JP6659250B2 - Cancer testing method, cancer cell growth inhibitor, anticancer agent and screening method for anticancer agent - Google Patents

Description

  The present invention relates to a method for examining cancer, a cancer cell growth inhibitor, an anticancer agent, and a method for screening an anticancer agent. More specifically, a cancer test method for detecting RAB39A and / or CPVL, a cancer cell growth inhibitor that suppresses the expression of RAB39A, CPVL, LHX2 and / or NUP210, an anticancer agent containing the inhibitor, and RAB39A and / or The present invention relates to a method for screening an anticancer agent using inhibition of the function and / or expression of CPVL as an index.

(Problems with current anticancer drugs)
The current anticancer drug treatment has low cancer cell specificity, and when it has a lethal effect on cancer, it often shows an impairment in normal cell lineages and often has strong biological side effects. On the other hand, although many molecular targeted drugs such as Herceptin and Iressa have poor biological side effects, they have low versatility for cancer types to be treated.
Therefore, regarding molecular target therapy for cancer, it is necessary to identify a new target that is applicable to more cancers, has a high therapeutic effect, and has very few side effects, and creates a new therapeutic method. Thus, identification of a target molecule having a specific cell-killing effect on cancer cells is essential for developing a new generation of anticancer drugs.

(Prior literature)
Prior art documents of the present invention include the following.
Patent Document 1 discloses “a method for predicting the response of an acute myeloid leukemia patient to an anticancer drug treatment using a marker gene containing CPVL”.
Patent Document 2 discloses “a method for predicting the response of an acute myeloid leukemia patient to an anticancer drug treatment using a marker gene containing CPVL”.
However, Patent Documents 1 and 2 do not disclose or suggest that “the presence or absence of cancer can be detected by detecting CPVL and that the growth of cancer cells is suppressed by inhibiting the expression of CPVL”.

  As described above, it is desired to develop a cancer cell growth inhibitor which suppresses the expression of the target molecule by screening for a novel target molecule specifically expressed in the cancer cell, and using the target molecule as an indicator. I have.

JP 2012-231798 A JP 2009-509525 Gazette

  In response to the above demands, the present invention screens for a novel target molecule specifically expressed in cancer cells, a method for testing cancer using the target molecule as an index, and a cancer cell growth inhibitor that suppresses the expression of the target molecule Another object of the present invention is to provide a method for screening an anticancer agent using inhibition of the function and / or expression of the target molecule as an index.

The present inventors have conducted intensive studies in order to solve the above problems, and as a result, performed principal component analysis using cancer cell lines and normal cell lines, and further, gene expression in normal cell lines was substantially eliminated. A plurality of target molecules including RAB39A, CPVL, LHX2, and NUP210, which maintain high expression in cancer cell lines regardless of the acidic culture environment and neutral culture environment, were identified. Furthermore, they found that cancer cell proliferation can be suppressed by suppressing the expression of RAB39A, CPVL, LHX2 and / or NUP210 in cancer cells.
Thus, a cancer test method for detecting RAB39A and / or CPVL, a cancer cell growth inhibitor that suppresses the expression of RAB39A, CPVL, LHX2 and / or NUP210, an anticancer agent containing the inhibitor, and RAB39A and / or CPVL Thus, a method for screening an anticancer agent using the inhibition of the function and / or the expression of the drug as an index was completed.

