KR20240040635A - Pharmaceutical composition for preventing or treating senile diseases comprising vascular smooth muscle cell expressing Cbfβ or its culture solution as active ingredients - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating geriatric diseases containing Cbfβ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient. When Cbfβ expression in vascular smooth muscle cells is inhibited, vascular calcification occurs. And osteoclast differentiation is promoted, and Cbfβ-expressing vascular smooth muscle cell culture medium inhibits osteoclast differentiation, so it can be usefully used as a composition for preventing, treating, improving, or diagnosing geriatric diseases.

Description

Pharmaceutical composition for preventing or treating senile diseases comprising vascular smooth muscle cells expressing Cbfβ or its culture solution as active ingredients {Pharmaceutical composition for preventing or treating senile diseases comprising vascular smooth muscle cells expressing Cbfβ or its culture solution as active ingredients}

The present invention relates to a pharmaceutical composition for preventing or treating geriatric diseases containing Cbfβ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient.

As the elderly population increases, the number of cases of cardiovascular disease and bone disease occurring together is rapidly increasing. Osteoporosis is a representative geriatric disease resulting from dysfunction of skeletal cells, aging blood vessels, and various inflammatory changes due to aging. Vascular calcification is one of the cardiovascular diseases and can be caused by diabetes, kidney disease, osteoporosis, etc. As bone mass decreases, the likelihood of vascular calcification increases, and there is a proportional relationship between chronic vascular diseases and osteoporosis. Biomolecules or proteins secreted from vascular cells can affect the activity of skeletal cells, and in particular, among vascular cell-derived proteins, they promote the activity of osteoclasts, destroying bone tissue and causing osteoporosis. Accordingly, the development of new drugs that can simultaneously treat cardiovascular diseases and bone diseases is actively underway.

1. Republic of Korea registered patent KR 10-2249135 (registered on April 30, 2021)

The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating geriatric diseases containing Cbfβ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient.

Another object of the present invention is to provide a health functional food composition for preventing or improving geriatric diseases containing the cells or their culture medium as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating geriatric diseases, which contains as an active ingredient a Cbfβ (Core-binding factor subunit beta) protein or an agent that induces the expression or activity of the gene encoding it.

Another object of the present invention is to provide a biomarker composition for diagnosing geriatric diseases containing Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it as an active ingredient.

Another object of the present invention is to provide a composition for diagnosing geriatric diseases containing as an active ingredient an agent capable of confirming the expression level of the protein or the gene encoding it.

Another object of the present invention is to provide a kit for diagnosing geriatric diseases containing the composition for diagnosing geriatric diseases as an active ingredient.

Another object of the present invention is to separate a biological sample from an individual (step 1); And a method of providing information for diagnosing geriatric diseases, including a step (second step) of measuring the expression level of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it in the biological sample isolated in the first step. It is provided.

Another object of the present invention is to treat a geriatric disease cell line with a test substance (first step); Measuring the expression of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step (second step): and the expression of Cbfβ compared to the geriatric disease cell line that was not treated with the test substance. To provide a screening method for a treatment for geriatric diseases, including the step of selecting test substances that induce (third step).

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating geriatric diseases containing Cbfβ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture medium as an active ingredient.

In addition, the present invention provides a health functional food composition for preventing or improving geriatric diseases containing the cells or their culture medium as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating geriatric diseases, which contains as an active ingredient a Cbfβ (Core-binding factor subunit beta) protein or an agent that induces the expression or activity of the gene encoding it.

In addition, the present invention provides a biomarker composition for diagnosing geriatric diseases containing Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it as an active ingredient.

In addition, the present invention provides a composition for diagnosing geriatric diseases, which includes as an active ingredient an agent capable of confirming the expression level of the protein or the gene encoding the protein.

Additionally, the present invention provides a kit for diagnosing geriatric diseases containing the composition for diagnosing geriatric diseases as an active ingredient.

In addition, the present invention includes the steps of isolating a biological sample from an individual (first step); And a method of providing information for diagnosing geriatric diseases, including a step (second step) of measuring the expression level of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it in the biological sample isolated in the first step. to provide.

In addition, the present invention includes the steps of treating a geriatric disease cell line with a test substance (first step); Measuring the expression of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step (second step): and the expression of Cbfβ compared to the geriatric disease cell line that was not treated with the test substance. Provides a screening method for a treatment for geriatric diseases, including the step of selecting test substances that induce (third step).

According to the present invention, when suppressing the expression of Cbfβ (Core-binding factor subunit beta) in vascular smooth muscle cells, vascular calcification and osteoclast differentiation are promoted, and by confirming that Cbfβ-expressing vascular smooth muscle cell culture media suppresses osteoclast differentiation. , It can be usefully used as a composition for preventing, treating, improving or diagnosing geriatric diseases.

