KR20230029360A - Composition for enhancing cancer treatment effect containing C19 and use thereof - Google Patents

Abstract

The present invention relates to a pharmaceutical composition containing C19 (EMT inhibitor-1) as an active ingredient for enhancing the therapeutic effect of cancer, and uses thereof. Since the composition of the present invention can induce the activation of immunocytotherapies including natural killer cells or release of cancer cytotoxic molecules, and thus can improve penetration efficiency of a therapeutic agent by degrading/inhibiting the ECM, so that a cancer treatment effect can be enhanced by using the composition.

Description

Composition for enhancing cancer treatment effect containing C19 and use thereof {Composition for enhancing cancer treatment effect containing C19 and use thereof}

The present invention relates to a pharmaceutical composition containing C19 (EMT inhibitor-1) as an active ingredient for enhancing the therapeutic effect of cancer and its use.

According to the analysis of the National Statistical Office of the Republic of Korea, cancer is the number one cause of death in Korea, accounting for 31.7% of men and 22.5% of women, and 31.7% of the total population dies of cancer. Methods for treating cancer include treatment through surgery, radiation treatment, and treatment through the administration of anticancer drugs, but these treatment methods are accompanied by side effects or are limited in their application depending on the degree of cancer progression. In particular, most anticancer drugs work as a mechanism to stop and kill the cell cycle of actively dividing cells, so they attack normally dividing cells in addition to cells, resulting in side effects such as hair loss, loss of appetite, and reduced immunity due to reduced white blood cells. . As a result of repeated studies, the number of types increased in the quantitative aspect, but there was no significant change in the qualitative aspect.

One of the obstacles in cancer treatment using chemotherapy is anticancer drug resistance. In order for chemotherapy for cancer patients to be successful, the patient must be able to tolerate side effects and the cancer cells must be killed at blood concentrations at which normal tissues can survive. However, in the case of continuous administration of anticancer drugs, drug resistance to anticancer drugs occurs when cancer cells do not die despite the administration of an amount of anticancer drugs capable of reaching blood concentrations capable of killing cancer cells, which is called anticancer drug resistance.

Anticancer drug resistance may vary from patient to patient and may even be caused by various factors including genetic differences between tumors derived from the same tissue. Anticancer drug resistance mechanisms can generally be broadly classified into extracellular resistance and intracellular resistance. Extracellular resistance exhibits specific severe side effects depending on the patient, when a sufficient concentration of anticancer drug is not administered or oral anticancer drug is administered. When intestinal absorption is abnormally low, as in the case of cancer, the patient's cancer cells may show resistance to anticancer drugs because they have not been exposed to concentrations that can kill cancer cells in vitro. Or, although sufficient blood concentration has been reached, the blood distribution to the cancer tissue is poor or the drug cannot penetrate into the tissue due to physiological barriers between blood vessels and cancer tissue (pharmacologic sanctuary) As in the case where cancer cells are present in a cell, resistance to anticancer drugs ultimately appears even when cancer cells are not exposed to sufficient concentrations of anticancer drugs. On the other hand, intracellular tolerance reduces drug absorption or promotes release even though cancer cells are exposed to a sufficient concentration of anticancer drugs, ultimately changing the drug delivery mechanism and reducing drug activity or inactivation. This means that cancer cells do not die despite the presence of high concentrations of anticancer drugs due to the induction of mutations in the metabolic process that enhances drug targets, the mutation of targets due to increase or decrease or mutation of drug targets, and the activation of the repair mechanism of damaged targets.

On the other hand, in recent years, enormous interest has been focused on the study of the tumor microenvironment, and as a method to overcome the limitation that the progression and metastasis of cancer cannot be prevented only by conventional anticancer therapies that attack cancer cells themselves, a new method targeting the tumor microenvironment has been developed. There is a growing interest in treatment.

Considering that the biggest problem of current anticancer treatment is anticancer drug resistance and the lack of new anticancer treatment targets, it is necessary to develop a therapeutic agent capable of effectively suppressing the tumor microenvironment and the like to solve these problems.

One aspect provides a pharmaceutical composition for enhancing cancer treatment effect comprising C19 (EMT inhibitor-1) or a pharmaceutically acceptable salt thereof as an active ingredient.

Another aspect provides a pharmaceutical composition for preventing or treating cancer comprising C19 or a pharmaceutically acceptable salt thereof, and an anticancer agent as an active ingredient.

Another aspect provides a method for treating cancer, comprising administering to a subject a pharmaceutical composition for preventing or treating cancer.

Another aspect provides a pharmaceutical composition for enhancing the therapeutic effect of an immune cell therapy, comprising C19 or a pharmaceutically acceptable salt thereof as an active ingredient.

One aspect is to provide a pharmaceutical composition for enhancing cancer treatment effect comprising C19 (EMT inhibitor-1) or a pharmaceutically acceptable salt thereof as an active ingredient.

The term "C19 (EMT inhibitor-1) [CAS No. 1638526-21-2, chemical formula: C ₁₂ H ₁₂ Cl ₂ N ₂ O ₂ S]" refers to Hippo, TGF-β having anti-tumor activity. And it is known as an inhibitor of the Wnt signal transduction pathway, and has the structural formula of Formula 1 below.

[Formula 1]

The term "cancer" in the present specification means a tumor that grows abnormally due to autonomous excessive growth of body tissue, or a disease that forms a tumor. The cancer is gastric cancer, liver cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, colon cancer, bone cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, colorectal cancer, proximal anal cancer, colon cancer, Breast cancer, cervical cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer , prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma or a pituitary adenoma.

The term “pharmaceutically acceptable salt” as used herein refers to a salt in a form that can be used pharmaceutically among salts in which cations and anions are bonded by electrostatic attraction, usually metal salts and organic bases. It may be a salt with an inorganic acid, a salt with an organic acid, a salt with a basic or acidic amino acid, etc. For example, as a metal salt, an alkali metal salt (sodium salt, potassium salt, etc.), an alkaline earth metal salt (calcium salt) salt, magnesium salt, barium salt, etc.), aluminum salt, etc.; salts with organic bases include triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine , cyclohexylamine, dicyclohexylamine, N,N-dibenzylethylenediamine, etc. Salts with inorganic acids can be salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, etc.; Salts with organic acids may include salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc.; A salt of may be a salt with arginine, lysine, ornithine, etc.; When it has, there are inorganic salts such as alkali metal salts (eg, sodium salts, potassium salts, etc.), alkaline earth metal salts (eg, calcium salts, magnesium salts, barium salts, etc.), and organic salts such as ammonium salts. When having a basic functional group, salts with inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, etc., organic acids such as acetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, p-toluenesulfonic acid, etc. There is a salt of

As used herein, the term "enhancement of cancer treatment effect" or "enhancement of anticancer effect" refers to reducing the resistance of cancer cells to anticancer drugs, increasing the penetration / invasion efficiency of cancer cells, or susceptibility / sensitivity of cancer cells to anticancer drugs. By increasing, it means improving and/or enhancing the cancer treatment effect of an anticancer agent.

The composition or the C19 drug contained therein alone may not have toxicity to cancer lesions, and thus may have significantly low cancer treatment or prevention effects.

The composition may be an anti-cancer treatment adjuvant, and in the present specification, "adjuvant" refers to a main drug, that is, to improve and/or enhance a therapeutic effect by assisting the efficacy of an anti-cancer drug, or to prevent harmful effects of the main drug. Refers to an auxiliary drug used for the purpose of preventing or alleviating it.

