KR102475915B1 - Marker composition for diagnosing vascular calcification comprising miRNA-27a-3p and pharmaceutical composition for preventing or treating vascular calcification comprising an expression inhibitor of a target gene thereof - Google Patents

Abstract

The present invention relates to a marker composition for diagnosing vascular calcification, including miRNA-27a-3p, and a pharmaceutical composition for preventing or treating vascular calcification, including an expression inhibitor of its target gene. Among high clinical patients, it can be applied to cases where it is difficult to diagnose vascular calcification inside blood vessels by conventional methods, or can be used as a biomarker for diagnosing vascular calcification.

Description

A marker composition for diagnosing vascular calcification comprising miRNA-27a-3p and a pharmaceutical composition for preventing or treating vascular calcification comprising an expression inhibitor of its target gene {Marker composition for diagnosing vascular calcification comprising miRNA-27a-3p and pharmaceutical composition for preventing or treating vascular calcification comprising an expression inhibitor of a target gene thereof}

The present invention relates to a marker composition for diagnosing vascular calcification containing miRNA-27a-3p and a pharmaceutical composition for preventing or treating vascular calcification containing an expression inhibitor of its target gene, and more particularly, miRNA-27a in a vascular calcification model. The present invention relates to a technology capable of treating vascular calcification by measuring the decrease in expression of -3p and using it for diagnosing vascular calcification and suppressing the expression of ATF3, a target gene of miRNA-27a-3p.

Vascular calcification refers to the deposition of minerals such as calcium phosphate in bones and soft tissues. Calcification in soft tissues such as blood vessels, kidneys, brain, heart, lungs, etc. is referred to as ectopic calcification, and exhibits the characteristics of a pathological disease different from normal calcified areas such as bones and teeth. Extensive vascular calcification, including coronary arteries, is commonly observed in patients with chronic kidney disease. Traditional risk factors such as hypertension, diabetes, dyslipidemia, aging, and smoking affect the occurrence of vascular calcification.

Vascular calcification is classified into two types: atherosclerotic calcification and medial artery calcification. In patients with chronic kidney disease, the concentration of calcium-phosphorus complex is elevated due to decreased renal function. If this phenomenon continues, vascular calcification occurs in the vascular smooth muscle cells constituting the medial artery. Although various drugs such as phosphate binders, active vitamin D analogs, and calcium analogs have been developed and used to control vascular calcification, their therapeutic effects are insignificant, and vascular calcification is still present in patients with chronic kidney disease. appears frequently.

Several factors and mechanisms may influence the pathogenesis of vascular calcification. Vascular calcification is associated with cardiovascular disease, and cardiovascular disease is currently one of the diseases with high mortality. Therefore, for more effective treatment of vascular calcification, it is necessary to find a new mechanism involved in the occurrence of vascular calcification.

Micro RNA is a single-stranded non-coding RNA with a 22-nucleotide sequence and is expressed in various tissues. MicroRNA regulates gene expression by binding to the 3'UTR (3' untranslated region) of the target gene. One microRNA may target and regulate multiple genes, and multiple microRNAs may regulate one target gene.

Currently, many reports have been made on microRNAs that act in the mechanism of vascular calcification, but microRNAs that act as preventive and therapeutic compositions for vascular calcification using them have not been reported.

Accordingly, the present inventors identified a new regulatory mechanism of vascular calcification mediated by miRNA-27a-3p (microRNA-27a-3p) acting in the vascular calcification mechanism and ATF3, a target gene. Since miRNA-27a-3p decreases in the vascular calcification model, it can be used for calcification diagnosis. When the miRNA-27a-3p mimic and miRNA-27a-3p's target gene, ATF3 siRNA, vascular calcification is blocked, it can be used for calcification diagnosis. It can be used for prevention or treatment.

Accordingly, an object of the present invention is to provide a marker composition for diagnosing vascular calcification containing miRNA-27a-3p.

Another object of the present invention is to provide a composition for diagnosing vascular calcification comprising an agent for measuring the expression level of miRNA-27a-3p.

Another object of the present invention is to provide a kit for diagnosing vascular calcification including a composition for diagnosing vascular calcification including an agent for measuring the expression level of miRNA-27a-3p.