Figure 1 shows the results of analyzing the effect of Cbfβ on vascular homeostasis.
Figure 2 shows the results of analyzing the effect of Cbfβ on blood pressure. *p<0.05
Figure 3 shows the results of analyzing the effect of Cbfβ on vascular calcification.
Figure 4 shows the results of analyzing the effect of Cbfβ on bone metabolism.
Figure 5 shows the results of analyzing the effect of vascular smooth muscle cell-derived proteins on osteoclast activity.
Figure 6 shows the results of analyzing the effect of Cbfβ-deleted vascular smooth muscle cell culture medium on osteoclast activity and differentiation.
Figure 7 shows the results of analyzing the effect of Cbfβ-overexpressing vascular smooth muscle cell culture medium on osteoclast differentiation.
Figure 8 shows the results of analyzing the effect of Cbfβ on the expression of genes related to osteoclast differentiation.

Hereinafter, the present invention will be described in more detail.

The present invention provides a pharmaceutical composition for preventing or treating geriatric diseases containing Cbfβ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient.

The Cbfβ-expressing vascular smooth muscle cells or their culture medium increase blood pressure; Alternatively, it may inhibit osteoclast differentiation.

The geriatric disease may be a vascular aging disease or a bone disease.

The vascular aging disease may be one or more selected from the group consisting of vascular calcification, osteoporosis, osteoarthritis, arteriosclerosis, fatty liver, liver fibrosis, diabetes, and dementia, but is not limited thereto.

The bone disease may be one or more selected from the group consisting of fractures, osteoarthritis, rheumatoid arthritis, osteoporosis, and osteomalacia, but is not limited thereto.

The pharmaceutical composition of the present invention is prepared in unit dose form or in a multi-dose container by formulating it using a pharmaceutically acceptable carrier according to a method that can be easily performed by a person skilled in the art. It can be manufactured by internalizing it.

The pharmaceutically acceptable carriers are commonly used in formulations and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Includes, but is not limited to, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.

In the present invention, the content of additives included in the pharmaceutical composition is not particularly limited and can be appropriately adjusted within the content range used in conventional formulations.

The pharmaceutical compositions include injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment agents, paste agents, and cataplasmase agents. It may be formulated in the form of one or more external skin preparations selected from the group consisting of, but is not limited to this.

The pharmaceutical composition of the present invention may additionally contain pharmaceutically acceptable carriers and diluents for formulation. The pharmaceutically acceptable carriers and diluents include excipients such as starch, sugar and mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose, hydroxypropylcellulose, gelatin, alginate, polyvinyl pyrrolidone. It includes, but is not limited to, binders such as talc, calcium stearate, lubricants such as hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone and crospovidone, and surfactants such as polysorbate, cetyl alcohol, glycerol, etc. The pharmaceutically acceptable carrier and diluent may be biologically and physiologically friendly to the subject. Examples of diluents include, but are not limited to, saline, aqueous buffers, solvents, and/or dispersion media.

The pharmaceutical composition of the present invention can be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally, or topically) depending on the desired method. For oral administration, it can be formulated as tablets, troches, lozenges, aqueous suspensions, oily suspensions, powders, granules, emulsions, hard capsules, soft capsules, syrups, elixirs, etc. In the case of parenteral administration, it can be formulated as an injection, suppository, powder for respiratory inhalation, aerosol for spray, ointment, powder for application, oil, cream, etc.

The dosage of the pharmaceutical composition of the present invention is determined by the patient's condition, weight, age, gender, health, dietary constitution specificity, nature of the preparation, degree of disease, administration time of the composition, administration method, administration period or interval, excretion rate, and The range may vary depending on the drug form and can be appropriately selected by a person skilled in the art. For example, it may range from about 0.1 to 10,000 mg/kg, but is not limited and may be administered once to several times a day.

The pharmaceutical composition may be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally, or topically applied) depending on the desired method. The pharmaceutically effective amount and effective dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time, administration route, etc. of the pharmaceutical composition, and those skilled in the art will know that it is effective for the desired treatment. Dosage can be easily determined and prescribed. The pharmaceutical composition of the present invention may be administered once a day, or may be administered in several divided doses.

In addition, the present invention provides a health functional food composition for preventing or improving geriatric diseases containing Cbfβ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient.

The present invention can be generally used with commonly used foods.

The food composition of the present invention can be used as a health functional food. The term “health functional food” refers to food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with the Health Functional Food Act, and “functionality” refers to food that is related to the structure and function of the human body. It means ingestion for the purpose of controlling nutrients or obtaining useful health effects such as physiological effects.

The health functional food composition may contain common food additives, and its suitability as a “food additive” is determined in accordance with the general provisions and general test methods of the food additive code approved by the Ministry of Food and Drug Safety, unless otherwise specified. The decision is made based on the specifications and standards for the item.

Items listed in the “Food Additives Code” include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid; natural additives such as subchromic pigment, licorice extract, crystalline cellulose, high-liquid pigment, and guar gum; Examples include mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline preparations, preservative preparations, and tar coloring preparations.

The food composition of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. For example, among health functional foods in the form of capsules, hard capsules can be manufactured by mixing and filling the composition according to the present invention with additives such as excipients in a regular hard capsule, and soft capsules can be manufactured by mixing and filling the composition according to the present invention. It can be manufactured by mixing with additives such as excipients and filling it with a capsule base such as gelatin. The soft capsule may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, etc., if necessary.