The composition may inhibit the tumor microenvironment.

As used herein, the term "tumor microenvironment" or "cancer microenvironment" refers to complex and diverse elements such as other cells, extracellular matrix, growth hormone, and signaling substances around cancer cells. It means the whole composed of fibroblast, macrophage, lymphocyte, endothelial cell, pericyte, smooth muscle, peripheral nerve It consists of more than 10 types of cells and more than 1000 types of various extracellular matrices, which are still poorly identified. Depending on the characteristics of individual cancer cells, the combination of these cells and extracellular matrix is different, and it is very complex and diverse. In 1889, British physician Dr. Stephen Paget presented the 'seed and soil' theory and announced that the tumor microenvironment plays an important role as soil in the growth of seeds called cancer cells, suggesting that the tumor microenvironment plays an essential role in the development and progression of cancer. Recently, interest in new therapies targeting the tumor microenvironment is attracting attention as a method to overcome the limitation that conventional anticancer therapies that attack cancer cells themselves cannot prevent cancer progression and metastasis.

The composition may inhibit the extracellular matrix (ECM) of cancer, specifically inhibit formation and/or deposition of the extracellular matrix, or alleviate/reduce the hardness/stiffness of the extracellular matrix. or to induce ECM modulation.

As used herein, the term "extracellular matrix (ECM)" refers to a non-cellular, three-dimensional matrix that physically supports tissues by filling in the gaps between cells or surrounds cells to create an environment for cells to survive. As a macromolecular network having a structure, it is composed of glycoproteins such as collagen, proteoglycan/sugar-aminoglycosaminoglycan, elastin, fibronectin, laminin, and the like. In addition, it forms a complex structure with cells in all tissues and organs, and each component or cell adhesion receptor is bound to each other. In addition, various receptors present on the cell surface transmit signals such as survival, growth, migration, and differentiation from the ECM to the cell. On the other hand, the ECM is a highly dynamic structural network that is constantly remodeled by matrix-destroying enzymes in both normal and pathological states. It is known that problems with the regulation of the composition and structure of the ECM are involved in the development and progression of several pathological conditions including cancer.

The composition may suppress the expression level of proteins constituting the ECM, and may specifically reduce the expression level of collagen, laminin, and/or fibronectin.

The composition may inhibit one or more selected from the group consisting of the Hippo-YAP/TAZ signaling pathway, the TGFβ signaling pathway, and the Wnt signaling pathway.

Specifically, the composition can increase the expression level of pLATS-1 in cancer cells, thereby inducing phosphorylation and degradation of the YAP/TAZ protein, thereby reducing the expression level of the YAP and/or TAZ protein, and reducing the expression level of the YAP/TAZ protein. signal transduction can be inhibited. In addition, since the composition does not affect the expression levels of YAP and/or TAZ proteins in natural killer cells, it may not affect the YAP/TAZ-signaling pathway of natural killer cells.

In addition, the composition may inhibit the expression level of the TGFβ receptor in cancer cells, and specifically, may inhibit the TGFβ signaling pathway by reducing the expression level of TGFβR1, TGFβR2 and/or TGFβR3.

The composition may enhance/improve the activity of an anticancer agent. The improvement of the anticancer activity means to improve / improve the effect of various factors that can affect the cancer treatment effect, specifically to improve the cancer cell toxicity of the anticancer agent or to improve the penetration efficiency into cancer lesions. may include

The anti-cancer agent may be an immuno-anticancer agent or a chemo-anticancer agent. Specifically, chemotherapy drugs include Oxaliplatin, Pemetrexed, Cisplatin, Gemcitabine, Carboplatin, Fluorouracil (5-FU), Cyclophosphamide ), Paclitaxel, Vincristine, Etoposide, Doxorubicin, Tamoxifen, Toremifene, Fulvestrant, Diindolylmethane, Exemestane, raloxifene, aromatase inhibitors, anthracycline, taxanes, irinotecan, eribulin, docetaxel, and abraxane (Abraxane) and the like.

Unlike conventional anticancer drugs that attack cancer cells themselves, the immunotherapeutic agent is a cancer treatment that stimulates the body's immune system to induce immune cells to attack cancer cells, such as immune checkpoint inhibitors, immune cell therapy agents, and anticancer immunotherapy vaccines. there is. The immune checkpoint inhibitor blocks the activity of immune checkpoint proteins using an antibody that specifically binds to immune checkpoint proteins (PD1, PDL1, CTLA4, Tim3, LAG3, etc.) that neutralizes the activity of T cells attacking cancer cells. To make cells function properly, specifically ipilimumab, pembrolizumab, nivolumab, atezolizumab, avelumab, durmalumab , and Cemiplimab, and the like.

The immune cell therapy refers to a therapeutic agent that activates the body's immune response using the body's immune cells such as dendritic cells, natural killer cells, and T cells to attack cancer cells more effectively. , Specifically, there are chimeric antigen receptor (CAR) T-cell therapy and CAR-NK cell therapy, and the effect of attacking cancer cells by attaching a cofactor that activates T/NK cells to the CAR of immune cells can also be raised.

The anticancer immunotherapeutic vaccine refers to an immunotherapy method in which protein peptide molecules capable of improving immune function are administered to cancer patients to activate the immune system, thereby enhancing the body's immune function and attacking cancer cells.

The anticancer agent included in the composition may be an immune cell therapy agent. The immune cell therapy agent may be wild-type immune cells themselves or genetically engineered immune cells, and the immune cells may be derived from the subject's own, allogeneic, or heterologous line. Specifically, dendritic cells, natural killer cells, T cells, tumor-infiltrating lymphocytes (TIL), and T cell receptor-expressing T cells (TCR-modified T cells) cell, TCR-T), chimeric antigen receptor-expressing T cell (CAR-modified T cell, CAR-T), lymphokine-activated killer cell (LAK), and chimeric antigen receptor-expressing NK cell (CAR-T) -modified NK cell, CAR-NK) may be one or more selected from the group consisting of, and specifically may be natural killer cells or CAR-NK.

As used herein, the term "natural killer cell" is an important lymphoid cell responsible for innate immunity, accounting for 5-10% of total lymphocyte cells and, unlike T cells, matures in the liver or bone marrow. It is known that natural killer cells can distinguish normal cells from abnormal cells by expressing various innate immune receptors on the cell surface, and can immediately attack and eliminate target cells such as virus-infected cells or tumor cells. . Natural killer cells that recognize abnormal cells secrete perforin to pierce the cell membrane of the target cell, secrete granzyme into the cell membrane to dismantle the cytoplasm, causing apoptosis, or injecting water and salt into the cell. This causes cell necrosis. Also, as an indirect method, cytotoxic T cells and B cells can be activated by secreting cytokines. It is known that both the number and high activity of natural killer cells are very important measures of the immune action effect mediated by these natural killer cells. The natural killer cells may include wild-type cells and genetically engineered cells such as CAR-NK cells.

The composition may be one capable of enhancing/enhancing cancer prevention and/or treatment effects of immune cell therapy agents, specifically, natural killer cells.

The composition may be an immune cell therapy agent, specifically, one that activates cancer cell toxicity by increasing the expression level of an activating receptor expressed in the cell membrane of natural killer cells, specifically CD69, NKG2D, NKp30, NKp46, NkP44, NKG2C, CD56 and It may be to increase the expression level of one or more activating receptors selected from the group consisting of TRAIL. In addition, the composition may effectively increase the expression level of activated receptors of natural killer cells when natural killer cells coexist (co-culture) with cancer lesions (cancer tissues and/or cancer cells).