That is, the present invention includes the following.
1. A method for detecting cancer, comprising detecting RAB39A and / or CPVL from a sample derived from a subject.
2. The cancer of the patient includes adrenal gland tumor, breast cancer, cervical cancer, ovarian cancer, colon cancer, endometrial cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, lymphoma, leukemia, testicular tumor, pancreatic cancer, prostate cancer, gastric cancer, 2. The method for testing a cancer according to the above item 1, which is at least one selected from thyroid cancer and bladder cancer.
3. A cancer cell growth inhibitor comprising RNA capable of suppressing the expression of RAB39A, CPVL, LHX2 and / or NUP210.
4. 4. The cancer cell growth inhibitor according to the above item 3, wherein the RNA has the following nucleotide sequence as a target sequence.
(1) The nucleotide sequence described in SEQ ID NO: 1 (2) The nucleotide sequence described in SEQ ID NO: 2 (3) The nucleotide sequence described in SEQ ID NO: 3 (4) The nucleotide sequence described in SEQ ID NO: 4 (5) SEQ ID NO: 5 (6) The base sequence described in SEQ ID NO: 6 (7) The base sequence described in SEQ ID NO: 7 (8) The base sequence described in SEQ ID NO: 8 An anticancer agent comprising the cancer cell growth inhibitor according to the above item 4.
6. A method for screening an anticancer agent comprising the following steps,
(1) contacting the candidate compound with RAB39A and / or CPVL;
(2) determining whether the candidate compound inhibits the function and / or expression of RAB39A and / or CPVL;
A method for screening an anticancer agent, comprising:
7. A cancer test kit comprising one or more of the following antibodies.
(1) Anti-RAB39A antibody (2) Anti-CPVL antibody

  The present invention can provide a novel cancer test method, a cancer cell growth inhibitor, an anticancer agent containing the inhibitor, and a method for screening an anticancer agent.

In the diagram of Component1, X-Axis (horizontal axis direction) in which 21,259 expressed gene data is reduced to a two-dimensional diagram by principal component analysis, normal cell line (□: acidic culture, ■: neutral culture) and malignant cells Both series (○: acidic culture, ●: neutral culture) can be separated. ｝. The list of genes that make up Componen1 in the principal component analysis and their contribution values are shown. Among these genes, genes whose gene expression is high in cancer cell lines and poor in normal cell lines (almost zero) are underlined. Shows｝. Note that the larger the absolute value, the higher the contribution. Confirmation of inhibition of RAB39A, CPVL, LHX2 and NUP210 gene expression in HOS (human osteosarcoma cells) in neutral environmental culture (extracellular pH 7.4). In the figure, R, C, L and N indicate RAB39A, CPVL, LHX2 and NUP210, respectively. RAB39A black line is tumor growth curve of control. The dark gray line (target sequence 2) and the light gray line (target sequence 1) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The CPVL black line is the control tumor growth curve. The dark gray line (target sequence 3) and the light gray line (target sequence 4) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). LHX2 black line is the control tumor growth curve. The dark gray line (target sequence 6) and the light gray line (target sequence 5) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The black line of NUP210 is the tumor growth curve of the control. The dark gray line (target sequence 7) and the light gray line (target sequence 8) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). Confirmation of inhibition of RAB39A, CPVL, LHX2 and NUP210 gene expression in HOS (human osteosarcoma cells) in acidic environment culture (extracellular pH 6.8). RAB39A black line is tumor growth curve of control. The dark gray line (target sequence 2) and the light gray line (target sequence 1) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The CPVL black line is the control tumor growth curve. The dark gray line (target sequence 3) and the light gray line (target sequence 4) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). LHX2 black line is the control tumor growth curve. The dark gray line (target sequence 6) and the light gray line (target sequence 5) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The black line of NUP210 is the tumor growth curve of the control. The dark gray line (target sequence 7) and the light gray line (target sequence 8) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). Confirmation of inhibition of PRAME, SLITRK5, KCNG3 and FXYD6 gene expression in HOS (human osteosarcoma cells) in neutral environment culture (extracellular pH 7.4). In the figure, K, F and S indicate KCNG3, FXYD6 and SLITRK5, respectively. PRAME black line is the control tumor growth curve. The dark gray line (target sequence 9) and the light gray line (target sequence 10) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The black line for KCNG3 is the control tumor growth curve. The dark gray line (target sequence 11) and the light gray line (target sequence 12) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The black line of FXYD6 is the control tumor growth curve. The dark gray line (target sequence 13) and the light gray line (target sequence 14) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The black line of SLITRK5 is the control tumor growth curve. The dark gray line (target sequence 15) and the light gray line (target sequence 16) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). Confirmation of PRAME, SLITRK5, KCNG3 and FXYD6 gene expression inhibition in HOS (human osteosarcoma cells) in acidic environment culture (extracellular pH 6.8). The black line is the control tumor growth curve. The dark gray line and the light gray line are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). PRAME black line is the control tumor growth curve. The dark gray line (target sequence 9) and the light gray line (target sequence 10) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The black line for KCNG3 is the control tumor growth curve. The dark gray line (target sequence 11) and the light gray line (target sequence 12) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The black line of FXYD6 is the control tumor growth curve. The dark gray line (target sequence 13) and the light gray line (target sequence 14) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The black line of SLITRK5 is the control tumor growth curve. The dark gray line (target sequence 15) and the light gray line (target sequence 16) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). Effect of inhibiting RAB39A, CPVL, LHX2 and NUP210 expression on human mesenchymal stem cells (hMSCs) in neutral environmental culture (extracellular pH 7.4). RAB39A black line is tumor growth curve of control. The dark gray line (target sequence 2) and the light gray line (target sequence 1) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The CPVL black line is the control tumor growth curve. The dark gray line (target sequence 4) and the light gray line (target sequence 3) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). LHX2 black line is the control tumor growth curve. The dark gray line (target sequence 6) and the light gray line (target sequence 5) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). The black line of NUP210 is the tumor growth curve of the control. The dark gray line (target sequence 7) and the light gray line (target sequence 8) are tumor growth curves due to two types of gene expression inhibition (shRNA knock-down). Fig. 7 shows the RAB39A gene expression in normal tissues and lymphomas (cancer tissues) (results in other cancer tissues are omitted). [Fig. 6] Fig. 6 shows CPVL gene expression in normal tissues and thyroid cancer (cancer tissues) (results in other cancer tissues are omitted). Fig. 4 shows LHX2 gene expression in normal tissues and ovarian cancer (cancer tissues) (results in other cancer tissues are omitted). Fig. 7 shows NUP210 gene expression in normal tissues and cervical cancer (cancer tissue) (note that results in other cancer tissues are omitted).