Definitions of terms such as excipients, binders, disintegrants, lubricants, coagulants, flavoring agents, etc. are described in literature known in the art and include those with the same or similar functions. There is no particular limitation on the type of food, and it includes all health functional foods in the conventional sense.

In the present invention, the term “prevention” refers to all actions that suppress or delay geriatric diseases by administering the composition according to the present invention.

In the present invention, the term “treatment” refers to any action that improves or beneficially changes the symptoms of a geriatric disease by administering the composition according to the present invention.

In the present invention, the term “improvement” refers to any action that improves the bad condition of a senile disease by administering the composition according to the present invention.

In addition, the present invention provides a pharmaceutical composition for preventing or treating geriatric diseases, which contains as an active ingredient a Cbfβ (Core-binding factor subunit beta) protein or an agent that induces the expression or activity of the gene encoding it.

In addition, the present invention provides a biomarker composition for diagnosing geriatric diseases containing Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it as an active ingredient.

The geriatric disease may be a vascular aging disease or a bone disease.

The expression of the protein or the gene encoding it may be reduced in vascular smooth muscle cells of patients with geriatric diseases.

As used herein, “diagnosis” means confirming the presence or characteristics of a pathological condition, and for the purposes of the present invention, means identifying a geriatric disease, and determining the subject's susceptibility to a geriatric disease or at least one symptom thereof. judgment, therametrics (e.g., monitoring the condition of an object to provide information about treatment efficacy), etc. It also includes primary diagnosis of a clinical condition or diagnosis of recurrent disease.

In this specification, “biomarker” is an indicator that can detect changes in the body, and is a substance that can confirm the normal or pathological state of a living organism and whether there is a change in this, including polypeptides, nucleic acids, lipids, glycolipids, It may include organic biomolecules such as glycoproteins and sugars (monosaccharides, disaccharides, oligosaccharides, etc.), and can be used to diagnose geriatric diseases as in the present invention.

In addition, the present invention provides a composition for diagnosing geriatric diseases containing as an active ingredient an agent capable of checking the expression level of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it.

Agents that can confirm the expression level include antibodies, peptides, aptamers, or compounds that specifically bind to the protein; Alternatively, it may be a primer or probe that specifically binds to the gene encoding the protein, but is not limited thereto.

As used herein, a "primer" is a nucleic acid sequence with a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and serving as a starting point for copying the template strand. refers to a short nucleic acid sequence that Primers can initiate DNA synthesis in the presence of four different nucleotide triphosphates and reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature. PCR conditions and lengths of sense and antisense primers can be appropriately selected according to techniques known in the art.

As used herein, “probe” refers to a fragment of several to hundreds of base sequences that can specifically bind to a gene or miRNA, and is labeled so that the presence or absence and expression level of the gene can be confirmed. there is. Appropriate probes and hybridization conditions can be appropriately selected according to techniques known in the art.

Additionally, the present invention provides a kit for diagnosing geriatric diseases containing the composition for diagnosing geriatric diseases as an active ingredient.

The kit can be used to diagnose the occurrence of a geriatric disease by measuring the expression level of the protein or the gene encoding it in a sample isolated from an individual suspected of having a geriatric disease.

In addition, the kit may include not only an agent for measuring the expression level of the protein or the gene encoding it, but also one or more other component compositions, solutions, or devices suitable for the analysis method.

For example, the kit according to the present invention includes genomic DNA derived from a sample to be analyzed to perform PCR, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer solution, and It may be a kit containing water. The PCR buffer solution may include KCl, Tris-HCl, and MgCl ₂ . In addition, components necessary for performing electrophoresis that can confirm the amplification of the PCR product may be additionally included in the kit of the present invention.

Additionally, the kit according to the present invention may be a kit containing essential elements required to perform RT-PCR. In addition to each primer pair specific for the marker gene, the RT-PCR kit contains test tubes or other suitable containers, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, and DEPC. -Can include DEPC-water, sterilized water, etc. Additionally, it may include a pair of primers specific to the gene used as a quantitative control.

In addition, the present invention includes the steps of isolating a biological sample from an individual (first step); And a method of providing information for diagnosing geriatric diseases, including a step (second step) of measuring the expression level of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it in the biological sample isolated in the first step. to provide.

The biological sample may be vascular smooth muscle cells.

Methods for measuring the protein expression level include Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, and rocket. ) It may be one or more selected from the group consisting of immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip, but is not limited thereto.

Methods for measuring the gene expression level include microarray, next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), and competitive RT-PCR (Competitive PCR). It may be one or more selected from the group consisting of RT-PCR), real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chip. It is not limited.

In addition, the present invention includes the steps of treating a geriatric disease cell line with a test substance (first step); Measuring the expression of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step (second step): and the expression of Cbfβ compared to the geriatric disease cell line that was not treated with the test substance. Provides a screening method for a treatment for geriatric diseases, including the step of selecting test substances that induce (third step).

In this specification, “test substance” refers to an unknown candidate substance used in screening to test whether it affects the expression level of a gene or affects the expression or activity of a protein. The test substances include, but are not limited to, chemicals, nucleic acids, antisense-RNA, siRNA (small interference RNA), and natural product extracts.