The composition may be an immune cell therapy agent, specifically, one that increases the secretion ability of cancer cytotoxic factors (molecules), cytokines and/or chemokines of natural killer cells, specifically, perforin, TNF-α, IFN-γ and granzymes. It may be to increase the secretion capacity and/or expression level of one or more cancer cell toxic factors selected from the group consisting of.

The C19 drug of the present invention or a pharmaceutical composition containing the same for enhancing the therapeutic effect of cancer can improve the cancer cytotoxic function of an immunotherapy agent containing natural killer cells, and degrades the extracellular matrix of cancer cells in the tumor microenvironment. while suppressing the infiltration efficacy of immune cell therapy can be improved. Therefore, the use of the composition can improve or enhance the cancer treatment effect by increasing the activity of the immune cell therapy agent itself or reducing anticancer drug resistance caused by the extracellular matrix and the tumor microenvironment.

The pharmaceutical composition may include a pharmaceutically acceptable carrier. The "pharmaceutically acceptable carrier" may refer to a carrier or diluent that does not inhibit the biological activity and properties of the compound to be injected without irritating living organisms. Here, "pharmaceutically acceptable" means that the application (prescription) does not have more toxicity than is adaptable without inhibiting the activity of the active ingredient.

Any type of carrier that can be used in the present invention can be used as long as it is commonly used in the art and is pharmaceutically acceptable. Non-limiting examples of the carrier include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and the like. These may be used alone or in combination of two or more. The pharmaceutical composition may be formulated into an oral dosage form or a parenteral dosage form according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient.

The pharmaceutical composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories or sterile injection solutions according to conventional methods. When formulating the pharmaceutical composition, it may be prepared by adding diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, or surfactants.

When the pharmaceutical composition is prepared as a dosage form for oral use, formulations such as powder, granule, tablet, pill, dragee, capsule, liquid, gel, syrup, suspension, wafer, etc. can be manufactured with Examples of suitable pharmaceutically acceptable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol, starches such as corn starch, potato starch, and wheat starch, cellulose, methylcellulose, ethylcellulose, Celluloses such as sodium carboxymethylcellulose and hydroxypropylmethylcellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyol, vegetable oil etc. are mentioned. In the case of formulation, if necessary, diluents and/or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants may be included.

When the pharmaceutical composition is prepared as a parenteral formulation, it may be formulated in the form of injection, transdermal administration, nasal inhalation, and suppository along with a suitable carrier according to a method known in the art. In the case of formulation as an injection, suitable carriers include sterile water, ethanol, polyols such as glycerol or propylene glycol, or mixtures thereof, preferably Ringer's solution, PBS (phosphate buffered saline) containing triethanolamine or sterilization for injection water, isotonic solutions such as 5% dextrose, and the like can be used. When formulated as a transdermal formulation, it may be formulated in the form of ointments, creams, lotions, gels, external solutions, pastas, liniments, air rolls, and the like. In the case of nasal inhalation, it can be formulated in the form of an aerosol spray using a suitable propellant such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, etc., and when formulated into suppositories, the base is Witepsol ( witepsol), tween 61, polyethylene glycols, cacao fat, laurin fat, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearates, sorbitan fatty acid esters, and the like may be used.

The pharmaceutical composition may be administered in a pharmaceutically effective amount, and the term "pharmaceutically effective amount" means an amount sufficient to treat or prevent a disease with a reasonable benefit/risk ratio applicable to medical treatment or prevention. , the effective dose level depends on the severity of the disease, the activity of the drug, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the administration time of the composition of the present invention used, the route of administration and the excretion rate, the treatment period, the present used It may be determined according to factors including drugs used in combination or simultaneous use with the composition of the invention and other factors well known in the medical field. The pharmaceutical composition may be administered alone or in combination with components known to exhibit therapeutic effects on known cancer diseases. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors.

The dosage of the pharmaceutical composition can be determined by those skilled in the art in consideration of the purpose of use, the degree of addiction of the disease, the patient's age, weight, sex, history, or the type of substance used as an active ingredient. For example, the pharmaceutical composition of the present invention can be administered at about 0.1 ng to about 1,000 mg/kg, preferably 1 ng to about 100 mg/kg per adult, and the frequency of administration of the composition of the present invention is particularly Although not limited, it may be administered once a day or administered several times by dividing the dose. The dosage or frequency of administration is not intended to limit the scope of the present application in any way.

Another aspect is to provide a pharmaceutical composition for preventing or treating cancer comprising C19 (EMT inhibitor-1) or a pharmaceutically acceptable salt thereof, and an anticancer agent as active ingredients. The same parts as described above also apply to the composition.

As used herein, the term "treatment" refers to all activities that improve or beneficially change the symptoms of cancer disease by administration of the composition of the present invention.

As used herein, the term "prevention" refers to any activity that suppresses or delays the onset of a cancer disease or disease by administration of the composition of the present invention.

The anticancer agent may be an immune cell therapeutic agent, and specifically, may be a therapeutic agent including natural killer cells or CAR-NK cells.

The C19 drug alone may have significantly low cancer treatment or preventive effects, but when co-administered with an immune cell therapeutic agent containing natural killer cells, the C19 drug enhances the cancer cytotoxic function of the immune cell therapeutic agent or targets cancer. Anticancer efficacy can be improved through a mechanism such as lowering anticancer drug resistance of cells.

The C19 or a pharmaceutically acceptable salt thereof, and the anticancer agent may be administered in combination, and specifically, the C19 or a pharmaceutically acceptable salt thereof, and the anticancer agent may be administered simultaneously in one dosage form, or in separate dosage forms. It may be administered simultaneously or sequentially.

Another aspect is to provide a method for treating or preventing cancer comprising administering the pharmaceutical composition for treating or preventing cancer to a subject. The same parts as described above are also applied to the method.

As used herein, the term "subject" may include, without limitation, mammals, birds, reptiles, farmed fish, etc., including mice, livestock, humans, etc., that have or are at risk of developing cancer diseases, and the subject It could be excluding humans.

The pharmaceutical composition may be administered singly or in multiple doses in a pharmaceutically effective amount. At this time, the composition may be formulated and administered in the form of a liquid, powder, aerosol, injection, infusion (intravenous gel), capsule, pill, tablet, suppository or patch. The administration route of the pharmaceutical composition for preventing or treating cancer may be administered through any general route as long as it can reach the target tissue.

The pharmaceutical composition is not particularly limited thereto, but depending on the purpose, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, transdermal patch administration, oral administration, intranasal administration, intrapulmonary administration, intrarectal administration, etc. It can be administered by route. However, oral administration can be administered in an unformulated form, and since the active ingredients of the pharmaceutical composition can be denatured or decomposed by gastric acid, the oral composition is formulated to coat the active agent or protect it from degradation in the stomach. It can also be administered orally in the form of a localized form or an oral patch. In addition, the composition may be administered by any device capable of transporting active substances to target cells.

Another aspect is to provide a pharmaceutical composition for enhancing the therapeutic effect of an immune cell therapy, comprising C19 (EMT inhibitor-1) or a pharmaceutically acceptable salt thereof as an active ingredient. The same parts as described above also apply to the composition.