Another object of the present invention is to provide an information providing method for diagnosing vascular calcification, which includes a measurement step of measuring the expression level of miRNA-27a-3p from a biological sample derived from a subject.

Another object of the present invention is to provide a method for screening a therapeutic agent for vascular calcification comprising the following steps:

A treatment step of treating cells expressing miRNA-27a-3p with a test substance in vitro; and

Selection step of selecting a test substance that increases miRNA-27a-3p expression level compared to the case where the test substance is not treated.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating vascular calcification containing an inhibitor of the expression of a gene encoding ATF3 or the activity of ATF3.

Another object of the present invention relates to the use of a preparation measuring the expression level of miRNA-27a-3p for diagnosing vascular calcification, or the use of an ATF3-encoding gene expression or ATF3 activity inhibitor for preventing or treating vascular calcification.

The present invention relates to a marker composition for diagnosing vascular calcification containing miRNA-27a-3p and a pharmaceutical composition for preventing or treating vascular calcification containing an expression inhibitor of its target gene. Since it decreases in the calcification model, it can be used for calcification diagnosis, and when the miRNA-27a-3p mimic and the target gene ATF3 siRNA of miRNA-27a-3p were treated, vascular calcification was blocked.

The present inventors have diligently studied to diagnose vascular calcification-related diseases and to develop a preventive or therapeutic composition. As a result, microRNA-27a-3p was significantly reduced in the vascular calcification model, and it was confirmed that vascular calcification was inhibited when the microRNA-27a-3p mimic was overexpressed in the vascular calcification-induced model.

On the other hand, it was confirmed that ATF3, as a target gene of microRNA-27a-3p, was regulated in the vascular calcification mechanism, and it was confirmed that ATF3 expression was reduced when miR-27a-3p was overexpressed. It was confirmed that vascular calcification was blocked in cells treated with ATF3 siRNA, whereas vascular calcification, reduced by the microRNA-27a-3p mimic, was aggravated again when ATF3 was overexpressed.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention is a marker composition for diagnosing vascular calcification comprising miRNA-27a-3p.

The miRNA-27a-3p may consist of the nucleotide sequence of SEQ ID NO: 1.

Another aspect of the present invention is a composition for diagnosing vascular calcification comprising an agent for measuring the expression level of miRNA-27a-3p.

The miRNA-27a-3p may consist of the nucleotide sequence of SEQ ID NO: 1.

In the present invention, agents for measuring the expression of miRNA-27a-3p may be sense and antisense primers or probes that complementarily bind to the miRNA, but are not limited thereto.

Another aspect of the present invention is a kit for diagnosing vascular calcification including a composition for diagnosing vascular calcification including an agent for measuring the expression level of miRNA-27a-3p.

Another aspect of the present invention is a method for providing information for diagnosing vascular calcification, comprising a measuring step of measuring the expression level of miRNA-27a-3p from a biological sample derived from a subject.

The miRNA-27a-3p may consist of the nucleotide sequence of SEQ ID NO: 1.

The biological sample may be one or more selected from the group consisting of tissues and cells.

In the present invention, the expression level of miRNA-27a-3p was determined by polymerase chain reaction (PCR), next generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction ( It may be measured through one or more methods selected from the group consisting of real-time PCR) and microarray, but is not limited thereto.

The information providing method may further include a step of determining that vascular calcification is determined when the expression level of miRNA-27a-3p in the subject sample is lower than the expression level of miRNA-27a-3p in the normal subject sample in the measurement step. .

Another aspect of the present invention is a method for screening a therapeutic agent for vascular calcification comprising the following steps:

A treatment step of treating cells expressing miRNA-27a-3p with a test substance in vitro; and

Selection step of selecting a test substance that increases miRNA-27a-3p expression level compared to the case where the test substance is not treated.

Another aspect of the present invention is a pharmaceutical composition for preventing or treating vascular calcification comprising an inhibitor of the expression of a gene encoding ATF3 or the activity of ATF3.