Hereinafter, the present invention will be described in detail through examples to aid understanding. However, the following examples only illustrate the content of the present invention and the scope of the present invention is not limited to the following examples. Examples of the present invention are provided to more completely explain the present invention to those skilled in the art.

[ Experiment example 1] Experiment preparation

1-1. reagent

The reagents (materials) used in this experiment and where they were purchased are listed in Table 1 below.

reagent Where to buy DMSO (dimethyl sulfoxide) Sigma ethanol fast red violet LB glycerol napthol As-Mx phosphate N,N-dimethylformamide nitric acid nonylphenyl-polyethyleneglycol acetate PFA(paraformaldehyde) acetone JUNSEI
(Nihonbashi-honcho, Chuo-ku, Tokyo) formaldehyde solution sodium acetate trihydrate sodium tartrate dihydrate α-MEM (α-minimum essential medium) hyclone Thermo scientific
(Rockford, IL, USA) permount Fetal bovine serum (FBS) GIBCO
(Grand Island, NY, USA) M-CSF (human macrophage-colony stimulation factor) PEPROTECH, INC. (Rocky Hill, NJ, USA) N,N-dimethyl-p-toluidine MP Biomedicals (Solon-Ohio, BC, U.S.A.) Penicillin/Streptomycin
(penicillin/streptomycin) Lonza (Rockland, ME, USA) red blood cell lysate BioLegend (San Diego, CA, U.S.A.) RANKL (receptor activator for nuclear factor κB ligand) R&D systems (Minneapolis, MN, U.S.A)

1-2. laboratory animals

Cbfβ ^{f /f} 16-week-old male mice were purchased and used from RIKEN, Japan, Sm22a Cre 16-week-old male mice (Sm22a Cre overexpressing mice) were purchased and used from Professor Jo Je-yeol's laboratory at Seoul National University, and ROR26 mice were purchased from Professor Kim Jeong-eun's laboratory at Kyungpook National University. It was purchased and used. When crossing Sm22a Cre mice and Cbfβ ^{f /f} mice, Cbfβ deletion mice were created using the principle that the Cbfβ gene is specifically removed from the vascular smooth muscle cells of the crossbred mice (Sm22a Cre;Cbfβ ^{f /f} ). In addition, when crossing Sm22a-Cre mice with ROR26 mice, the position where Sm22a-Cre is expressed in the crossed mice can be confirmed through X-GAL staining, so crossbreeding was performed. Specifically, the mice used in the experiment are as follows.

1) Cbfβ ^{f /f} mouse: normal mouse (control group; WT)

2) Sm22a Cre;Cbfβ ^{f /f} mouse (Cbfβ ^{Δvc /+} ): heterozygous Cbfβ deletion mouse (HE)

3) Sm22a Cre;Cbfβ ^{f /f} mouse (Cbfβ ^{Δvc / Δvc} ): homozygous Cbfβ deletion mouse (HO)

4) Sm22a-Cre;ROR26 mouse: Sm22a Cre overexpressing mouse

The experiments were conducted after acclimatization for one week in an SPF (Specific Pathogen Free) laboratory animal breeding room (temperature 25°C and relative humidity 60%). The feed was regular food (Super bead Co, Korea), and all animal experiments were conducted in accordance with the regulations of the Animal Experiment Ethics Committee of Kyungpook National University (animal experiment approval number: KNU 2021-0099).

1-3. cell

Mouse bone marrow monocytes (mBMM) were isolated from the femur and tibia of 8-week-old mice. In a mouse with a dislocated cervical spine, the femur and tibia were separated, the muscles were removed, both ends were cut, and bone marrow cells were separated by passing α-MEM using a syringe. The separated bone marrow cells were centrifuged, red blood cell lysate was added to hemolyze the red blood cells, and the medium [α-MEM, 10% (v/v) FBS, penicillin (100 units/ml), and streptomycin (100 units/ml)] was added and cultured for 1 day in a constant temperature and humidity incubator at 37°C and 5% (v/v) CO ₂ conditions. Only cells that did not stick to the culture dish and were floating were collected, treated with M-CSF (20ng/ml), and cultured for 3 days to obtain bone marrow-derived monocyte/macrophage cells. To differentiate macrophages into osteoclasts, M-CSF (30ng/ml) and RANKL (30ng/ml) were added and cultured for 4 days. While inducing differentiation, the medium was changed every 2 days.

[ Experiment example 2] Real-time PCR

To confirm changes in gene expression of osteoclast differentiation markers, real-time PCR was performed. Total RNA was extracted from differentiated osteoclasts using an RNA extraction kit (Easy-blue), and 2 ㎍ of total RNA was synthesized into cDNA using reverse transcriptase. Real-time PCR was performed by mixing 0.5 μl of synthesized cDNA with 2× SYBR green PCR master mixture (5 μl) and specific primer (0.2 μl). The primers used for real-time PCR are listed in Table 2 below, and the primers were designed using Primer Express software (ABI).