The immune cell therapy agent may be wild-type immune cells themselves or genetically engineered immune cells, and the immune cells may be derived from the subject's own, allogeneic, or heterologous line. Specifically, dendritic cells, natural killer cells, T cells, tumor-infiltrating lymphocytes (TIL), and T cell receptor-expressing T cells (TCR-modified T cells) cell, TCR-T), chimeric antigen receptor-expressing T cell (CAR-modified T cell, CAR-T), lymphokine-activated killer cell (LAK), and chimeric antigen receptor-expressing NK cell (CAR-T) -modified NK cell, CAR-NK) may be one or more selected from the group consisting of, and specifically may be natural killer cells or CAR-NK cells.

The composition enhances the infiltration of immunotherapy agents into target sites (tissues, lesions, etc.), enhances cancer cell toxicity of the immune cell therapy agents itself, or secretes cytotoxic molecules/factors of the immune cell therapy agents. It may be to enhance the therapeutic effect of the immune cell therapy by promoting.

The composition of the present invention can improve the penetration efficiency of a therapeutic agent by inducing the activation of an immune cell therapy agent including natural killer cells or the release of cancer cytotoxic molecules, or by degrading/inhibiting the ECM. can enhance the therapeutic effect.

Figure 1 is a schematic diagram showing the process of a 3D biomimetic spheroid platform for screening drugs that can produce synergistic effects with NK-mediated cell lysis in cancer treatment.
Figure 2 is a diagram confirming cell morphology after culturing 6 types of PDCs in a hydrophobic polymer (pCHM and pV4D4)-coated culture plate.
Figure 3 is a diagram showing the morphological characteristics (a), ECM protein expression levels (b and c), and stem cell marker expression levels (d and e) of spheroids prepared using 110621 PDC (** p <0.01; ***p < 0.001).
Figure 4 is a diagram showing the NGS analysis results in 2D cell culture conditions and 3D biomimetic spheroid conditions.
Figure 5 is a diagram showing the results of analyzing the expression levels of genes related to ECM modeling and EMT function in 3D biomimetic spheroids (*p <0.05; **p <0.01; ***p <0.001).
Figure 6 is a diagram showing the results of imaging-based high-content screening of combination drugs with NK92 cells.
7 is a diagram showing the results of NK-mediated cell lysis according to co-treatment of NK92 cells and C19.
8 is a diagram showing 2D cancer cell and 3D steroid proliferation rates according to the concentration of C19 treated alone.
9 is a diagram showing the results of NK-mediated cell lysis according to co-treatment of PBNK cells and C19.
Figure 10 is a diagram showing the expression level of activated receptors on NK92 cells according to C19 treatment, a shows the results when NK92 cells were cultured alone, and b shows the results when NK92 cells and cancer spheroids were co-cultured. The results in the figure were obtained through 4 replicate experiments, and the bar graph represents the mean ± sem (*p <0.05; **p <0.01; ***p < 0.001).
Figure 11 is a diagram showing the phenotypic characteristics of effector molecules on PBNK cells according to C19 treatment, a is a graph showing the flow cytometry results, b shows the flow cytometry results according to C19 treatment, c shows the in vitro cell proliferation and isolation results of PBNK cells (*p <0.05; **p <0.01; ***p < 0.001).
12 is a diagram showing the secretion levels of cytotoxic granules and cytokines according to C19 treatment (*p <0.05; **p <0.01; ***p < 0.001).
Figure 13 is a diagram showing the expression levels of DR4 and DR5 on cancer spheroids according to C19 treatment (*p <0.05; **p <0.01; ***p < 0.001).
14 is a diagram showing the expression levels of genes related to the Hippo signaling pathway according to C19 treatment.
15 is a diagram showing YAP/TAZ expression levels in PBNK cells and NK92 cells according to C19 treatment.
16 is a diagram showing the expression levels of ECM proteins and TGFβ receptors according to C19 treatment.
17 a and b are diagrams showing the infiltration efficiency of NK cells into cancer spheroids according to C19 treatment, and c is a diagram showing the stiffness of cancer spheroids according to C19 treatment.
18 is a diagram showing the gene expression characteristics of C19-treated cancer spheroids, where a is a diagram showing the number of DEGs, and b is a Volcano plot showing upregulated (orange dots) and downregulated (blue dots) genes. c and d are diagrams showing the results of KEGG pathway enrichment analysis and GSEA analysis, respectively.
19 is a diagram schematically showing the cancer cell death process through combined treatment of C19 and NK cells.

It will be described in more detail through examples and experimental examples below. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1: Cell culture

Patient-derived pancreatic cancer cell lines (SNU2570, SNU2608, SNU2491, SNU213, and SNU2564) were obtained from the Korean Cell Line Bank (KCLB), and 110621 patient-derived cancer cells (PDCs) were obtained from Asan Medical Center. The cells were cultured in RPMI1640 medium (Welgene) containing 10% FBS (Welgene) and 1% antibiotic and antifungal solution (Welgene) at 37° C. under 5% CO ₂ humidified conditions.

NK-92 cells were purchased from American Type Culture Collection (ATCC). NK-92 cells were cultured in Minimum Essential Medium α (MEMα) containing 20% FBS (Gibco), 10X MEM vitamin solution (Gibco), 0.1 mM 2-mercaptoethanol (Gibco), and 1% penicillin/streptomycin (Gibco). The medium was cultured at 37 °C and 5% CO ₂ under humidified conditions.

PBNK (Primary NK) cells were prepared using frozen PBMC (peripheral mononuclear blood cells) in MACS medium (Miltenyi) for 3 weeks in the presence of rIL2 (100 IU/ml) and rIL15 (5 ng/mL) with 100 Gy irradiated K562 feeder cells. They were cultured and isolated using an NK cell isolation kit (Miltenyi).

Example 2: Fabrication of 3D biomimetic spheroids

PDCs were seeded onto plates coated with pCHMA [poly(cyclohexylmethacrylate) or pV4D4 [poly (2,4,6,8-tetravinyl-2,4,6,8-tetramethyl cyclotetrasiloxane)], followed by 10% KnockOut ^TM Serum Replacement ( Gibco) and RPMI1640 medium containing 1% antibiotic and antifungal solution at 37 °C and 5% CO ₂ humidified conditions.

Example 3: NGS (Next Generation Sequencing) analysis

RNA isolated from each indicated cell was used for whole transcriptome library construction and WTS sequencing performed by Macrogen (Korea). DEGs were analyzed using a critical fold change (FC) value of 2 and a p-value of <0.05. GO enrichment (https://biit.cs.ut.ee/gprofiler/orth) and KEGG enrichment analysis (http://www.kegg.jp/kegg/pathway.html) with a p-value threshold of <0.05 analyzed.

