KR101671100B1 - Composition for preventing or treating metabolic disease - Google Patents

Abstract

The present invention relates to a novel use of the CCR4-NOT transcription complex subunit 2 (CNOT2) gene.
The CNOT2 gene according to the present invention functions as a regulator of lipid differentiation in cells and promotes the expression of lipogenic genes, thereby affecting lipid accumulation and fat cell size increase, resulting in metabolic diseases. Therefore, CNOT2 gene inhibitor Inhibition of the expression of this gene can have an action effect of inhibiting the induction of metabolic diseases and can also be used as a target gene of a diagnostic or therapeutic agent for metabolic diseases.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for preventing or treating metabolic diseases,

The present invention relates to a novel use of the CNOT2 gene.

Metabolic Disease refers to a syndrome in which the risk factors such as obesity, diabetes, hypertension and arteriosclerosis are caused by excessive accumulation of the body and lack of exercise in the body, and the heart, lung, blood of the World Health Organization, The metabolic syndrome was formally named by the institute's adult treatment program.

Due to the improvement of living standards due to economic development, modern people belonging to obesity, which is the main cause of metabolic diseases, are rapidly increasing. Obesity is a phenomenon in which excess calories are accumulated in the body in the form of fat due to the intake of excessive calories. It is known that adipocytes proliferated in internal organs more directly affect lipid metabolism. Adipogenesis is one of the risk factors that can cause metabolic diseases such as obesity and diabetes. Localization refers to a process in which adipocytes differentiate from preadipocytes and accumulate fat. Adipogenic factors such as mature fat Cells differentiate from immature adipocytes such as fibroblasts and ultimately form lipid droplets within the cells.

Therefore, since metabolic diseases including obesity are caused by a very complicated mechanism in cells as described above, it is necessary to develop technologies that can diagnose metabolic diseases, prevent and treat metabolic diseases by controlling the mechanism more efficiently Do.

Meanwhile, in the conventional technologies developed to date, medicines such as Xenical (Roche Pharmaceuticals, Switzerland), Reductil (TM) (Abbott USA), Exoise (Exopia), Acopama, France) However, blood pressure reduction or lactic acidosis can occur, and side effects such as inhibition of vitamin absorption or cardiovascular disease or dizziness are taking place.

Under these circumstances, it has been proposed as an alternative to the prevention and suppression of essential obesity is an adipocyte differentiation inhibitor. Energy storage and endocrine secretion in adipose tissue are closely related to differentiation and growth and fat production processes of adipocytes. In other words, there is a need to study drugs that regulate the number of adipocytes produced while blocking the differentiation of adipocyte precursor cells into adipocytes and regulate the accumulated extra energy therefrom.

The present invention relates to a pharmaceutical composition for the prevention or treatment of metabolic diseases comprising an CNOT2 gene inhibitor as an active ingredient.

The present invention relates to a composition for diagnosing metabolic diseases comprising a probe or a primer having a sequence complementary to a nucleotide sequence of a CNOT2 gene.

(A) contacting a cell containing the CNOT2 gene or protein with a sample to be analyzed; (b) measuring the expression level of the CNOT2 gene, the amount of the CNOT2 protein or the activity of the CNOT2 protein; And (c) when the amount of expression of CNOT2 gene, the amount of CNOT2 protein, or the activity of CNOT2 protein is decreased as a result of the measurement of step (b), the sample is judged to be a substance for treating or preventing metabolic diseases A method for screening a substance for preventing or treating a metabolic disease.

The present inventors have been studying a new method for diagnosing, preventing and treating metabolic diseases. The CCR4-NOT transcription complex subunit 2 (CNOT2) gene controls the differentiation of adipocytes and promotes the expression of lipogenic genes, (CCR4-NOT) transcription complex subunit 2 (CNOT2) gene in lipid metabolism.

Accordingly, the present invention provides a pharmaceutical composition for the prevention or treatment of metabolic diseases comprising an CNOT2 gene inhibitor as an active ingredient.

The CNOT2 gene inhibitor of the present invention inhibits the expression of the CNOT2 gene to inhibit the differentiation of adipocytes and suppresses the expression of lipogenesis-related genes, thereby exerting an excellent effect of controlling metabolic diseases, thereby effectively treating metabolic diseases.

The CNOT2 gene is a gene present in various species such as human (NCBI Gene ID BC002597), mouse (NCBI Gene ID BC063105).