mDCSTAMP Forward CTTCCGTGGGCCAGAAGTT Reverse AGGCCAGTGCTGACTAGGATGA mc-fms Forward CCTGAATCTCCCGGAAGCA Reverse CAAGCTCGGTACAACGGTAGGT mRank Forward TCTGCAGCTCTTCCATGACACT Reverse GAAGAGGAGCAGAACGATGAGACT mTRAP Forward TCCCCAATGCCCCATTC Reverse CGGTTCTGGCGATCTCTTTG mGapdh Forward TGTGTCCGTCGTGGATCTGA Reverse CCTGCTTCACCACCTTCTTGA mc-fos Forward GCATGGGCTCTCCTGTCAA Reverse GGCACTAGAGACCGGACAGATCTG mOscar Forward ACCTGGCACCTACTGTTGCTATTAC Reverse GCTGGCTGCGCTGTGAT mCathepsin K Forward GGCTGTGGAGGCGGCTAT Reverse AGAGTCAATGCCTCCGTTTCTG mVegf Forward CAGGCTGCTGTAACGATGAA Reverse GCATTCACATCTGCTGTGCT mRankL Forward GATTTTCAAGCTCCGAGCTGG Reverse CCTGAACTTTGAAAGCCCCAA mOpg Forward ACTCGAACCTCACCACAGAGCA Reverse CGCTCGATTTGCAGGTCTTTC mRunx1 Forward CAGGCAGATCCAGCCATC Reverse TTGAGAGTCGACTGGAAAGTTCT mRunx2 Forward GCACAAACATGGCCAGATTCA Reverse AAGCCATGGTGCCCGTTAG mCbfβ Forward GTTTACAGCTCTTTGGGTTCCA Reverse TTACTGCCAGCAGCTGTGA mSmmhc Forward GCGCAATACCACGCCTAACTT Reverse AGATGCGGATGCCTTCCAA mPPARG Forward GAAAGACAACGGACAAATCACC Reverse GGGGGTGATATGTTGAACTTG mPDGFB Forward CAAGAGTGTGGGCAGGGTTA Reverse CATCGAGACAGACGGACGAG mPDGFRB Forward AAGCTGCAGGTCAATGTCCC Reverse CTTCTGCAGGTAGACCAGGTG mElastin Forward GGGATAAAACGAGGGCGCTGA Reverse AGCTCCTGGAACCCCTCC mAngptl4 Forward GTTTGCAGACTCAGCTCAAGG Reverse CCAAGAGGTCTATCTGGCTCTG

[ Experiment example 3] Trap( Tartrate resistant acid phosphatase ) dyeing

M-CSF (20ng/ml) was treated with intramedullary monocytes isolated from the femur and tibia of mice, reacted for 1 day, collected cells attached to the culture vessel, and dispensed at 3× ¹⁰ cells/well in a 48-well multi-plate. Then, it was replaced with osteoclast differentiation inducing medium and cultured for 4 days. After removing the medium and washing with PBS (phosphate-buffered saline), cells fixed with 10% formaldehyde solution were treated with Trap staining solution [Naphthol As-Mx, Fast red violet LB and N,N-dimethylformamide in 50mM acetate. dissolved in buffer (pH 5.0)] and stained at 37°C for 30 minutes. The solution was removed, washed twice using PBS, and then observed under a microscope.

[ Experiment example 4] H&E( Hematoxylin & Eosin) dyeing

To observe the morphology of blood vessels, H&E staining was performed. After rehydrating the vascular paraffin sections, the cell nuclei were stained with hematoxylin and the cytoplasm was stained with eosin, and then observed under a microscope.

[ Experiment example 5] VVG ( Verhoeff -Van Gieson ) dyeing

To observe elastic fibers in blood vessels, VVG staining was performed. After rehydrating the vascular paraffin sections, they were reacted in Verhoeff's solution for 1 hour, washed three times in running water, and reacted with 2% iron chloride for 2 minutes. After washing in running water, it was reacted with 5% sodium thiosulfate for 5 minutes, washed again, stained with Van Gieson's solution, and observed under a microscope. All procedures were carried out according to the method disclosed at the site below (https://www.ihcworld.com/_protocols/special_stains/vvg.htm).

[ Experiment example 6] Tissue immunology staining

After rehydrating the vascular paraffin sections, they were placed in Tri-EGTA (Tris 1.211g + EGTA 0.19g/ddH ₂ O 1L; TEG) solution, boiled in a microwave, retrieval, and slowly cooled at room temperature. The retrieval sample was blocked with 3% H ₂ O ₂ /methanol and 1% BSA/PBS solution, and permibilized with 0.1% Triton X-100. Afterwards, the primary antibody was reacted at 4°C overnight, and the secondary antibody was reacted at room temperature for 1 hour. Finally, color was developed using DAB substrate, dehydrated, mounted, and observed under a microscope.

[ Experiment example 7] Von Kossa dyeing

To observe the progress of bone mineralization, Von Kossa staining was performed. Vertebrae were fixed in 4% PFA for 1 day at 4°C. Paraffin samples were prepared without decalcification after fixation. After rehydrating the paraffin section, 1% silver nitrate (AgNO ₃ ) was added and reacted for 5 minutes under UV (ultraviolet). After the reaction was completed, the reaction mixture was washed twice with water, 5% sodium thiosulfate was added and reacted for 5 minutes, and non-specific signals were removed. Afterwards, it was mounted and observed under a microscope.