Example 4: Quantitative real-time PCR (qRT-PCR)

For qRT-PCR analysis, total RNA was extracted from T cells using RNA-easy mini kit (QIAGEN) and reverse transcribed into cDNA using Superiorscript III reverse transcriptase (Thermo Fisher Scientific) according to the manufacturer's protocol. Quantitative PCR (qPCR) was performed using SYBR Green Master Mix (Roche) and StepOnePlus Real-Time PCR System (Applied Biosystems), and the sequences of primers used for qRT-PCR analysis are listed in Table 1 below.

primer Sequence (5'-3') sequence number ALDHA1A1-F CGCCAGACTTACCTGTCCTA One ALDHA1A1-R GTCAACATCCTCCTTATCTCCT 2 CD133-F ACCAGGTAAGAACCCGGATCAA 3 CD133-R CAAGAATTCCGCCTCCTAGCACT 4 CD24-F GCTCCTACCCACGCAGATTTAT 5 CD24-R AGTTGGAAGTACTCTGGGAGGA 6 EPCAM-F CAATGCCAGTGTACTTCAGTTGG 7 EPCAM-R GCCATTCATTTCTGCCTTCATCA 8 TGFβ1-F TTGTGCGGCAGTGGTTGA 9 TGFβ1-R CCGTTGATGTCCACTTGCAG 10 TGFβ2-F GGTGCTCTGTGGGTACCTTG 11 TGFβ2-R AGGGTCTGTAGAAAGTGGGC 12 TGFβ3-F ATCCTTCGGCCAGATGAGC 13 TGFβ3-R CCACTCACGCACAGTGTCA 14 TGFβR1-F GCCGTTTGTATGTGCACCC 15 TGFβR1-R GCAATGGTCCTGATTGCAGC 16 TGFβR2-F TGCCCCAGCTGTAATAGGAC 17 TGFβR2-R TGGAAACTTGACTGCACCGT 18 TGFβR3-F GGTTGGCCAGATGGTTATGA 19 TGFβR3-R ATTTCAGGTCGGGTGAACAG 20 CXCR3-F CAGGTGCCCTCTTCAACATCAA 21 CXCR3-R TAGAGCTGGGTGGCATGAACTA 22 CXCR4-F TCCATTCCTTTGCTCTTTTGC 23 CXCR4-R CAGGGTTCCTTCATGGAGTCAT 24 CXCR7-F CACGTCTGCGTCCAACAATGA 25 CXCR7-R AATGGAGAAGGGAACGGCAAAG 26 CXCL10-F TGCCATTCTGATTTGCTGCCTTAT 27 CXCL10-R TGCAGGTACAGCGTACAGTTCT 28 CXCL11-F TGCTACAGTTGTTCAAGGCTTCC 29 CXCL11-R AGGCTTTCTCAATATCTGCCACTTT 30 CXCL12-F GCTTTCTCCAGGTACTCCTGAATC 31 CXCL12-R CCAGGTACTCCTGAATCCACTTTAG 32

Example 5: Imaging based on high-content drug screening

GFP-expressing 110621 spheroids and NK92 were co-cultured at the indicated E:T ratios (NK cells:cancer cells) in the presence of several drugs: CXCR3 antagonist (PS372424) (Merck), CXCR4 antagonist ) (AMD3100) (Merck), C19 (EMT inhibitor-1) (MedChemExpress) and vactosertib (TEW-7197) (Selleckchem). After 24 hours, GFP fluorescent spheroid images were acquired and quantitative data were obtained using the Operetta CLS high-content analysis system equipped with Harmony software (PerkinElmer).

Example 6: Live cell imaging analysis

GFP-expressing 110621 spheroids were co-cultured with Did (Invitorgen)-labeled PBNK cells in the presence or absence of C19 at an E:T ratio of 1:1, 4:1 or 8:1. Real-time fluorescence images were obtained using a LionheartFX (BioTek) automated live cell microscope at 37 °C and 5% CO ₂ humidified conditions. For analysis of survival and killing efficacy and NK infiltration efficacy, images were captured at 4-hour intervals for 72 hours.

For the measurement of spheroid stiffness, C19 treated GFP expressing 110621 spheroids were incubated with DiD dye and images were obtained every 2 hours for 24 hours. Imaging processing and in-depth quantitative evaluation were performed using Gen5 software (BioTeck).

Example 7: Western blotting analysis

Whole cell lysates were lysed in lysis buffer (1% NP-40, 137 mM NaCl, 20 mM Tris-HCl (pH 8.0), 2 mM EDTA, 10% glycerol, 20 mM NaVO4) containing protease inhibitor cocktail (Roche). , 10 mM sodium pyrophosphate, 100 mM sodium fluoride, 20 mM PMSF), incubated on ice for 20 minutes, and collected by centrifugation at 17,000 g for 15 minutes. The total protein concentration in whole cell lysates was determined by Bradford protein assay (Bio-Rad), and the collected proteins were stored in SDS sample loading buffer (60 mM Tris-HCl, 25% glycerol, 2% SDS, 14.4 mM, β-mercaptoethanol and 0.1% bromophenol blue) at 95 °C for 5 minutes.

Cell-lysate proteins were electrophoresed on an 8-10% SDS-PAGE gel, and the separated proteins were transferred to a nitrocellulose membrane. The membrane was blocked by incubation with Tris-buggered saline (TBST, 0.1% Tween-20) containing 5% skim milk at room temperature for 1 hour, and then the membrane was incubated with the primary antibody overnight at 4°C. The primary antibodies used to detect the target protein were as follows: Laminin, Collagen I 1:1000, Abcam), GAPDH (1:2000, Abcam), pMST-1 (1:1000, Cell Signaling Technology (CST)) ), MST-1 (1:1000, CST), pLATS-1 (1:1000, CST), LATS-1 (1:1000, CST), YAP (1:1000, CST), TAZ (1:1000, CST), Fibronectin (1:1000, Abcam), CD133 (1:1000, Abcam), Collagen ₃Abcam), TGFβR1 (1:1000, R&D systems), TGFβR2 (1:1000, Abcam), TGFβR3 (1:1000, R&D systems), β-actin (1:2500, Santa Cruz Biotechnology). Next, the membrane was incubated with an HRP-conjugated secondary antibody (Invitrogen), treated with an enhanced chemiluminescence (ECL) substrate (Bio-Rad), and then imaged by ChemiDoc (Bio-Rad) using the Image lab program. HRP signal was visualized.

Example 8: Flow cytometry analysis

2 x 10 ⁴ 110621 spheroids were co-cultured with NK-92 cells or PBNK cells at the indicated ratios at 37 °C, 5% CO ₂ humidified conditions in the presence or absence of C19. For analysis of surface markers, cells harvested at 24 and 48 hours of incubation were stained with PBS containing 0.5% BSA and 0.05% azide. For intracellular staining, cell fixation and permeabilization were performed using cytofix/cytoperm (BD Biosciences). Dead cells were excluded using LIVE/DEAD Fixable Dead Viability Dye (Thermo Fisher Scientific). For flow cytometry experiments, antibodies were purchased from Biolegend and the following antibodies were used: CD16-PE (B73.1), CD56-FITC (HCD56), CD69-PE/Cy7 (FN50), NKG2D-APC/Cy7 (1D11), NKp30-PerCP/Cy5.5 (P30-15), NKp46-PE/CF594 (9E2), TRAIL-APC (RIK-2), DR4-PE (DJR2-4), DR5-APC (DJR1) , and Perforin-PE (dG9). Flow cytometry was performed using Cytoflex (Beckman Coulter), and the obtained data was analyzed using FlowJo V10 7.2 (BD).

Example 9: ELISA and LDH assay

2 x 10 ⁴ 110621 spheroids were co-cultured with PBNK cells in the presence or absence of C19 at 37 °C, 5% CO ₂ humidified conditions at E:T ratios of 2:1, 4:1, and 8:1. Supernatants were obtained after 24 and 28 hours of incubation. LDH release was performed using the CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega) according to the manufacturer's instructions. Human cytokine quantification was performed using the human IFN gamma Elisa kit (Abcam).