  Hereinafter, a cancer test method for detecting RAB39A and / or CPVL of the present invention, a cancer cell growth inhibitor that suppresses the expression of RAB39A, CPVL, LHX2 and / or NUP210, an anticancer agent containing the inhibitor, and RAB39A and / or Alternatively, a method for screening an anticancer agent using inhibition of the function and / or expression of CPVL as an index will be described in detail, but the scope of the present invention is not limited by the following description.

(RAB39A)
RAB39A (Ensembl: ENSG00000179331) is a member of the RAS family and is known to be involved in vesicle transport, fusion of lysosome and phagosome, and the like.

(CPVL)
CPVL (carboxypeptidase, vitellogenic-like: yolk-forming carboxypeptidase-like protein, Ensembl: ENSG00000106066) is a carboxypeptidase that cleaves a single amino acid at the carboxy terminus of a protein or peptide, and has high homology to serine carboxypeptidase.

(LHX2)
LHX2 (LIM homeobox 2, Ensembl: ENSG00000106689) is known as a transcription activator that stimulates the promoter of the alpha glycoprotein gene.

(NUP210)
NUP210 (Nucleoporin 210 kDa, Ensembl: ENSG00000132182) is known to be involved in the regulation of ARF protein signaling.

(subject)
The subject in the present invention is intended for patients (mammals, preferably dogs, cats, horses, and more preferably humans) with all cancers (or possible cancers) at any stage (early stage, advanced stage, terminal stage). However, according to Example 3 below, at least the following cancers are targeted.
Adrenal tumor, breast cancer, cervical cancer, ovarian cancer, colorectal cancer, endometrial cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, lymphoma, leukemia, testicular tumor, pancreatic cancer, prostate cancer, gastric cancer, thyroid cancer, bladder cancer.

(sample)
The sample in the present invention is collected from a subject, and is not particularly limited as long as RAB39A and / or CPVL is present. Blood, lymph, cerebrospinal fluid, bone marrow fluid, saliva, urine, joint fluid, pleural effusion, ascites, Tear, aqueous humor, vitreous humor, nasal fluid, breast milk, semen, prostate fluid, vaginal fluid, pancreatic juice, bile, sweat, pus, bronchial lavage fluid, biopsy sample (gastric mucosa, colonic mucosa, bronchial mucosa, skin, muscle , Tumor, lymph node, uterine mucosa), anatomical specimen (pathological tissue, forensic tissue) and the like, and preferably a biopsy sample of tumor tissue.