The CNOT2 gene is one of the subunits constituting the CCR4-NOT transcription complex, and is a gene identified in yeast and human. The CCR4-NOT transcription complex contains subunits such as CNOT1, CNOT2, CNOT3, CNOT6, CNOT7, CNOT8, CNOT9, CNOT10 and CNOT11. CNOT2, CNOT4 and CNOT8 interact with CNOT1 while CNOT3 is known to bind to CNOT8 without binding to CNOT1. The CNOT2 gene is known as a transcriptional repressor, but there is no known use for inhibiting adipocyte differentiation.

The CNOT2 gene inhibitor of the present invention inhibits a substance capable of regulating expression of at least one CNOT2 gene selected from the group consisting of antisense oligonucleotides, siRNA (small interfering RNA) or shRNA (small hairpin RNA) of a gene encoding CNOT2 protein Can be used without.

In the present invention, an antisense oligonucleotide refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and binds to a complementary sequence in mRNA to inhibit the translation of mRNA into a protein do. The antisense sequence of the present invention refers to a DNA or RNA sequence that is complementary to CNOT2 mRNA and capable of binding CNOT2 mRNA and can be used for translation of CNOT2 mRNA, translocation into the cytoplasm, maturation, or any other overall biological function Lt; RTI ID = 0.0 > activity. ≪ / RTI > The antisense oligonucleotides may be synthesized in vitro in a conventional manner and administered in vivo or may allow the synthesis of antisense oligonucleotides in vivo. An example of synthesizing antisense oligonucleotides in vitro is RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to allow the antisense RNA to be transcribed using a vector whose recognition site (MCS) origin is in the opposite direction. Such antisense RNAs are preferably made such that translation stop codons are present in the sequence so that they are not translated into the peptide sequence.

In the present invention, siRNA means a nucleic acid molecule capable of mediating RNA interference or gene silencing. siRNA is provided as an efficient gene knock-down method or gene therapy method since it can inhibit the expression of a target gene. The siRNA molecule of the present invention may have a structure in which a sense strand (a sequence corresponding to a CNOT2 mRNA sequence) and an antisense strand (a sequence complementary to a CNOT2 mRNA sequence) are located on opposite sides to form a double strand, SiRNA molecule of the invention may have a single stranded structure with self-complementary sense and antisense strands. Furthermore, siRNAs are not limited to the complete pairing of double-stranded RNA moieties in RNA pairs, but may be mated by mismatch (corresponding bases are not complementary), bulge (no bases corresponding to one strand) And a portion that is not achieved may be included. In addition, the siRNA terminal structure can be blunt or cohesive, as long as it can inhibit the expression of the CNOT2 gene by the RNAi effect, and the adhesive terminal structure has a 3'-terminal protruding structure and a 5'-terminal Both protruding structures are possible. In addition, the siRNA molecule of the present invention may have a form in which a short nucleotide sequence is inserted between self-complementary sense and antisense strands, in which case the siRNA molecule formed by the expression of the nucleotide sequence is Thereby forming a hairpin structure, which in turn forms a stem-and-loop structure. The template-and-loop structure is processed in vitro or in vivo to produce siRNA molecules that are capable of mediating RNAi.

In the present invention, shRNA refers to small hairpin RNA or short hairpin RNA (shRNA), and has a small hairpin structure used for silencing gene expression by RNA interference. The shRNA is introduced into the cell using a vector. The shRNA hairpin structure is cleaved by other substances in the cell to form siRNA, which is bound to the RNA induced silencing complex (RISC) The mRNA is clipped to the mRNA having the correct part and the mRNA is cleaved. As a result, the mRNA is destroyed, so that the gene is not expressed and gene silencing occurs.

In the present invention, the CNOT2 gene inhibitor may preferably be siRNA, or shRNA. More preferably, it may be an siRNA of SEQ ID NO: 27 and an anti-sense sequence of SEQ ID NO: 29 or SEQ ID NO: 30.

As described above, since the CNOT2 gene inhibitor according to the present invention can regulate adipocyte formation by inhibiting the CNOT2 gene, it is possible to provide a pharmaceutical composition for preventing or treating metabolic diseases containing the CNOT2 gene inhibitor as an active ingredient.

In the present invention, a metabolic disease refers to a disease caused by an abnormality of energy metabolism in the body, and refers to a disease caused by abnormalities of adipocyte differentiation and lipid metabolism. Such metabolic diseases include, but are not limited to, obesity, diabetes, hyperlipidemia, hypercholesterolemia, atherosclerosis and fatty liver.

The composition of the present invention may be administered in various formulations, oral and parenteral, at the time of actual clinical administration. Formulations of the pharmaceutical composition comprising the CNOT2 gene inhibitor of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier. For example, oral administration may be in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. In the case of injections, unit dosage ampoules or multiple dosage forms may be prepared. Other solutions, suspensions, tablets, pills, capsules, sustained release formulations, and the like.

Examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltoditol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil. Further, it may further contain a filler, an anti-coagulant, a lubricant, a wetting agent, a fragrance, a preservative, and the like.

The composition of the present invention can be used as a medicine, as a therapeutic agent for metabolic diseases, orally or parenterally, and in particular, in an injection form. The route of administration of the pharmaceutical composition of the present invention may be, but is not limited to, oral, nasal, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, Intestinal, sublingual, inhalation or topical administration is possible. For such clinical administration, the pharmaceutical composition of the present invention can be formulated into a suitable formulation using known techniques.

Solid formulations for oral administration include tablets, pills, powders, granules and capsules, which may be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient such as starch, calcium carbonate, sucrose, lactose And gelatin. In addition to simple excipients, lubricants such as magnesium, stearide, and talc may also be used.

Liquid preparations for oral administration include suspensions, solutions, emulsions and syrups. Various excipients such as wetting agents, sweeteners, fragrances and preservatives may be included in addition to water and liquid paraffin, which are commonly used simple diluents. have.

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations and suppositories. Examples of the non-aqueous solvent and the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Witepsol, macrogol, tween 61, cacao paper, laurin, glycerol, gelatin and the like may be used as a base for suppositories.

The pharmaceutical composition of the present invention can be administered via parenteral administration, for example, by subcutaneous injection, intravenous injection, or the like.

The dosage of the pharmaceutical composition of the present invention varies depending on the condition and the weight of the patient, the degree of disease, the type of drug, the administration route and the period, and can be appropriately selected by those skilled in the art. However, for the desired effect, the pharmaceutically effective amount of the CNOT2 gene inhibitor of the present invention is 0.5 to 100 mg / day / body weight, preferably 0.5 to 5 mg / day / body weight. However, the pharmaceutically effective amount may be appropriately changed depending on the degree of obesity or lipid-related metabolic disease symptoms, the patient's age, body weight, health condition, sex, administration route and treatment period. The CNOT2 gene inhibitor of the present invention may be administered once a day or divided into several doses. However, the scope of the present invention is not limited to these dosages.

In addition, the composition of the present invention can be used alone or in combination with methods using hormone therapy, chemotherapy, and biological response modifiers for the prevention or treatment of metabolic diseases, and can also be used as a supplements or quasi-drugs in addition to medicines.

The present invention provides a composition for diagnosing metabolic diseases comprising a probe or a primer having a sequence complementary to a nucleotide sequence of a CNOT2 gene. By measuring the expression level of the CNOT2 gene according to the present invention, it is possible to diagnose a metabolic disease.

The probe or primer contained in the diagnostic composition of the present invention has a sequence complementary to the nucleotide sequence of the CNOT2 gene, and the sequence of the CNOT2 gene referred to in the present invention may be SEQ ID NO: 1 or 2.

The diagnosis is a term for confirming a pathological condition. The diagnosis in the present invention includes the determination of whether the CNOT2 gene is expressed or not and the degree of expression of the CNOT2 gene to determine whether or not the metabolic disease is caused, development and alleviation. The diagnostic composition of the present invention may further comprise a buffer or reaction solution which stably maintains the structure or physiological activity of the probe or the primer in addition to the probe or primer having a sequence complementary to the nucleotide sequence of the CNOT2 gene of the present invention And may be provided in powder form or dissolved in a suitable buffer to maintain stability.

In the present invention, probes refer to linear oligomers of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, which can hybridize specifically to the target nucleotide sequence and are naturally occurring or artificially . The probes according to the present invention may be single-stranded, preferably oligodeoxyribonucleotides.

In the present invention, a primer is a single-stranded oligonucleotide capable of acting as a starting point for template-directed DNA synthesis under suitable conditions (i.e., four different nucleoside triphosphates and polymerization enzymes) in a suitable buffer and a suitable temperature. . The appropriate length of the primer may vary depending on various factors, such as temperature and use of the primer. The primer according to the present invention is preferably used for gene amplification reaction, and may be a pair of primers consisting of SEQ ID NOS: 3 and 4, or a pair of primers consisting of SEQ ID NOS: 17 and 18. Such gene amplification reactions are well known in the art and include, for example, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), ligase Chain reaction (LCR), electron mediated amplification (TMA), nucleic acid sequence substrate amplification (NASBA), and the like. When the composition for diagnosing metabolic diseases of the present invention is applied to a PCR amplification process as a component of a kit, the kit of the present invention may optionally contain a reagent necessary for PCR amplification, such as a buffer, a DNA polymerase (for example, Thermus aquaticus (Taq) Thermostable DNA polymerases obtained from Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase joins and dNTPs.