The expression inhibitor of the gene encoding ATF3 is siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), antisense oligonucleotide, probe, natural extract or compound that specifically binds to the mRNA of the gene It may be, for example, miRNA-27a-3p consisting of the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

The activity inhibitor of ATF3 is an oligopeptide, monoclonal antibody, polyclonal antibody, chimeric antibody, ligand, PNA (peptide nucleic acid), aptamer, natural extract that specifically binds to the ATF3 Or it may be a compound, for example, it may be miRNA-27a-3p consisting of the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

The pharmaceutical composition of the present invention may be used as a pharmaceutical composition comprising a pharmaceutically effective amount of an inhibitor of the expression of the gene encoding ATF3 or the activity of ATF3 and/or a pharmaceutically acceptable carrier.

As used herein, the term "pharmaceutically effective amount" means an amount sufficient to achieve the efficacy or activity of the expression of the gene encoding ATF3 or the activity inhibitor of ATF3 described above.

Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, including, but not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil; it is not going to be The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components.

The pharmaceutical composition according to the present invention can be administered to mammals including humans by various routes. The administration method may be any method commonly used, and may be administered through, for example, oral, dermal, intravenous, intramuscular, or subcutaneous routes.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, medical condition, food, administration time, administration route, excretion rate and reaction sensitivity, A ordinarily skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by those skilled in the art. or it may be prepared by incorporating into a multi-dose container. At this time, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, capsule or gel (eg, hydrogel), and may additionally contain a dispersing agent or stabilizer. .

The present invention relates to a marker composition for diagnosing vascular calcification, including miRNA-27a-3p, and a pharmaceutical composition for preventing or treating vascular calcification, including an expression inhibitor of its target gene. Among high clinical patients, it can be applied to cases where it is difficult to diagnose vascular calcification inside blood vessels by conventional methods, or can be used as a biomarker for diagnosing vascular calcification.

1 is a graph showing changes in the expression level of miRNA-27a-3p in calcification model cells induced by treating vascular smooth muscle cells with inorganic phosphate according to the present invention.
Figure 2 shows the difference in the degree of vascular calcification according to the overexpression of miRNA-27a-3p mimic in calcification model cells induced by treating vascular smooth muscle cells with inorganic phosphoric acid according to the present invention, alizarin red S (pH 4.2) staining This is a picture that was confirmed by .
Figure 3 is a graph showing the difference in the degree of calcium accumulation according to the overexpression of miRNA-27a-3p mimic in calcification model cells induced by treating vascular smooth muscle cells with inorganic phosphoric acid according to the present invention.
4 is a diagram showing that miRNA-27a-3p according to the present invention complementarily binds to the 3'UTR region of ATF3.
Figure 5 is a graph comparing promoter activity for wild-type and mutant ATF3-3'UTR by overexpression of miRNA-27a-3p mimic according to the present invention.
6 is a graph showing the mRNA expression level of ATF3 by overexpression of miRNA-27a-3p mimic according to the present invention.
7 is a graph showing the mRNA expression level of ATF3 in calcification model cells induced by treating vascular smooth muscle cells with inorganic phosphate according to the present invention.
8 is a photograph showing the difference in the degree of vascular calcification according to the presence or absence of ATF3 knockdown in calcification model cells induced by treating vascular smooth muscle cells with inorganic phosphoric acid according to the present invention by alizarin red S staining.
9 is a graph showing the difference in the degree of calcium accumulation by ATF3 and whether miRNA-27a-3p mimic was overexpressed in calcification model cells induced by treating vascular smooth muscle cells with inorganic phosphoric acid according to the present invention.
10 shows the degree of calcification (A), miRNA-27a-3p expression level (B) and ATF3 expression level (C) in calcification model animals induced by injecting vitamin D3 into mice according to the present invention. This is a picture showing the tissue immunoprecipitation method.

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and liquid/liquid is (volume/volume) %.

Example 1: Cell culture and induction of vascular calcification

1-1. Preparation of calcification model cells

After separating aortas from 6- to 7-week-old rats (Sprague Dawley), they were cultured in Ham's F12 medium containing collagenase, and then vascular smooth muscle cells were isolated. The isolated vascular smooth muscle cells were cultured in Dulbecco's modified Eagle's medium (hereinafter referred to as general medium) containing 10% fetal bovine serum (FBS).

An overexpression system using miRNA-27a-3p mimic (SMM-001, bioneer) was introduced into vascular smooth muscle cells. miRNA-27a-3p mimic is a synthetic RNA made with the same sequence as miRNA-27a-3p present in cells.

sequence number designation order One miR-27a-3p UUCACAGUGGGCUAAGUUCCGC

Specifically, 10 nM of miR-27a-3p mimic was transfected using RNAiMAX, and the next day, the medium was replaced with 10% fetal bovine serum (FBS). As a control (miR-control), a miRNA negative control (SMC-2001, bioneer) having a general miRNA structure but low homology to gene sequences of various species such as humans and mice was used.