Example 10: Immunofluorescence staining

110621 spheroids were prepared using primary antibodies of Laminin (1:100, Abcam), Collagen Ⅰ (1:100, Abcam), CD133 (1:100, Abcam) and Alexa Fluor 488- or Alexa Fluor 647-conjugated IgG (1 :200, Abcam) and immunostained with DAPI. Next, the stained cells were imaged on a Zeiss LSM800 confocal microscope (Carl Zeiss).

Example 11: Statistical Analysis

Comparisons between the two experimental groups were calculated using the two-tailed unpaired Student's t-test or the Mann-Whitney U-test. Comparisons between two or more experimental groups were calculated using one-way ANOVA test and Tukey's multiple comparison test. All results are expressed as mean ± standard error (s.e.m.). P-values indicate the following significance: *P < 0.05; **P < 0.01 and ***P < 0.001. Data analysis was performed using GraphPad Prism Software 9.0 (La Jolla).

Experimental Example 1: 3D biomimetic spheroid bioassay platform development and characterization using PDC

It is known that in vitro 3D spheroid cancer models fabricated using polymer film-coated surfaces can mimic the complex interactions between cancer cells and the tumor microenvironment (TME) by modulating cancer cell behavior and phenotype. Hydrophobic polymer-coated surfaces formed multicellular tumor spheroids from numerous different cancer cell lines with highly aggressive tumorigenic properties such as enhanced cancer stemness, ECM protein deposition and drug resistance. Currently, a major challenge in in vitro cancer models is the lack of appropriate models to generate clinically relevant efficacy data for drug discovery and precision medicine. Therefore, in order to expand the above in vitro 3D spheroid cancer model as a pre-clinically applicable tool for verifying the effect of cancer immunotherapy, patient-derived pancreatic cancer cells (pancreatic cancer PDCs) are used to NK-mediated cancer cells We aimed to determine treatment optimization by screening compounds to enhance the killing effect (FIG. 1).

1-1. Fabrication of PDC-derived 3D spheroids

First, it was confirmed whether a 3D spheroid model could be produced in vitro using PDC. For PDC spheroid generation, pCHMA [poly(cyclohexylmethacrylate) or pV4D4 [poly (2,4,6,8-tetravinyl-2,4,6,8- tetramethyl cyclotetrasiloxane)] was directly deposited on the surface of the cell culture well-plate. Six types of PDC were seeded and cultured in a 96-well plate coated with the hydrophobic polymer, and their cell morphology was monitored on the first and second days, respectively.

As a result, three types of PDCs, including 110621, SNU2570, and SNU2608, formed dense 3D spheroids in all polymer-coated culture plates (Fig. 2a), while other PDCs, including SNU2491, SNU213, and SNU2564, formed loose spheroids. It was confirmed that it was formed (Fig. 2b). Based on the above results, it can be seen that differences in cell clustering and tumorigenic potential of each PDC can induce morphological differences between spheroid-forming PDC and non-spheroid-forming PDC.

1-2. Characterization of 3D spheroids made with 110621 PDC

As a result of analyzing the characteristics of the spheroids prepared from 110621 PDC among the above spheroid-forming PDCs, they maintained a uniform and high-density structure with a constant size distribution during the culture period of 8 days, and 11021 PDCs had an average diameter of 50 μm It was confirmed that multicellular spheroids were formed (Fig. 3a). In addition, deposition of ECM proteins representing human TME was confirmed in 110621 PDC spheroids, specifically, they included higher levels of type 1 and type 4 collagen compared to the control group (FIG. 3b), fluorescently labeled laminin and It was confirmed that type 1 collagen was strongly and uniformly accumulated in each of the 110621 spheroids, especially at cell-cell boundaries (Fig. 3c).

In addition, 110621 spheroids showed improved stem cell characteristics along with the deposition of ECM proteins. Specifically, several stem cell characteristic markers such as ALDH1A1 (aldehyde dehydrogenase 1A1), CD133, CD24, and EpCAM (epithelial cell adhesion molecule) were found in 110621 As it was significantly up-regulated in spheroids, it was confirmed that it exhibits high tumorigenic potential (FIG. 3d). In particular, 110621 spheroids showed a 13-fold increase in the expression level of ALDH1A1 compared to the control group on day 4 at the RNA level. In addition, it was confirmed that a high level of CD133 surface expression was shown (FIG. 3e).

Based on the above results, PDC-forming spheroids generated in pCHMA-coated culture plates are similar to cancer stem cells and can be converted into more tumorigenic cancer cells with strong deposition of ECM proteins, reflecting the TME in vivo. Able to know.

1-3. Analysis of gene expression levels in 2D cell culture conditions and 3D biomimetic spheroid conditions

To compare mRNA expression levels in 2D cell culture conditions and 3D biomimetic spheroid conditions, NGS analysis was performed. As a result, 735 DEGs (differentially expressed genes) with a fold change (FC) value of ≥2 and a p-value of <0.05 were discovered through whole transcriptome sequencing (WTS) (Fig. 4a). ). It was confirmed that 492 or 243 DEGs among the 735 DEGs were significantly upregulated or downregulated in 3D spheroids including 110621 and SNU2608, respectively, compared to 2D cell culture conditions (FIG. 4b).

Next, the top 20 GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment analysis was performed. As a result, it was confirmed that the DEG was significantly enriched in collagen-containing extracellular matrix-related genes according to the cellular component of the GO term analysis (Fig. 4c), and according to KEGG's environmental information processing It was confirmed that the Hippo signaling pathway, ECM-receptor interaction, and TGFβ (transforming growth factor beta) signaling pathway were significantly enriched (FIG. 4d). Based on the above results, it can be seen that these characteristics of 3D spheroids strongly accumulate ECM in 3D biomimetic spheroids.

Experimental Example 2: Compound screening for enhancing NK-mediated cytotoxicity

Using the 3D biomimetic spheroid culture system prepared in Experimental Example 1, the following experiment was performed to screen a combination drug for enhancing NK-mediated cell toxicity.

2-1. Candidate drug selection

First, as a result of analyzing the expression levels of genes related to ECM modeling and EMT function in 3D biomimetic spheroids using quantitative real-time (qRT)-PCR, it was confirmed that genes related to induction of the TGFβ signaling pathway were significantly increased. . Specifically, the expression level of TGFβ cytokine and its receptor (TGFβR), known as a key regulator of EMT function, was greatly increased in 3D biomimetic spheroids (Fig. 5a). In addition, chemokines play an important role in tumor proliferation and metastasis, and the chemokine-chemokine receptor axis is known to be important for EMT initiation and function, and it was confirmed that 3D biomimetic spheroids showed high levels of CXCR3 and CXCR4 (Fig. 5b). .

Therefore, based on the above results, four chemical drugs including CXCR3 antagonist (PS372424), CXCR4 antagonist (AMD3100), C19 (EMT inhibitor-1) and vactosertib (TEW-7197) known to regulate EMT and ECM were candidates. It was selected as a drug, and it was confirmed whether the drug could enhance the NK-mediated cancer cell killing effect.

2-2. Evaluation of cancer cell killing efficacy according to the combination of NK cells and candidate drugs

To screen the combination of NK cells and drugs for effective cancer treatment, GFP-overexpressing 110621 spheroids prepared using pCHMA-coated biofilms were co-cultured with NK92 cells at a 1:1 ratio in the presence of the above four drugs did A high-content imaging system in a 96-well format was used to monitor the spheroid area during combination treatment.