(A) contacting a cell containing the CNOT2 gene or protein with a sample to be analyzed; (b) measuring the expression level of the CNOT2 gene, the amount of the CNOT2 protein or the activity of the CNOT2 protein; And (c) when the amount of expression of CNOT2 gene, the amount of CNOT2 protein, or the activity of CNOT2 protein is decreased as a result of the measurement of step (b), the sample is judged to be a substance for treating or preventing metabolic diseases A method for screening a substance for preventing or treating a metabolic disease.

According to the method of the present invention, a sample to be analyzed can be first contacted with cells containing the CNOT2 gene or protein. Here, the sample refers to an unknown substance used in screening to examine the expression level of CNOT2 gene, the amount of CNOT2 protein or the activity of CNOT2 protein. The sample may include, but is not limited to, chemicals, nucleotides, antisense-RNA, small interference RNA (siRNA), and natural extracts. The expression level of the CNOT2 gene, the amount of the CNOT2 protein, or the activity of the CNOT2 protein can be measured in the cells treated with the sample. As a result, the expression amount of the CNOT2 gene, the amount of the CNOT2 protein or the activity of the CNOT2 protein is decreased The sample can be judged to be a substance for treating or preventing a metabolic disease.

Methods for measuring the expression level of CNOT2 gene, the amount of CNOT2 protein or the activity of CNOT2 protein can be performed through various methods known in the art. For example, A reverse transcriptase-polymerase chain reaction, a real time-polymerase chain reaction, a Western blot, a Northern blot, an enzyme linked immunosorbent assay (ELISA), a radioimmunoassay (RIA) (radioimmunodiffusion) and immunoprecipitation assays (immunoprecipitation assays).

The CNOT2 gene according to the present invention functions as a regulator of lipid differentiation in cells and promotes the expression of lipogenic genes, thereby affecting lipid accumulation and fat cell size increase, resulting in metabolic diseases. Therefore, CNOT2 gene inhibitor Inhibition of the expression of this gene can have an action effect of inhibiting the induction of metabolic diseases and can also be used as a target gene of a diagnostic or therapeutic agent for metabolic diseases.

FIG. 1 is a graph showing an increase in protein and mRNA expression of CNOT2 and lipogenesis-related genes in 3T3L-1 cells during adipogenic differentiation.
Fig. 2 is a graph showing inhibition of adipocyte formation in 3T3L-1 cells inhibiting CNOT2 expression.
Fig. 3 is a graph showing OD value results measured for inhibition of adipocyte formation in 3T3L-1 cells inhibiting CNOT2 expression. Fig.
FIG. 4 is a graph showing the inhibition of lipogenesis-related protein expression in 3T3L-1 cells inhibiting CNOT2 expression.
FIG. 5 is a graph showing the inhibition of the expression of lipogenesis-related proteins and mRNA in MDA-MD-231 cells of breast cancer cells inhibiting CNOT2 expression

Best Mode for Carrying Out the Invention Hereinafter, preferred examples and formulation examples are shown to facilitate understanding of the present invention. However, the following examples and preparative examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples or preparation examples.

Example 1 Adipocyte differentiation of 3T3-L1 cell line

3T3-L1 cells (source: American Type Culture Collection, Manassas, Va., USA) were seeded in 6-well plates and incubated for 2 days in 100% confluent (day 0) / mL Insulin was added to induce differentiation. Differentiation was carried out for two days in 100% confluent state (day 0), until day 8, and cells were collected on days 2, 4, 6 and 8.

Example 2 Confirmation of Gene Expression Changes in Adipocyte Differentiation of 3T3-L1 Cell Lines

During the differentiation of 3T3-L1 cells into adipocytes, changes in the expression of CNOT2 gene associated with adipocytes were confirmed by Western blot and RT-PCR.

As in Example 1, 3T3-L1 cells were lipogenesis-differentiated, and cells were collected at 2, 4, 6, and 8 days intervals. Then, Western blotting was carried out using CNOT2 and lipogenesis-related genes (PPARγ and C / EBPα) Changes in the amount of protein were confirmed.

The results are shown in Fig. As shown in Fig. 1 (A), it was confirmed that the CNOT2 gene was increased as the differentiation into adipocytes progressed, and PPAR? And C / EBP?

In the same manner, 3T3-L1 cells were lipogenesis-differentiated, and the cells were collected at 2, 4, 6 and 8 days intervals, and RNA was extracted and RT-PCR was performed.