Thereafter, vascular calcification was induced for vascular smooth muscle cells. In general, when smooth muscle cells are treated with 2 mM inorganic phosphoric acid, calcium begins to be deposited from day 3, mild calcification occurs, and complete calcification occurs after 5 to 6 days.

The group cultured only in normal medium was used as a control group (vehicle), and in the experimental group in which vascular calcification was induced, vascular smooth muscle cells were treated with 2 mM inorganic phosphoric acid in normal medium for 6 days, and the medium was changed once every 2 days.

1-2. Confirmation of calcification inhibitory effect by miRNA-27a-3p mimic overexpression

Using the calcification model cells prepared in Example 1-1, the relationship between miRNA-27a-3p and calcification was examined. First, the expression of miRNA-27a-3p in vascular smooth muscle cells with or without 2 mM inorganic phosphate was measured.

In the case of the primer, it was used after verifying that there was no non-specific binding inside the gene. The used miR-27a-3p primer (#4426961, ThermoFisher) was purchased and used as a primer that had been previously verified to not form a secondary structure inside the sequence.

Total RNA was isolated with a reagent (NucleoSpin®RNA/Protein), and the isolated RNA was treated with DNase I to remove any remaining DNA. RNA integrity was checked with a Bioanalyzer, and complementary DNA was synthesized using reverse transcriptase (SuperScript™). After reaction using a kit (QuantiTect SYBR Green PCR Kit), gene amplification experiments were performed using a gene amplification equipment (Rotor gene Q realtime PCR cycler). The results of all gene amplification experiments were corrected and quantified with the 18S RNA gene expression result, which is a housekeeping gene.

As can be seen in Figure 1, the expression of miRNA-27a-3p was reduced in the calcification model cells prepared by inorganic phosphate treatment.

In order to confirm the vascular calcification inhibitory effect according to this, after treating the vascular smooth muscle cells with inorganic phosphoric acid, the cells were fixed with 10% formalin at room temperature for 1 hour. After removing the formalin, rinsing with PBS three times and drying the cells slightly, 40 mM alizarin red S (pH 4.2) dye was added and allowed to react for 20 minutes. After staining, the cells were rinsed with tertiary distilled water to remove non-specifically stained cells.

As can be seen in FIG. 2, vascular smooth muscle cells overexpressing the miRNA-27a-3p mimic were treated with inorganic phosphoric acid to induce calcification model cells, and as a result, the degree of calcification was significantly reduced compared to the control group.

In order to check the amount of calcium accumulation in the calcification model cells, the calcification model cells were reacted with 0.6 N HCl for 24 hours in a refrigerated state, and then the amount of calcium was measured using a kit (QuantiChrom calcium assay kit). The amount of protein was measured using a kit (BCA protein assay kit). Calcium accumulation was measured and then corrected (mg mg ^-1 protein) by the amount of protein.

calcium stores
(mg/mg protein, Fold change) Inorganic phosphoric acid non-treatment (Vehicle) Inorganic Phosphate (Pi) 2 mM miR-control 1.00 7.99 miR-27a-3p mimic 1.00 2.68

As can be seen in Table 2 and FIG. 3, calcium accumulation increased by inorganic phosphate treatment in vascular smooth muscle cells was effectively blocked by overexpression of miRNA-27a-3p mimic.

Therefore, it was confirmed that vascular calcification can be suppressed as the expression of miRNA-27a-3p increases.

Example 2: Exploration of subgenes regulated by miRNA-27a-3p

Bioinformatic analysis was performed to screen genes complementary to miRNA-27a-3p using software programs www.targetscan.org/ and www.microrna.org.

As can be seen in Figure 4, the analysis result of complementary binding of miRNA-27a-3p to the 3'UTR region of ATF3 was obtained.