(Cancer testing method)
The method for testing cancer of the present invention may be any method as long as it can detect RAB39A and / or CPVL in a sample derived from a subject.
When measuring the mRNA of RAB39A and / or CPVL, for example, it is selected from the group consisting of RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection analysis, Northern blotting and a DNA chip. Can be used, but is not particularly limited.
When measuring the expression level of a protein expressing RAB39A and / or CPVL, a method of detecting the protein using an antibody or ligand that specifically binds to the protein may be used, but the method is not particularly limited. As the antibodies against RAB39A and CPVL, commercially available antibodies can be used.
Further, an “index (Cut off) value” may be set in the cancer testing method of the present invention. The index means the expression level of RAB39A and / or CPVL in a sample for distinguishing a cancer patient from a healthy subject. For example, when the expression level of RAB39A and / or CPVL in the sample of the subject is equal to or greater than the expression level in the sample set in advance, the cancer is developing, the cancer is progressing, and the cancer is severe. It can be determined that there is and / or is likely to develop cancer in the future.
As a method for setting the index value, for example, the index value is calculated from the average value of the expression levels of RAB39A and / or CPVL derived from healthy subjects. Usually, 90% or less, preferably 80% or less, more preferably 70% or less, even more preferably 60% or less, most preferably 60% or less, most preferably the standard deviation of the average value of the expression levels of RAB39A and / or CPVL from a healthy person determined in advance. Indicates an expression level of 50% or less as an index.

(Screening method for anticancer drug)
The method for screening an anticancer agent of the present invention includes at least the following steps.
(1) A step of bringing a candidate compound into contact with RAB39A and / or CPVL.
(2) determining whether the candidate compound inhibits the function and / or expression of RAB39A and / or CPVL;

(Candidate compound)
As the candidate compound used in the present invention, any substance can be used, including a naturally occurring compound. The type of the candidate compound is not particularly limited, and may be an individual low-molecular-weight synthetic compound, a compound present in a natural product extract, or a synthetic peptide. Alternatively, the candidate compound may be a compound library, phage display library or combinatorial library. The candidate compound is preferably a low molecular compound, and a compound library of low molecular compounds is preferable. Construction of compound libraries is known to those skilled in the art, and commercially available compound libraries can also be used.

The method for screening an anticancer agent of the present invention preferably includes a step of contacting a candidate compound with RAB39A and / or CPVL gene-containing (expressing) cells. The method of contact is not limited. For example, a candidate compound can be added to cultured cells. The incubation time is not limited. A suitable incubation time varies depending on the type and environment of the cell, but is 24 hours to 1 week, preferably 24 hours to 72 hours, more preferably 24 hours to 60 hours.
In addition, there is also a method of preparing a gene structure in which a reporter gene is linked to an expression control region containing a promoter of the RAB39A and / or CPVL gene, and measuring the expression level of the reporter gene. In this method, after the gene construct is introduced into an expression vector, animal cells are transduced to produce a transformant. After contacting the transformant with the candidate compound, the expression level of the reporter gene is measured, and the expression level can be compared with that of a control group not in contact with the candidate compound. A luciferase gene or the like can be used as a reporter gene, but is not limited thereto.

  Cells used for screening are not limited. Preferably, a mammalian-derived cell line can be used. For example, a normal cell-derived cell line, a cancer-derived cell line, a transduced cell line and the like can be mentioned. Preferably, a cancer-derived cell line or a cell line into which a reporter gene has been introduced is used. Alternatively, the candidate compound may be administered to a mammal other than a human to measure and compare the gene expression levels.