In order to perform RT-PCR, TRIzol reagent (Life Technologies) was added to the cells, and RNA was extracted according to the manufacturer's instructions, and cDNA was synthesized using 2 ug of RNA. For qRT-PCR, the Lightcycler SYBR Green PCR material mixture (Roche Applied Sciences) was used for analysis using the Lightcycler ™ instrument. The sequence of the primers used in the RT-qPCR was as follows, and GAPDH was used as an internal control.

[Table 1] Primer sequence

The results of the above experiment are shown in Fig. The expression of CNOT2 gene was increased by adipocyte differentiation, and PPARγ, C / EBPα, aP2, and adiponectin, which are adipogenic differentiation genes, were also increased by adipocyte differentiation. In the case of C / EBPβ, Respectively.

From the above results, it was confirmed that the level of transcription of CNOT2 increased according to the lipid differentiation process.

Example 3 Confirmation of adipocyte differentiation and lipogenesis inhibition in siRNA-treated 3T3-L1 cells

For knockdown of CNOT2 gene, expression of CNOT2 gene was inhibited using siRNA. Purchase CNOT2 siRNA (SEQ ID NO: 27; sense sequence- GUUGGACCUUUCAGAUUUU, SEQ ID NO: 28: anastisense seqeunce- AAAUCUGAAAGGUCCAAUCUU) (Thermo Scientific Company, USA) and control siRNA (Biona, Korea) for knockdown with siRNA, CNOT2 siRNA (Thermo scientific company, USA) and control siRNA (Bioneer, Korea) were transfected into 3T3L-1 cells using lipofetamine 2000, respectively. The next day, cells were replaced with fresh medium.

Cells were washed in PBS and fixed with paraformaldehyde for 1 hour at 2, 4, 6 and 8 days after differentiation of the siRNA-treated control adipocytes and CNOT2 knockdown adipocytes prepared above. It was then washed three times with water. A solution prepared by dissolving 0.5 g of oil-red-O in isopropanol (100 ml) and a mixed solution (60 ml) and distilled shoe (40 ml) was added to the cells and stored at room temperature for 1 hour for staining. The stained cells were washed and washed with water, and the stained cells were dried at room temperature. Then, the stained solution was dissolved in 200% isopropanol for 10 minutes, and the optical density was measured spectroscopically at a wavelength of 500 nm.

The results are shown in Fig. 2 and Fig. FIG. 2 shows the result of confirming the differentiation of the adipocyte into oil-red-O and then microscopically, and FIG. 3 shows the measured OD value. As can be seen, the formation of adipocytes in CNOT2 siRNA treated cells was markedly reduced by visual observation and OD measurement results.

In addition, changes in markers of lipid differentiation formation were confirmed when CNOT2 was inhibited by Western blotting in the same manner as in Example 2 above. The results are shown in Fig. As shown in FIG. 4, it was confirmed that the expression of PPARγ and C / EBPα, which are lipid differentiation-forming markers, is reduced in CNOT2 knockdown cells inhibited by CNOT2.

Example 4 Identification of adipocyte differentiation and inhibition of adipogenesis in shRNA-treated cells

For the CNOT2 gene knockdown, the expression of the CNOT2 gene was inhibited using shRNA (SEQ ID NO: 29 shRNA # 1 CCGGCGGGTTACTAACATTCCTCAACTCGAGTTGAGGAATGTTAGTAACCCGTTTTT, SEQ ID NO: 30: shRNA # 2 CCGGATGAATGGAGGAGACGTATTACTCGAGTAATACGTCTCCTCCATTCATTTTTTG). For knockdown with shRNA, CNOT2 shRNA was purchased from sigma and shRNAcnot2 cell line lacking CNOT2 in MDA-MB-231 cell line was prepared according to the manufacturer's instructions.

The expression of fat-related genes was confirmed by Western blotting and RT-qPCR in the same manner as in Example 2, and the results are shown in Fig.

FIG. 5A shows the results of confirming the changes in the differentiation-forming markers through Western blotting in the MDA-MB-231 cell line knocked down with shRNA. As shown in Fig. 5A, it was confirmed that the expression of PPARγ and C / EBPα was significantly reduced when CNOT2 was deficient.

FIG. 5B shows the results of confirming the changes of lipid differentiation formation markers through RT-qPCR in MDA-MB-231 cell line knockdown with shRNA. As shown in Fig. 5B, when CNOT2 was deficient, expression of C / EBP?, C / EBP? And AP2 was remarkably reduced.

These results confirm that CNOT2 gene acts as a regulator of lipid differentiation in cells and regulates the expression of lipogenesis-related genes. Inhibition of CNOT2 gene has a remarkable effect on prevention or treatment of metabolic diseases .