As a result, when C19 and NK cells were treated in combination among the four drugs, it was confirmed that the spheroid area was significantly reduced compared to the case of combined treatment with other drugs (PS372424, AMD3100 and TEW-7197) (Fig. 6).

Based on the above results, it can be seen that C19 among the candidate drugs has excellent cancer cell killing efficacy when treated in combination with NK cells.

2-3. Evaluation of cancer cell killing efficacy of C19 and NK cell combination

The efficacy of NK-mediated cancer cell killing at various E:T ratios and various C19 concentrations was evaluated using either a high-content imaging system or a live cell imaging system.

First, the cancer cell killing effect according to the combination treatment of NK92 cells and C19 was evaluated. As a result, it was confirmed that the combined treatment with C19 could induce remarkably improved NK-mediated cell lysis (FIG. 7). However, when C19 was treated alone without NK cells, it was confirmed that cancer cell toxicity was not induced in 3D spheroid models and 2D cultured cells (FIG. 8).

Next, the cancer cell killing effect according to the combined treatment of healthy donor-derived primary NK (PBNK) cells and C19 was evaluated. Specifically, Did-labeled PBNK cells were co-cultured with GFP-overexpressing 110621 spheroids for 72 hours, and the GFP expression intensity of 110621 spheroids was checked at 8-hour intervals. As a result, it was confirmed that a significant improvement in NK-mediated cell toxicity could be induced in a concentration-dependent manner of C19 treated (FIG. 9a). In addition, it was confirmed that NK-mediated cytotoxicity was improved as the treatment ratio of PBNK increased during C19 treatment (FIG. 9b).

Next, in order to evaluate the degree of cytolytic death of spheroids according to the presence or absence of C19, a luminescence-based lactate dehydrogenase release assay was performed from the supernatant co-cultured with PBNK cells. As a result, it was confirmed that the presence of C19 induces strong LDH release (FIG. 9c).

Summarizing the above results, it can be seen that C19 can enhance the cancer cell killing efficacy of NK cells, and thus the cancer cell killing efficacy is excellent when treated in combination with NK cells.

Experimental Example 3: Mechanism analysis for synergistic effect of NK-mediated cancer cell lysis of C19

Through the above example, it was confirmed that C19 has a synergistic effect on NK-mediated cancer cell lysis. Therefore, in order to confirm the mechanism for the synergistic effect of NK-mediated cancer cell lysis by C19, the following experiment was performed.

3-1. Evaluation of expression levels of activating receptors on NK cells

First, we evaluated the expression of activating receptors in NK92 cells. As a result, when NK92 cells were present alone, C19 did not induce the expression of the activating receptor (Fig. 10a), but when NK92 cells and cancer spheroids were co-cultured, C19 induced the expression of the activating receptor. (Fig. 10b). Based on the above results, it can be seen that the surface expression of activating receptors such as CD69 and NKG2D on NK92 is due to co-treatment with C19 on cancer spheroids.

Next, similar to the above results, when cancer spheroids and PBNK cells are co-cultured at various E:T ratios, C19 induces the expression of activating receptors such as CD69, NKG2D, NKp30, NKp46 and TRAIL in PBNK cells confirmed that it could be done. On the other hand, when PBNK cells were not co-cultured with cancer spheroids, it was confirmed that C19 did not affect NK cell activation (FIGS. 11a and 11b). Based on the above results, it can be seen that C19-treated spheroids can affect the activation of NK cells through the regulation of cancer-derived secretome or ligand-receptor signal pair.

3-2. Assessment of cytotoxic granules and release of cytokines

First, it was confirmed that perforin and interferon-γ were significantly released in the supernatant obtained from cancer spheroids co-treated with PBNK and C19 (FIG. 12). Based on the above results, it can be seen that co-treatment of C19 and NK cells can induce NK cell activity and promote cancer cytolytic activity.

Next, it is known that TRAIL (TNF-related apoptosis-inducing ligand) can be expressed in NK cells by stimulation of IFN-γ, and in FIG. 11a, high levels of TRAIL are expressed during co-culture of C19 and cancer spheroids. As confirmed, it can be seen that C19 induced TRAIL-mediated NK cell toxicity.

In addition, death receptor 4 (DR4) and DR5, known as TRAIL receptors on cancer cells, are known to be internalized into cells through receptor-mediated endocytosis after TRAIL-ligation to overcome TRAIL-induced apoptosis. Therefore, the expression levels (whether internalized or not) of DR4 and DR5 were evaluated in cancer spheroids co-treated with PBNK and C19. As a result, it was confirmed that the expression level of DR5 was gently decreased on cancer spheroids (FIG. 13), indicating that DR5-mediated endocytosis was induced in cancer spheroids after participating in TRAIL.

Taken together, it can be seen that the co-treatment of C19 and NK cells can accelerate NK cell activation against cancer, and C19 can induce enhanced cytotoxic effects of NK cells.

Experimental Example 4: Evaluation of whether C19 regulates ECM protein deposition and enhances cancer spheroid penetration of NK cells

In order to confirm the molecular biological mechanism of the therapeutic effect of the combination of NK cells and C19, the following experiment was performed.

4.1: Identification of major target proteins of C19

YAP (Yes-associated protein) and TAZ (transcriptional coactivator PDZ-binding motif) are key components of the Hippo signaling pathway, and the Hippo-YAP/TAZ pathway plays an important role in various biological processes such as homeostasis, development, and cancer. . When Hippo signaling is activated, key kinase cascades of MST1/2 (mammalian sterile 20-like kinase 1/2) and LATS1/2 (large tumor suppressor kinase 1/2) are phosphorylated, and then two transcriptional regulators, YAP and TAZ are phosphorylated and inactivated by inducing ubiquitination-mediated proteasomal degradation of pYAP/TAZ. In tumor cells, the Hippo signaling pathway is blocked, YAP/TAZ is not phosphorylated and not degraded, but activated, translocation to the nucleus occurs, and existing transcription factors TEAD 1-4 and other transcription factors form a complex to promote cell proliferation and promote survival.

Therefore, considering the above, the expression levels of MST-1/pMST-1, LATS-1/pLATS-1, and YAP/TAZ in cancer spheroids according to C19 treatment were evaluated, and as a result, MST-1 and pMST-1 The expression level of was not affected (FIG. 14a), but the expression level of pLATS-1 increased (FIG. 14b), and YAP/TAZ was degraded, confirming that the expression level decreased (FIG. 14c).

Next, as a result of evaluating the expression levels of YAP/TAZ in NK cells after C19 treatment, it was confirmed that the expression levels of TAZ and YAP did not change significantly in PBNK and NK92 cells (FIG. 15). It can be seen that it has no effect.

4.2: ECM protein expression level evaluation according to C19 treatment

The Hippo-YAP/TAZ signaling pathway is closely related to the TGFβ and Wnt signaling pathways, and may play an important role in ECM deposition, stiffness, and cancer metastasis. Therefore, as a result of evaluating the expression level of ECM proteins according to C19 treatment, it was confirmed that the expression level of ECM proteins such as fibronectin and collagen decreased by C19 treatment (FIG. 16a). It can be seen that by reducing the expression level of the protein, it is possible to induce immune cells to easily infiltrate cancer.

Next, as a result of evaluating the expression level of TGFβR1-3 according to C19 treatment, it was confirmed that TGFβR was greatly reduced at the protein level in C19-treated spheroids (FIG. 16b). It can be seen that mediating signaling pathways play an important role.