Therefore, we tried to confirm whether miRNA-27a-3p actually regulates ATF3 gene expression by binding to the 3'UTR of ATF3. Insert the gene sequence (SEQ ID NO: 2, underlined) containing the 3'UTR of ATF3 to which miR-27a-3p complementarily binds to the psiCHECK2 luciferase vector (C801A, Promega) containing the luciferase enzyme A wild-type vector ( psiCHECK2 luciferase- ATF3 3'UTR wt) was constructed by genetic recombination, and the 3'UTR gene sequence of ATF3 was mutated and inserted to prevent complementary binding of miR-27a-3p to the psiCHECK2 luciferase vector A mutant vector ( psiCHECK2 luciferase- ATF3 3'UTR mut) was constructed by genetic recombination.

sequence number designation order 2 Wild-type gene sequence of ATF3-3'UTR 1465-1471 AAAAUUCUGAUGUUU CUGUGAA A 3 Mutant gene sequence of ATF3-3'UTR 1465-1471 AAAAUUCUGAUGUUUCUUUUAAA

After seeding the cells in a 24-well plate, miR-27a-3p mimic and wild-type vector, or miR-27a-3p mimic and mutant vector were transduced using Lipofectamine 2000, respectively. At this time, the miR-27a-3p mimic was transduced at each concentration (10 nM, 20 nM, and 40 nM).

After 24 hours, with a kit (luciferase assay kit, E1500, Promega), cells into which miR-27a-3p mimic and wild type vector were introduced (wild type), and cells into which miR-27a-3p mimic and mutant vector were introduced ( mutant), luciferase activity was measured, and relative to the group not transduced with the miR-27a-3p mimic.

Luciferase activity miR-27a-3p mimic 0 nM miR-27a-3p mimic 10 nM miR-27a-3p mimic 20 nM miR-27a-3p mimic 40 nM wild type 1.00 0.83 0.56 0.43 variant 1.00 1.29 1.21 1.11

As can be seen in Table 4 and Figure 5, when the miR-27a-3p mimic was overexpressed at each concentration (10 nM, 20 nM and 40 nM), the promoter activity for wild-type ATF3-3'UTR was significant in a concentration-dependent manner , whereas the promoter activity for the mutant ATF3-3'UTR was not changed.

From these results, it can be confirmed that miR-27a-3p inhibits ATF3 gene expression by binding to ATF3 3'UTR.

Example 3: Correlation between miRNA-27a-3p and ATF3

The relationship between miRNA-27a-3p mimic and ATF3 expression was confirmed using the calcification model cells of Example 1-1.

In the case of the primer, it was used after verifying that there was no non-specific binding inside the gene. The ATF3 primers used were prepared after confirming that no secondary structure was formed within the sequence using the Primer3 program, and are shown in Table 5 below.

sequence number designation order 4 ATF3 F primers GCGAAGACTGGAAAATGA 5 ATF3 R primer TTTTGTTTCTTTCCCGCCGC

As can be seen in Figure 6, when the miRNA-27a-3p mimic was overexpressed in calcification model cells, the mRNA expression of ATF3 was significantly reduced compared to the control group.

As can be seen in Figure 7, when vascular calcification was induced by inorganic phosphate treatment in vascular smooth muscle cells overexpressing miRNA-27a-3p mimic, the mRNA expression of ATF3 significantly increased compared to the control group not treated with inorganic phosphate. It became.

ATF3 was knocked down in vascular smooth muscle cells using ATF3 siRNA (#25389, bioneer). Accordingly, inorganic phosphoric acid was treated and observed in contrast to scramble using alizarin red S staining. Scramble (bioneer) is a synthetic siRNA, which is a negative control siRNA, and has the same composition as the target siRNA, but has no homology to the target gene by randomly changing the order and was used as a control.

As can be seen in FIG. 8 , vascular calcification increased by inorganic phosphate treatment of vascular smooth muscle cells was blocked when ATF3 was knocked down.

Accordingly, if the expression of miRNA-27a-3p increases and the expression of ATF3 decreases, it can be expected that vascular calcification will be suppressed, so if the expression of ATF3 is increased again, it is confirmed by analyzing the degree of calcium accumulation to see if calcification proceeds again. did

Specifically, the pcDNA6/myc-His-ATF3 vector, an ATF3 overexpression vector, was prepared by inserting the coding region sequence of the rat ATF3 gene into the pcDNA6/myc-His vector (V22120, Thermofisher) by recombinant method, and miRNA-27a-3p Vascular calcification induction experiments were performed by transducing 1 ng/ul of the pcDNA6/myc-His-ATF3 vector into mimic-overexpressing vascular smooth muscle cells using lipofectamine 2000, over-expressing the cells, and treating them with inorganic phosphate.