<110> University-Industry Cooperation Group of Kyung Hee University <120> COMPOSITION FOR PREVENTING OR TREATING METABOLIC DISEASE <130> P15-019-KHU <160> 30 <170> Kopatentin 2.0 <210> 1 <211> 1770 <212> DNA <213> Homo sapiens <220> <221> gene &Lt; 222 > (1) .. (1770) <223> CCR4 NOT transcription complex subunit 2 mRNA <400> 1 cttggatccg cgggacaaga aaattcatgc gagggagacg tggtgggcgg tccttcctgt 60 gacacgaccc ttgagtgaca gttctatttg attgcctccg gtactgtgag gaaaggacac 120 gactctatgg tgaggactga tggacataca ttatctgaga aaagaaacta ccaggtgaca 180 aacagcatgt ttggtgcttc aagaaagaag tttgtagagg gggtcgacag tgactaccat 240 gacgaaaaca tgtactacag ccagtcttct atgtttccac atcggtcaga aaaagatatg 300 ctggcatcac catctacatc aggtcagctg tctcagtttg gggcaagttt atacgggcaa 360 caaagtgcac taggccttcc aatgaggggg atgagcaaca atacccctca gttaaatcgc 420 agcttatcac aaggcactca gttaccgagc cacgtcacgc caacaacagg ggtaccaaca 480 atgtcacttc acacgcctcc atctccaagc aggggtattt tgcctatgaa tcctaggaat 540 atgatgaacc actcccaggt tggtcagggc attggaattc ctagcaggac aaatagcatg 600 agcagttcag ggttaggtag ccccaacaga agctcgccaa gcataatatg tatgccaaag 660 cagcagcctt ctcgacagcc ttttactgtg aacagtatgt ctggatttgg aatgaacagg 720 aatcaggcat ttggaatgaa taactcctta tcaagtaaca tttttaatgg aacagacgga 780 agtgaaaatg tgacaggatt ggacctttca gatttcccag cattagcaga ccgaaacagg 840 agggaaggaa gtggtaaccc aactccatta ataaacccct tggctggaag agctccttat 900 gttggaatgg taacaaaacc agcaaatgaa caatcccagg acttctcaat acacaatgaa 960 gattttccag cattaccagg ctccagctat aaagatccaa catcaagtaa tgatgacagt 1020 aaatctaatt tgaatacatc tggcaagaca acttcaagta cagatggacc caaattccct 1080 ggagataaaa gttcaacaac acaaaataat aaccagcaga aaaaagggat ccaggtgtta 1140 cctgatggtc gggttactaa cattcctcaa gggatggtga cggaccaatt tggaatgatt 1200 ggcctgttaa catttatcag ggcagcagag acagacccag gaatggtaca tcttgcatta 1260 ggaagtgact taacaacatt aggcctcaat ctgaactctc ctgaaaatct ctaccccaaa 1320 tttgcgtcac cctgggcatc ttcaccttgt cgacctcaag acatagactt ccatgttcca 1380 tctgagtact taacgaacat tcacattagg gataagctgg ctgcaataaa acttggccga 1440 tatggtgaag accttctctt ctatctctat tacatgaatg gaggagacgt attacaactt 1500 ttagctgcag tggagctttt taaccgtgat tggagatacc acaaagaaga acgagtatgg 1560 attaccaggg caccaggcat ggagccaaca atgaaaacca atacctatga gaggggaaca 1620 tattacttct ttgactgtct taactggagg aaagtagcta aggagttcca tctggaatat 1680 gacaaattag aagaacggcc tcacctgcca tccaccttca actacaaccc tgctcagcaa 1740 gccttctaaa aaaaaaaaaa aaaaaaaaaa 1770 <210> 2 <211> 3014 <212> DNA <213> Mus musculus <220> <221> gene &Lt; 222 > (1) <223> CCR4-NOT transcription complex, subunit 2, mRNA <400> 2 gatacgtcgc catcttggat ccgcgggaca agaaaattca tgcgtactgt gaggaaagga 60 cacgactcta tggtgaggac tgatggacat acattatctg agaaaagaaa ctaccagagc 120 agaagaatcc catcgtttat catgttctgg ttggactcct ttcttatcgt ttgctggagt 180 ttgaacttca gagctatggt gtcaaccctg ctgtaatatc tcaggggagc tcctagtgtg 240 gggctggtgc catggctcac cctccaacct ttccttcttc acttcagcct ccagctctga 300 gctttcccat ccccagagta gcaaatgttg aaagaagttg cacaggtgac aaacagcatg 360 tttggtgctt caagaaagaa gtttgtagag ggggtggaca gcgactacca tgatgagaac 420 atgtactaca gccagtcttc tatgttccca catcggtcag agaaagatat gctggcatcg 480 ccatctacgt caggtcagct gtctcaattt ggggcaagtt tatacgggca acaaagtgca 540 ctaggccttc caatgagggg gatgagcaac aatacccctc agttaaatcg cagcttatca 600 caaggcactc agttaccgag ccacgtcacg ccaacaacag gggtaccaac aatgtcactt 660 cacacgcctc catctccaag caggggtatt ttgcctatga atcctaggaa tatgatgaac 720 cactcccagg ttggtcaggg cattggaatt cctagcagga caaatagcat gagcagttca 780 gggttaggta gccccaacag aagctcgcca agcataatat gtatgccaaa gcaacagcct 840 tctcgacagc cttttactgt gaacagtatg tctggatttg gaatgaacag gaatcaggca 900 tttggaatga ataactcctt atcaagtaac atttttaatg gaacagatgg cagtgaaaat 960 gtgacaggat tggacctttc agatttccca gcgttagctg accggaatag aagggaaggg 1020 agcggcaacc caactccatt aataaacccc ttggctggaa gagctcctta cgttggaatg 1080 gtaacaaaac ctgcaaatga gcaatcccaa gacttctcaa tacacaacga agattttcca 1140 gcattacctg gttccagcta taaagatcca acgtcaagta atgacgacag caaatctaat 1200 ttgagtacat cggggaagac gacttcaagt acagatggac ccaaattccc tggagataaa 1260 agttcaacaa cacaaaacaa taatcaacag aaaaagggga tccaggtgtt acctgatggt 1320 cgagttacta acattcctca agggatggtg acggaccaat ttggaatgat tggcctgtta 1380 acatttatca gggcagcaga gacagaccca ggaatggtac atcttgcttt aggaagtgac 1440 ttaacaacat taggcctcaa tctgaactca cctgaaaatc tctatcccaa atttgcatca 1500 ccctgggctt cttcaccttg tcggcctcaa gacatagact tccatgttcc atcagaatat 1560 ttaacaaaca ttcacattag ggataagctg gctgcaatca aacttggccg atatggagaa 1620 gacctcctct tctatctgta ttacatgaac ggcggggatg tattacaact cttagctgcg 1680 gtagaacttt ttaaccgtga ttggagatac cacaaggagg agcgggtatg gattaccagg 1740 gcaccaggca tggagccaac aatgaaaacc aacacgtatg agcgggggac ctactatttc 1800 tttgactgtc tcaactggag gaaagtagct aaggagttcc atctggaata