(Cancer cell growth inhibitor)
The cancer cell growth inhibitor of the present invention contains a substance (particularly, a compound) capable of inhibiting the function and / or expression of RAB39A, CPVL, LHX2 and / or NUP210 as an active ingredient.
Further, the above compound and a pharmacologically acceptable carrier, excipient, diluent, extender, disintegrant, stabilizer, preservative, buffer, emulsifier, fragrance, coloring agent, sweetener known per se. , Thickeners, flavoring agents, solubilizing agents, and other additives, such as water, vegetable oils, alcohols such as ethanol or benzyl alcohol, polyethylene glycol, glycerol triazetate gelatin, lactose, starch, etc. It can be orally or parenterally administered in the form of tablets, capsules, elixirs, microcapsules, injections, liquids, suspensions, etc. by mixing with carbohydrates, magnesium stearate, talc, petrolatum, etc. .
The cancer cell growth inhibitor of the present invention is not limited to use as an anticancer agent.

(Anti-cancer agent)
The anticancer agent of the present invention contains the above-mentioned cancer cell growth inhibitor or a substance (particularly, a compound) capable of inhibiting the function and / or expression of RAB39A, CPVL, LHX2 and / or NUP210 as an active ingredient. Furthermore, the anticancer agent of the present invention can be used not only for any stage of cancer (early stage, advanced stage, terminal stage) but also for cancer prevention.
The dosage or intake of the anticancer agent of the present invention is not particularly limited as long as the effects of the present invention can be obtained, and the efficacy of the contained components, dosage form, administration route, type of disease, It is appropriately selected according to the nature of the subject (body weight, age, medical condition, the use of other medicines, etc.), the judgment of the attending physician, and the like. The anticancer agent of the present invention can be administered or ingested once or several times a day, or may be intermittently administered or ingested once every several days or several weeks.

(RNA that can suppress the expression of RAB39A, CPVL, LHX2 and / or NUP210)
RNA (including siRNA and shRNA) capable of suppressing the expression of RAB39A, CPVL, LHX2 and / or NUP210 of the present invention suppresses cancer cell growth by suppressing the expression of RAB39A, CPVL, LHX2 and / or NUP210 ( In particular, it has a cancer cell-specific growth suppression effect. The phrase “cancer cell-specific growth suppression” means that cancer cell growth is suppressed, but growth of normal cells is substantially (or only slightly) suppressed.
The above-mentioned RNA can be exemplified as an active ingredient contained in the cancer cell growth inhibitor or anticancer agent of the present invention.
When a DNA expressing RNA capable of suppressing the expression of RAB39A, CPVL, LHX2 and / or NUP210 of the present invention is administered to a patient, it is not particularly limited, and a known virus or non-viral vector can be used. .

(Method for treating cancer of the present invention)
In the method for treating cancer of the present invention, the dose, the number of administrations, and the administration interval are not particularly limited, and the purpose of prevention (particularly, prevention of recurrence) and / or clinical treatment, disease type, patient weight, age, disease, etc. Is appropriately selected according to conditions such as the severity of the disease.

(Cancer test kit)
The cancer test kit of the present invention includes components necessary for detecting RAB39A and / or CPVL from a sample obtained from a subject.
For example, the cancer test kit of the present invention contains any one or more of the following antibodies.
(1) Anti-RAB39A antibody (2) Anti-CPVL antibody All of the above antibodies may be commercially available products known per se, or may be monoclonal antibodies or polyclonal antibodies prepared using each antigen as a target.

  Hereinafter, the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited to these Examples.

(Discrimination between cancer cell line and normal cell line)
20,000 or more all expressed genes were statistically and mathematically processed, and principal component analysis was performed using only the discrimination of cancer cell line or normal cell line as an index. The details are as follows.
As model cases for cancer cells and cancer stem cells, human osteosarcoma cells MG-63, HOS and Saos-2 and their cancer stem cells (CSC) were used. A known method was used to culture the cancer stem cells in dominant (Salerno, et al. Int J Oncol 2013). As normal cell lines to be compared, two human normal fibroblasts, TIG-108 and -121, and four human mesenchymal stem cells (Lonza, # PT-2501) were used.
Each cell is adjusted with DMEM / 10% FBS, neutral culture solution ｛pH7.4, 10mM 4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid (HEPES)｝, acid culture solution ｛pH6.5, 10mM After culturing in piperazine-1,4-bis (2-ethanesulfonic acid) (PIPES)｝ for 24 hours in a 5% CO ₂ environment, each total RNA was recovered with TRIzol. From the total RNA, a library for sequencer analysis was prepared using TruSeq ^™ RNA sample preparation kit-v2 (Illumina), and RNA-Seq analysis was performed using the next-generation sequencer GAIIx (Illumina). Principal component analysis was performed on the obtained sequence data using Strand NGS v2.1 (Strand) software.