[ Experiment example 8] Tissue immunology staining

After rehydrating the vascular paraffin sections, they were blocked for 1 hour using 1% BSA (Bovine Serum Albumin) and reacted with CD31 antibody for 1 hour at room temperature. Afterwards, it was reacted with HRP (Horse Radish Peroxidase)-attached secondary antibody for 1 hour, developed with DAB (3,3'-diaminobenzidine) (Dako, Carpinteria, CA, USA), and mounted. , observed under a microscope.

[ Experiment example 9] Fluorescence Immunology dyeing

After rehydrating the vascular paraffin sections, they were blocked using 1% BSA for 1 hour and reacted with PCNA antibody for 1 hour at room temperature. After reacting with a fluorescent secondary antibody for 1 hour, cell nuclei were stained with DAPI (4',6-diamidino-2-phenylindole), mounted, and observed under a microscope.

[ Experiment example 10] X-Gal staining

The entire tissue was fixed in 4% paraformaldehyde (PFA)/0.1M calcium phosphate solution [pH 7.4, 2mM MgCl ₂ , 5mM ethylene glycol tetra-acetic acid (EGTA)] for 30 minutes. Afterwards, it was washed three times and stained in X-gal staining solution overnight at 37°C. Stained samples were made into paraffin blocks, cut into sections, and counterstained with Nuclear Fast Red (Sigma Aldrich, St. Louis, MO, USA).

[ Experiment example 11] micro-CT analysis

After separating the mouse femur and removing the muscle, it was fixed in 4% PFA at 4°C for one day, and the next day it was washed three times in PBS solution and stored in PBS. The stored femur was analyzed by scanning the area from 1.6 mm to 2.3 mm below the growth plate at 6㎛ increments using a Skysan 1272 (Bruker, Massachusetts, USA) model. Using micro-CT, cancellous bone volume (BV/TV), cancellous bone thickness (Tb.Th), cancellous bone number (Tb.N), cancellous bone dead area (Tb.Sp), and cancellous bone bone density (BMD) are measured. Bone volume (BV/TV) and bone mineral density (BMD) of cortical bone were measured.

[ Experiment example 12] bone strength measurement

The mouse femur was separated, the muscles were removed, placed in 0.9% sodium chloride (pH 7.4), and stored at -20°C. Before analyzing the sample, it was slowly melted at 4°C, and max load (N) and slope (N/mm) were measured using Instron (Tensile Tester, Williamston, SC, USA).

[ Experiment example 13] blood biochemistry analyze

To confirm the extent of osteoclast resorption in vivo, the secretion of CTX in serum was measured using ELISA. All experimental procedures were conducted according to the standard manual of cloud clone (WUHAN, PRC).

[ Experiment example 14] Blood pressure measurement

To confirm the effect of Cbfβ deletion on blood pressure, mouse blood pressure was measured. Before measuring mouse blood pressure, it was stabilized for 5 minutes and measured using an automatic blood pressure monitor (Tango+, Suntech, NC, USA).

[ Experiment example 15] Alizarin Red staining

To confirm the effect of deletion of Cbfβ on vascular calcification in a vascular calcification induction model using high-dose vitamin D, Alizarin Red staining was performed. Kidneys and blood vessels isolated from sacrificed mice were washed with PBS three times for 10 minutes each, fixed with 4% PFA, washed three times with distilled water three times for 10 minutes each, and reacted with Alizarin Red solution for 10 minutes. After washing three times with distilled water, it was observed under a microscope.

[ Experiment example 16] MTS assay

To confirm the effect on osteoblast and osteoclast proliferation, MTS assay was performed. MC3T3-E1 cells were planted in a 48-well multi-plate at 3 × 10 ⁴ cells/well, and after 24 hours, culture medium obtained from vascular smooth muscle cells was treated. After culturing for 24 hours, 20 ㎕ of MTS solution was added to each well. It was added to 100㎕ culture medium and incubated for 4 hours. After 4 hours, absorbance was measured at a wavelength of 490 nm using an ELISA reader.

[ Example 1] Vascular homeostasis analysis

As a result of analyzing the effect of Cbfb on vascular homeostasis in vascular smooth muscle cells, as shown in Figure 1A, X-gal staining showed that Sm22a-cre expression was increased in vascular smooth muscle cells derived from mice overexpressing Sm22a-Cre (Sm22a-Cre; ROR26). This was confirmed through (Experimental Example 10). In addition, as shown in Figure 1B, it was confirmed through fluorescence immunological staining (Experimental Example 9) that Cbfβ and Runx1 expression was decreased in vascular smooth muscle cells derived from Cbfβ deletion mice (Cbfβ ^{Δvc / Δvc} ). In addition, as shown in Figure 1C, it was confirmed through H&E and VVG staining (Experimental Examples 4 to 5) that the elastin fibers of the vascular smooth muscle derived from the Cbfβ deletion mouse were flat and irregular, as shown in Figure 1D. , it was confirmed through fluorescence immunological staining (Experimental Example 9) that CD31 expression was increased and vascular smooth muscle cell proliferation was decreased in vascular smooth muscle cells derived from the Cbfβ deletion mouse. From the above results, it was confirmed that Cbfβ is involved in vascular homeostasis.