tgacaaatta 1860 gaagagcggc ctcacctgcc atccaccttc aactacaacc ctgctcagca agccttctaa 1920 aaagacttcc cttttcttgg ggtatggctg tctcagcaca atactcgaca taactgcaga 1980 gctgatgtgg ctcaggcacc ctggttttaa tcccttgagg atctggcaat tggcttacgt 2040 aaagaaaggg tcaccatttg aggtcctgcc ttaccaatta tgtgctgccc aacaactaaa 2100 tttgtaattt gttttctcta ctttgagcag ggtctgaatt ttttcattta ttttcttttt 2160 gccagcagac agacttgggt ctataaagac aagcaagtac actgacagaa attaccattt 2220 agtttcttaa atgtaaaaaa agaaaaccca caaaagactc aacaaaatta gaccacaaaa 2280 tttgcattgt tcattgtagc actattggta ataaaagaac agatgtttgt gcatttttat 2340 gtgaagatcc ttctcgtatt tcatttggaa ggatgagcga ggtctgcttc tttcttttta 2400 cttcccctgt gtttctgaaa ggcggtttgg ccaggcttac tgcaggcatc cgactgtaga 2460 gatcgccaca gtctctgggg ctccagggct gcgctgtaac tgagcttcat ccagaatgag 2520 caaaacactg tccagtcttt gttacgattt tgtaataaat gtgtacattt tttttaaatt 2580 ttggacatca catgaataaa ggtatgtatg tacgaatgtg tatatattat atatatgaca 2640 tctattttgg aaaatgtttg ccctgctgta cctcattttt aggaggtgtg catggatgca 2700 atatatgaaa atgggacatt ctggaactgc tggtcagggg actttgtcgc cctgtgcact 2760 aaagggccag attttcagca gccaaggaca tccataccca agtgaatgtg atggggcttc 2820 aagacgtgaa ctgagacaat tcactctggc tgtttgaaca gcagcgtttc ataggaagag 2880 aaaaagatca atcttgtatt ttctgaccac ataaaggctt cttctctttg taataaagta 2940 gaaaagctct cctcaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 3000 aaaaaaaaaa aaaa 3014 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse cnot2 forward primer <400> 3 tgctcagcaa gccttctaaa 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse cnot2 reverse primer <400> 4 gccagatcct caagggatta 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse C / EBP a forward primer <400> 5 gtgctggagt tgaccagtga 20 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> mouse C / EBP reverse primer <400> 6 ccaaggagct ctcaggcag 19 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> mouse C / EBP beta forward primer <400> 7 gcaagagccg cgacaag 17 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> mouse C / EBP beta reverse primer <400> 8 ggctcgggca gctgctt 17 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse PPAR gamma forward primer <400> 9 atgggtgaaa ctctgggaga 20 <210> 10 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> mouse PPAR gamma reverse primer <400> 10 cttgtgaagt gctcagc 17 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse adiponectin forward primer <400> 11 aagaaggaca aggccgttct c 21 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> mouse adiponectin reverse primer <400> 12 gagtccattg tggtcccc 18 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse AP2 forward primer <400> 13 gcatgagcca aaggaagagg 20 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> mouse AP2 reverse primer <400> 14 ccgactgact attgtagtg 19 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH forward primer <400> 15 gcttgtcatc aacgggaag 19 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH reverse primer <400> 16 gatgttagtg gggtctcg 18 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human CNOT2 forward primer <400> 17 ggtaacccaa ctccattaat aaacc 25 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> human CNOT2 reverse primer <400> 18 tgctggtttt gttaccattc c 21 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human AP2 forward primer <400> 19 accaggaaag tggctggcat 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human AP2 reverse primer <400> 20 caggtcaacg tcccttggct 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human CEBP a forward primer <400> 21 cggtggacaa gaacagcaac 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human CEBP a reverse primer <400> 22 cggaatctcc tagtcctggc 20 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> human CEBP beta forward primer <400> 23 cacagcgacg actgcaagat c 21 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> human CEBP beta reverse primer <400> 24 cttgaacaag ttccgcaggg tg 22 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> human GAPDH forward primer <400> 25 cttttaactc tggtaaagtg g 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> human GAPDH reverse primer <400> 26 ttttggctcc cccctgcaaa t 21 <210> 27 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> CNOT2 siRNA sense sequence <400> 27 guuggaccuu ucagauuuuu 20 <210> 28 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> CNOT2 siRNA anti-sense sequence <400> 28 aaaucugaaa gguccaaucu u 21 <210> 29 <211> 57 <212> RNA <213> Artificial Sequence <220> <223> CNOT2 shRNA NO.1 <400> 29 ccggcgggtt actaacattc ctcaactcga gttgaggaat gttagtaacc cgttttt 57 <210> 30 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> CNOT2 shRNA NO.2 <400> 30 ccggatgaat ggaggagacg tattactcga gtaatacgtc tcctccattc attttttg 58