(result)
FIG. 1 shows the results of the principal component analysis. Regarding Component1 (X-Axis: horizontal axis), normal cell line and malignant cell line were clearly distinguished.
Furthermore, by ranking the degree of contribution of each gene expression to the discriminating principal component, a contribution rank list (see FIG. 2) of genes capable of discriminating each lineage of cancer cells and normal cells was created. From the top 100 in the list, gene expression in normal cell lines is almost zero, and RAB39A, CPVL, LHX2 and RAB39 maintain high expression in cancer cell lines regardless of the acidic culture environment and neutral culture environment. Ten of them, including NUP210, were selected as target molecule candidates (see Table 1 and the underline in FIG. 2).

(Inhibition of target molecule candidate gene expression)
Specific expression of each target gene using lenti-viral shRNA for expression of each of eight genes (Table 1 above) including RAB39A, CPVL, LHX2 and NUP210 among the ten target molecule candidates selected in Example 1 Inhibition of expression was carried out, and an evaluation experiment of viable cells was performed. The details are as follows.
Combining lenti-viral shRNA expression inhibition system with target molecule candidate gene expression system and WST-8 viable cell evaluation system (Cell Counting Kit-8, Dojindo) to confirm the effect of target molecule candidate gene expression inhibition on cell growth did. Human osteosarcoma cells (HOS) and human cervical cancer cells (HeLa) were used for screening for gene inhibition and cell killing effects. To evaluate toxicity to normal cells, human mesenchymal stem cells were used.
In addition, as the sequence of each shRNA, an shRNA having the following sequences as target sequences was used.
○ RAB39A:
Target sequence 1: TTGTAGCATCCTTTGCTGAGG (SEQ ID NO: 1)
Target sequence 2: TAAGATCGGGTTATTGATCTG (SEQ ID NO: 2)
○ CPVL:
Target sequence 3: AACACTTCTGTATAGGGAGCG (SEQ ID NO: 3)
Target sequence 4: TATGGCACTGTATAAATCCCG (SEQ ID NO: 4)
○ LHX2:
Target sequence 5: ATCTTGTTACACGTGGTGCAC (SEQ ID NO: 5)
Target sequence 6: ATCTTCCAAGTTGTTCCTCGG (SEQ ID NO: 6)
○ NUP210:
Target sequence 7: AAATGAGCTAATGGGCAGAGC (SEQ ID NO: 7)
Target sequence 8: AAAGAGCACTTCTAACTGCTC (SEQ ID NO: 8)
○ PRAME:
Target sequence 9: AAATCTTCAATAGAGTCCAGC (SEQ ID NO: 9)
Target sequence 10: TTAAGGTTGTAAGCTGGGAGC (SEQ ID NO: 10)
○ KCNG3 ：
Target sequence 11: TAGCTTCAATTATCCCGGAGG (SEQ ID NO: 11)
Target sequence 12: AACACAGAGATGTAATACGGC (SEQ ID NO: 12)
○ FXYD6:
Target sequence 13: ATTGGCGGTGATGAGGTTCTC (SEQ ID NO: 13)
Target sequence 14: TAGGATAAGGAGGATCCCAAC (SEQ ID NO: 14)
○ SLITRK5:
Target sequence 15: TAACTCCAGATATTCGTTCCG (SEQ ID NO: 15)
Target sequence 16: AAGCATTGGGTTCAATGACGC (SEQ ID NO: 16)