[ Example 2] Blood pressure analysis

As a result of analyzing the effect of Cbfβ on blood pressure in vascular smooth muscle cells (Experimental Example 12), as shown in Figure 2, blood pressure was found to be higher in Cbfβ deletion mice (Cbfβ ^{Δvc / Δvc} ) compared to normal mice (Cbfβ ^{fl /fl} ) (n =4-5/group, *p<0.05). From the above results, it was confirmed that Cbfβ is involved in blood pressure homeostasis.

[ Example 3] Vascular calcification analysis

To confirm the effect of Cbfβ on vascular calcification in vascular smooth muscle cells, vascular calcification was induced by subcutaneously injecting high-dose vitamin D (6 × 10 ⁵ IU/Kg) into mice, and Alizarin Red staining (Experimental Example 13) Vascular calcification was observed in the kidneys and arterial blood vessels. As a control group, when PBS was administered instead of vitamin D, it was administered by subcutaneous injection. Specifically, the experimental group was set as follows.

1) PBS administration (200μl) normal mouse (WT) (n=2)

2) Vitamin D administration (6×10 ⁵ IU/Kg) to normal mice (WT) (n=4)

3) PBS administration (200μl) to Cbfβ deletion mice (Cbfβ ^{Δvc / Δvc} ) (n=2)

4) Vitamin D administration (6×10 ⁵ IU/Kg) to Cbfβ deletion mice (Cbfβ ^{Δvc / Δvc} ) (n=4)

As a result, as shown in Figure 3, vascular calcification was promoted in the kidneys (Kidney) and arterial blood vessels (Aorta) of normal mice (Cbfβ ^{fl /fl} ) and Cbfβ deletion mice (Cbfβ ^{Δvc / Δvc} ) administered vitamin D, and normal Vascular calcification was more significant in Cbfβ deletion mice compared to mice. From the above results, it was confirmed that Cbfβ inhibits vascular calcification.

[ Example 4] bone metabolism analyze

As a result of analyzing the effect of Cbfβ on bone metabolism in vascular smooth muscle cells, as shown in Figures 4A and 4B, bone density (bone density) of cancellous bone in Cbfβ deletion mice (Cbfβ ^{Δvc /+} and Cbfβ ^{Δvc / Δvc} ) compared to normal mice (Cbfβ ^{fl /fl} ) Tb. BMD), cancellous bone mass (Tb. BV/TV), cancellous bone thickness (Tb.Th), and trabecular bone number (Tb.N) were significantly decreased, and cancellous bone dead area (Tb.Sp) was significantly increased. A decrease in femur length, slope, and YLD.load values, which are bone strength indicators, was confirmed through micro-CT and Instron (Experimental Examples 9 to 10). In addition, as shown in Figure 4C, it was confirmed through blood biochemical analysis (Experimental Example 11) that CTX and RANKL expression increased in Cbfβ deletion mice (Cbfβ ^{Δvc / Δvc} ) compared to normal mice, and as shown in Figure 4D, Cbfβ compared to normal mice It was confirmed through TRAP staining (Experimental Example 3) that the number of osteoclasts (Oc.NO) and osteoclast unit surface area/bone unit surface area (Oc.S/BS) increased in deletion mice (Cbfβ ^{Δvc / Δvc} ). In the vertebrae, bone mass (BV/TV), bone thickness (Tb.Th), and cancellous bone number (Tb.N) decreased, and cancellous bone area (Tb.Sp) increased, confirmed through Von Kossa staining (Experimental Example 7). did. From the above results, it was confirmed that Cbfβ is involved in bone metabolic homeostasis.

[ Example 5] Osteoclast activity and differentiation analysis

5-1. Vascular smooth muscle cells

As a result of analyzing the effect of vascular smooth muscle cell-derived proteins on osteoclast activity and differentiation, as shown in Figures 5A and 5C, the vascular smooth muscle cell culture medium treated group (WT-CM, CM = vascular smooth muscle) compared to the control group (untreated group; Control) It was confirmed through MTS assay (Experimental Example 16) and Trap staining (Experimental Example 3) that cell derived conditional media promotes the proliferation of osteoclasts (mononuclear cells), while inhibiting the differentiation of osteoclasts. In addition, as shown in Figure 5B, the expression of osteoclast differentiation markers (c-fos, c-fms, RANK, TRAP, OSCAR, NFACT1, Cathepsin K, and DC-STAMP) was decreased in the vascular smooth muscle cell culture medium-treated group compared to the control group. This was confirmed through real-time PCR (Experimental Example 2). From the above results, it was confirmed that the vascular smooth muscle cell-derived protein participates in bone metabolism by promoting osteoclast proliferation and inhibiting osteoclast differentiation.