Claims (12)

NOT transcription complex subunit 2 (CNOT2) gene selected from the group consisting of antisense oligonucleotides, siRNA (small interfering RNA) and shRNA (small hairpin RNA) of genes encoding CCR4-NOT transcription complex subunit 2 (CNOT2) A pharmaceutical composition for preventing or treating obesity comprising an inhibitor as an active ingredient. delete The pharmaceutical composition for preventing or treating obesity according to claim 1, wherein the siRNA is SEQ ID NO: 27 and SEQ ID NO: 28. The pharmaceutical composition for preventing or treating obesity according to claim 1, wherein the shRNA is SEQ ID NO: 29 or SEQ ID NO: 30. delete A composition for diagnosing obesity comprising a probe or a primer having a sequence complementary to a nucleotide sequence of a CNOT2 gene. 7. The composition for diagnosing obesity according to claim 6, wherein said probe or primer comprises SEQ ID NOS: 3 and 4, or SEQ ID NO: 17 and SEQ ID NO: 18. delete An obesity diagnostic kit comprising a probe or primer having a sequence complementary to a nucleotide sequence of a CNOT2 gene. (a) contacting a cell containing the CNOT2 gene or protein with a sample to be analyzed; (b) measuring the expression level of the CNOT2 gene, the amount of the CNOT2 protein or the activity of the CNOT2 protein; And (c) when the amount of expression of CNOT2 gene, the amount of CNOT2 protein, or the activity of CNOT2 protein is decreased as a result of measurement in step (b), the sample is judged to be a substance for treating or preventing obesity , A method for screening a substance for preventing or treating obesity. 11. The method of claim 10,
The measurement of step (b) may be performed using a reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, Western blotting, northern blotting, enzyme linked immunosorbent assay (ELISA) Wherein the method is selected from the group consisting of radioimmunoassay (RIA), radioimmunodiffusion, and immunoprecipitation assay. delete

Images