(result)
It was confirmed that inhibition of the expression of RAB39A, CPVL, LHX2 and NUP210 caused a very strong induction of cell killing in HOS cancer cells. For all target genes, the effects of expression inhibition were confirmed in two or more shRNA treatments. This ruled out the possibility of another gene of similar sequence due to the inhibited effect. Furthermore, it was confirmed that the cell killing effect of the cancer cells occurs even in culture in a neutral environment regardless of culture in an acidic environment (see: FIG. 3-4). Similar results were obtained with HeLa cancer cells.
On the other hand, inhibition of the expression of PRAME, SLITRK5, KCNG3 and FXYD6 showed a growth inhibitory effect but did not show a sufficient cell killing effect. In particular, the growth inhibitory and cell killing effects of cancer cells in an acidic environment tended to be poor (see: FIG. 5-6). Similar results were obtained with HeLa cancer cells. However, FXYD6, SLITRK5, KCNG3, and PRAME may also exhibit a sufficient tumor inhibitory effect by improving the target sequence, and may be target cancer therapeutic molecules.
Furthermore, the inhibition of the expression of RAB39A, CPVL, LHX2 and NUP210 clearly showed no toxicity and cell killing effect of human mesenchymal stem cells (normal cell line), and showed moderate cell growth (see FIG. 7).
As described above, it was confirmed that the expression inhibition of RAB39A, CPVL, LHX2, and NUP210 exhibited a specific and strong cell killing effect on cancer cells even with single molecule inhibition. Thus, RAB39A, CPVL, LHX2 and NUP210 become novel cancer therapeutic target molecules.

(Confirmation of expression of target molecule in each cancer)
For tissue expression of target molecules, comparative analysis of gene expression levels was performed for 22 types of cancer and normal tissues (all 381 cases) using TissueScan ^™ cancer and normal tissue cDNA arrays (OriGene).

(result)
When the expression state of each molecule of RAB39A, CPVL, LHX2 and NUP210 was confirmed, it was confirmed that the expression level was different in each target molecule, but it was expressed in many cancers (see: FIG. 8-11). In particular, it was confirmed that RAB39A and CPVL were expressed in the following cancers.
Adrenal tumor, breast cancer, cervical cancer, ovarian cancer, colorectal cancer, endometrial cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, lymphoma, leukemia, testicular tumor, pancreatic cancer, prostate cancer, gastric cancer, thyroid cancer, bladder cancer.
That is, the above-described cancer test can be performed by detecting RAB39A and / or CPVL from a patient-derived sample. In addition, if the expression level of RAB39A and / or CPVL in the tumor tissue is high, the target treatment target of RAB39A and / or CPVL is obtained. Furthermore, a compound that suppresses the expression of RAB39A, CPVL, LHX2 and / or NUP210 becomes a cancer cell growth inhibitor and further an anticancer agent.

(General remarks)
According to the above examples, in the present invention, at least adrenal gland tumor, breast cancer, cervical cancer, ovarian cancer, colorectal cancer, endometrial cancer, esophageal cancer, renal cancer, liver cancer, lung cancer, lymphoma, leukemia, testicular tumor, pancreatic cancer, The present invention can provide a method for testing cancer against prostate cancer, gastric cancer, thyroid cancer, and / or bladder cancer, a cancer cell growth inhibitor, an anticancer agent, and a method for screening an anticancer agent.

  The present invention can provide a novel cancer test method, a cancer cell growth inhibitor, an anticancer agent, and a method for screening an anticancer agent.

Claims (4)

  A method for testing for cancer, comprising detecting RAB39A from a sample derived from a subject. Before Kigan are adrenal tumor, breast cancer, cervical cancer, ovarian cancer, colon cancer, endometrial cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, lymphoma, leukemia, testicular cancer, pancreatic cancer, prostate cancer, stomach cancer, thyroid The method according to claim 1, wherein the method is at least one selected from cancer and bladder cancer. A method for screening an anticancer agent comprising the following steps,
(1) contacting the candidate compound with RAB39A,
(2) determining whether the candidate compound inhibits the function and / or expression of RAB39A,
A method for screening an anticancer agent, comprising: A cancer test kit comprising the following antibodies:
(1) Anti-RAB39A antibody