5-2. Cbfβ fruition Vascular smooth muscle cells

As a result of analyzing the effect of Cbfβ-deleted vascular smooth muscle cell culture medium on osteoclast activity and differentiation, as shown in Figures 6A and 6C, there was no significant difference in osteoclast proliferation between the experimental groups, whereas the control group (WT-CM; normal vascular smooth muscle) MTS assay (Experimental Example 16) and Trap staining (Experimental Example 16) showed an increase in osteoclast differentiation in the Cbfβ-deleted vascular smooth muscle cell culture media treatment group (HO-CM) compared to the cell culture media treatment group (CM = vascular smooth muscle cell derived conditional media). It was confirmed through 3). In addition, as shown in Figure 6B, compared to the control group, RUNX2 and OCN expression decreased, Osterix and OPN expression increased, and ALP and Colla expression showed no significant difference between experimental groups in the Cbfβ-deleted vascular smooth muscle cell culture medium treatment group compared to the control group. This was confirmed through time PCR (Experimental Example 2). In addition, as shown in Figure 7, Trap staining showed a decrease in osteoclast differentiation in the Cbfβ-overexpressing vascular smooth muscle cell culture treated group (Cbfβ CM) compared to the control group (normal vascular smooth muscle cell culture treated group; pcDN3.1 CM) (Experimental Example 3). It was confirmed through . From the above results, it was confirmed that Cbfβ inhibits osteoclast differentiation.

[ Example 6] Analysis of gene expression related to osteoclast differentiation

As a result of analyzing the effect of Cbfβ on ^the expression of genes related to osteoclast ^{differentiation} in ^vascular smooth muscle cells, as shown in Figure 8A ^{, Runx1} , It was confirmed through real-time PCR (Experimental Example 2) that Runx2, VEGF, PDGF-BB, PDGFRB, RANKL, and RANKL/OPG expression was significantly increased, and Cbfβ, OPG, PPARG, OPN, and ANGPTL4 expression was significantly decreased. did. In addition, as shown in Figure 8B, it was confirmed through ELISA (Experimental Example 11) that RANKL expression was significantly increased in Cbfβ deletion mouse cells (HE CM and HO CM) compared to the control group (WT CM). From the above results, it was confirmed that Cbfβ suppresses osteoclast differentiation through regulating the expression of genes related to osteoclast differentiation.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. do. That is, the practical scope of the present invention is defined by the appended claims and their equivalents.

Claims (18)

A pharmaceutical composition for preventing or treating geriatric diseases comprising Cbfβ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture medium as an active ingredient. According to claim 1, wherein the Cbfβ-expressing vascular smooth muscle cells or their culture medium increases blood pressure; Or a pharmaceutical composition characterized in that it inhibits osteoclast differentiation. The pharmaceutical composition according to claim 1, wherein the geriatric disease is a vascular aging disease or a bone disease. The pharmaceutical composition according to claim 3, wherein the vascular aging disease is one or more selected from the group consisting of vascular calcification, osteoporosis, osteoarthritis, arteriosclerosis, fatty liver, liver fibrosis, diabetes, and dementia. The pharmaceutical composition according to claim 3, wherein the bone disease is at least one selected from the group consisting of fractures, osteoarthritis, rheumatoid arthritis, osteoporosis, and osteomalacia. A health functional food composition for preventing or improving geriatric diseases containing Cbfβ (Core-binding factor subunit beta)-expressing vascular smooth muscle cells or their culture fluid as an active ingredient. A pharmaceutical composition for preventing or treating geriatric diseases, comprising as an active ingredient a Cbfβ (Core-binding factor subunit beta) protein or an agent that induces the expression or activity of the gene encoding it. A biomarker composition for diagnosing geriatric diseases containing Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it as an active ingredient. The biomarker composition according to claim 8, wherein the geriatric disease is a vascular aging disease or a bone disease. The biomarker composition according to claim 8, wherein the protein or the gene encoding the protein has decreased expression in vascular smooth muscle cells of a group of patients with geriatric diseases. A composition for diagnosing geriatric diseases comprising as an active ingredient an agent capable of checking the expression level of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it. The method of claim 11, wherein the agent capable of confirming the expression level is an antibody, peptide, aptamer or compound that specifically binds to the protein; Or a diagnostic composition, characterized in that it is a primer or probe that specifically binds to the gene encoding the protein. A kit for diagnosing geriatric diseases comprising the composition of claim 11 or 12 as an active ingredient. Isolating a biological sample from an individual (step 1); and
A method of providing information for diagnosing geriatric diseases, including the step (second step) of measuring the expression level of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it in the biological sample isolated in the first step. The method of claim 14, wherein the biological sample is vascular smooth muscle cells. The method of claim 14, wherein the method for measuring the protein expression level is Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, and Ouchterlony immunosorbent assay. An information provision method characterized by one or more selected from the group consisting of diffusion method, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip. . The method of claim 14, wherein the method for measuring the gene expression level is microarray, next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), Selected from the group consisting of competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chip. A method of providing information, characterized by one or more. Treating a test substance to a geriatric disease cell line (step 1); Measuring the expression of Cbfβ (Core-binding factor subunit beta) protein or the gene encoding it in the cell line of the first step (second step): and the expression of Cbfβ compared to the geriatric disease cell line that was not treated with the test substance. A screening method for a treatment for geriatric diseases, comprising the step of selecting a test substance that induces (third step).