Inorganic Phosphate (Pi) 2 mM + + + miR-27a-3p - + + pcDNA6-Atf3 - - + Calcium accumulation (mg/mg protein) 1.0 0.56 1.15

As can be seen in Table 6 and FIG. 9, calcium accumulation increased by inorganic phosphate treatment in vascular smooth muscle cells was blocked by miRNA-27a-3p, whereas calcium accumulation was increased again by overexpressing ATF3.

Example 4: Confirmation of effect by miRNA-27a-3p in calcification model animals

A vascular calcification model animal was prepared by inducing vascular calcification by injecting vitamin D3 into a mouse (mouse, C57BL/6, Samtaco Bio Korea). Specifically, after isolating the aorta of mice in which vascular calcification was induced by injection of vitamin D3, it was fixed with formalin at room temperature for 24 hours. After rinsing the tissue fixed with formalin three times with PBS (phosphate buffer saline), the tissue was dehydrated using ethanol, and then a paraffin-embedded block was made, and thinly cut tissue sections were prepared using a microtome.

Accordingly, the relationship between miR-27a-3p and Atf3 was observed in vascular calcification model animals over time of 1, 3, and 6 days using tissue immunoprecipitation.

In order to confirm the expression of miR-27a-3p, a probe (probe, YD00614838, Qiagen) designed specifically to react only to miR-27a-3p was bound to the aortic tissue section, rinsed with buffer (miRURY LNA miRNA ISH), and Non-specific binding was removed. In addition, using the antigen-antibody immune reaction, ATF3 (sc-188, Santa Cruz) and SM a-actin (sc-53015, Santa Cruz) primary antibodies were added to tissue sections, respectively, and reacted in a refrigerator for 24 hours, followed by PBS. After rinsing, fluorescent-conjugated secondary antibodies (A11008, A11011, ThermoFisher) were added to the tissue sections and reacted at room temperature for 1 hour. A mount solution containing DAPI for nuclear staining was placed in the tissue section, and the stained tissue section was covered with a cover slide and observed under a fluorescence microscope, and then a photograph was taken.

As can be seen in FIG. 10, miRNA-27a-3p expression (B) was decreased in calcification model animals (A), while ATF3 expression (C) was increased. Accordingly, it was confirmed that the expression of ATF3 increased as the expression of miRNA-27a-3p decreased in the body of the calcification model animal, and as a result, calcification progressed.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Marker composition for diagnosing vascular calcification comprising miRNA-27a-3p and pharmaceutical composition for preventing or treating vascular calcification comprising an expression inhibitor of a target gene <130> PN200153 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> RNA 213 <213> <400> 1 uucacagugg cuaaguuccg c 21 <210> 2 <211> 23 <212> RNA 213 <213> <400> 2 aaaauucuga uguuucugug aaa 23 <210> 3 <211> 23 <212> RNA <213> artificial sequence <220> <223> ATF3-3'UTR 1465-1471 mutated sequences <400> 3 aaaauucuga uguuucuuuu aaa 23 <210> 4 <211> 18 <212> DNA <213> artificial sequence <220> <223> ATF3 F primer <400> 4 gcgaagactg gaaaatga 18 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> ATF3 R primer <400> 5 ttttgtttct ttcccgccgc 20

Claims (15)

delete delete delete delete delete delete delete delete delete delete delete delete A small interference RNA (siRNA), short hairpin RNA (shRNA), miRNA (microRNA), antisense oligonucleotide, or probe that specifically binds to mRNA of a gene encoding ATF3, an expression inhibitor of the gene encoding ATF3; or
An inhibitor of the activity of ATF3, which is an oligopeptide, monoclonal antibody, polyclonal antibody, chimeric antibody, ligand, peptide nucleic acid (PNA), or aptamer that specifically binds to ATF3
A pharmaceutical composition for preventing or treating vascular calcification comprising a. The pharmaceutical composition for preventing or treating vascular calcification according to claim 13, wherein the miRNA is miRNA-27a-3p. delete

Images