E-box1 was the binding site of NF- κ B p65 to HMGCS 2.

The combination of the above shows that: the nuclear factor NF-kappa B p65 can be combined with a promoter of ketone body synthetase HMGCS2, the expression of the enzyme is regulated from the transcription level, and HMGCS2 influences the synthesis level of ketone bodies; can activate NF-kappa B p65, regulate the expression of HMGCS2 from the transcription level, and protect AD and other neurodegenerative diseases by indirectly enhancing ketone body synthesis.

Therefore, the NF-kappa B p65/HMGCS2 can be applied to the preparation of ketogenic drugs and foods, in particular to the preparation of drugs and foods for preventing and treating neurodegenerative diseases.

The embodiments given above are preferable examples for implementing the present invention, and the present invention is not limited to the above-described embodiments. Any non-essential addition and replacement made by the technical characteristics of the technical scheme of the invention by a person skilled in the art belong to the protection scope of the invention.

Claims

The use of IL-6 in the manufacture of a medicament for ketogenesis, said medicament being a medicament for activating NF- κ B p65, enhancing expression of HMGCS2 from the transcriptional level, indirectly enhancing liver cell ketone body synthesis, said IL-6 being present at a concentration of 30 ng/mL.
2. The use according to claim 1, wherein the IL-6 is used in the manufacture of a medicament for the prevention or treatment of neurodegenerative diseases.
3. The use according to claim 1 or 2, wherein the medicament is one that enhances the binding of NF- κ B p65 to the GGAAGACCT site on the HMGCS2 promoter.