4.3: Evaluation of NK cell infiltration efficiency according to C19 treatment

In Example 4.2, it was confirmed that ECM deposition was reduced by C19 treatment. In this regard, the rate of NK cell penetration into cancer spheroids was evaluated during C19 treatment. As a result, compared to the C19 untreated condition, it was confirmed that a large portion of Did-labeled NK92 cells were detected in GFP-expressing spheroids when C19 was treated (FIG. 17a), and PBNK cells were also detected in cancer spheroids due to C19 treatment. As it was confirmed that the infiltration efficiency into cancer cells was improved (FIG. 17b), based on the above results, it can be seen that the infiltration efficiency of NK cells into cancer cells can be improved by C19 treatment.

Next, with respect to NK cell invasion efficiency, the rigidity of cancer spheroids by C19 treatment was evaluated. As a result, when Did dye and C19 were co-cultured in spheroids, it was confirmed that the dye penetrated rapidly into spheroids in the C19-treated group compared to the control group (FIG. 17c). In addition, when C19 was treated, it was confirmed that the red fluorescence of Did dye was present in the core of the spheroid, not around the spheroid.

Taken together, it can be seen that C19 affects ECM deposition and stiffness, and improves cancer cell toxicity by increasing the infiltration efficiency of NK cells based on this.

Experimental Example 5: Analysis of gene expression characteristics of C19-treated cancer spheroids

To evaluate the gene expression properties of C19 influencing NK-mediated cell lysis of cancer cells, NGS analysis was performed on C19 treated cancer spheroids. As a result, when cancer spheroids were treated with C19, 119 DEGs were identified (Fig. 18a), and among the DEGs, CDH5 (cadherin 5), CDH11, COL6A6 (collagen Type VI Alpha 6 Chain) and ADORA2A (adenosine receptor A2a) It was confirmed that genes associated with tumor metastasis or TME such as were significantly downregulated in C19-treated spheroids (FIG. 18b).

Next, as a result of KEGG pathway analysis, it was confirmed that genes mainly involved in metabolism are abundant in the DEGs (FIG. 18c), and in particular, downregulated DEGs are neuro-active ligands that can affect cancer invasion and metastasis. It was confirmed that it was significantly related to the signaling pathway related to receptor interaction and cell adhesion molecules.

Next, as a result of GSEA (gene set enrichment analysis) analysis of WTS data, it was confirmed that genes related to DNA replication, elongation, and extracellular transport were downregulated in C19-treated spheroids (FIG. 18d).

Taken together, it can be seen that C19 can enhance NK cell activation by influencing TME remodeling.

In conclusion, in the present invention, C19 was selected as a combination drug for enhanced NK cell cancer cytolysis through an imaging-based screening method using co-culture analysis of patient-derived 3D cancer spheroids and NK cells. The C19 significantly inhibits the Hippo, Wnt and TGFβ signaling pathways and is known to be involved in cancer cell death. However, in the results of the above experimental example, it was confirmed that C19 alone had no or slight antitumor effect when treated with cancer spheroids. . In addition, treatment with C19 alone did not significantly affect NK cell activation and NK-mediated cell lysis.

However, the combination of C19 and NK cells showed a synergistic effect for dramatically enhanced anti-tumor effects on 3D cancer spheroids. Specifically, C19 did not exhibit cytotoxicity against 3D cancer spheroids, but contributed to degradation/inhibition of ECM proteins and TGFβ receptors in cancer spheroids. In addition, co-treatment of NK cells with C19 induced enhanced NK activation, invasion and cytolysis. Based on these results, it can be seen that C19 may be due to structural changes in the extracellular matrix in the tumor microenvironment, and reduction of ECM proteins and TGFβ receptors may improve NK cell infiltration by reducing ECM stiffness can know

Based on the above results, co-treatment of C19 and NK cells can induce a synergistic effect on NK-mediated cytolytic potency (FIG. 19).

The above description of the present invention is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting.

<110> KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY <120> Composition for enhancing cancer treatment effect containing C19 and use it <130> PN139467KR <160> 32 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> ALDHA1A1-F <400> 1 cgccagactt acctgtccta 20 <210> 2 <211> 22 <212> DNA <213> artificial sequence <220> <223> ALDHA1A1-R <400> 2 gtcaacatcc tccttatctc ct 22 <210> 3 <211> 22 <212> DNA <213> artificial sequence <220> <223> CD133-F <400> 3 accaggtaag aacccggatc aa 22 <210> 4 <211> 23 <212> DNA <213> artificial sequence <220> <223> CD133-R <400> 4 caagaattcc gcctcctagc act 23 <210> 5 <211> 22 <212> DNA <213> artificial sequence <220> <223> CD24-F <400> 5 gctcctaccc acgcagattt at 22 <210> 6 <211> 22 <212> DNA <213> artificial sequence <220> <223> CD24-R <400> 6 agttggaagt actctgggag ga 22 <210> 7 <211> 23 <212> DNA <213> artificial sequence <220> <223> EPCAM-F <400> 7 caatgccagt gtacttcagt tgg 23 <210> 8 <211> 23 <212> DNA <213> artificial sequence <220> <223> EPCAM-R <400> 8 gccattcatt tctgccttca tca 23 <210> 9 <211> 18 <212> DNA <213> artificial sequence <220> <223> TGFb1-F <400> 9 ttgtgcggca gtggttga 18 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> TGFb1-R <400> 10 ccgttgatgt ccacttgcag 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> TGFb2-F <400> 11 ggtgctctgt gggtaccttg 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> TGFb2-R <400> 12 agggtctgta gaaagtggggc 20 <210> 13 <211> 19 <212> DNA <213> artificial sequence <220> <223> TGFb3-F <400> 13 atccttcggc cagatgagc 19 <210> 14 <211> 19 <212> DNA <213> artificial sequence <220> <223> TGFb3-R <400> 14 ccactcacgc acagtgtca 19 <210> 15 <211> 19 <212> DNA <213> artificial sequence <220> <223> TGFbR1-F <400> 15 gccgtttgta tgtgcaccc 19 <210> 16 <211> 20 <212> DNA <213> artificial sequence <220> <223> TGFbR1-R <400> 16 gcaatggtcc tgattgcagc 20 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> TGFbR2-F <400> 17 tgccccagct gtaataggac 20 <210> 18 <211> 20 <212> DNA <213> artificial sequence <220> <223> TGFbR2-R <400> 18 tggaaacttg actgcaccgt 20 <210> 19 <211> 20 <212> DNA <213> artificial sequence <220> <223> TGFbR3-F <400> 19 ggttggccag atggttatga 20 <210> 20 <211> 20 <212> DNA <213> artificial sequence <220> <223> TGFbR3-R <400> 20 atttcaggtc gggtgaacag 20 <210> 21 <211> 22 <212> DNA <213> artificial sequence <220> <223> CXCR3-F <400> 21 caggtgccct cttcaacatc aa 22 <210> 22 <211> 22 <212> DNA <213> artificial sequence <220> <223> CXCR3-R <400> 22 tagagctggg tggcatgaac ta 22 <210> 23 <211> 22 <212> DNA <213> artificial sequence <220> <223> CXCR4-F <400> 23 tccattcctt tgcctctttt gc 22 <210> 24 <211> 22 <212> DNA <213> artificial sequence <220> <223> CXCR4-R <400> 24 cagggttcct tcatggagtc at 22 <210> 25 <211> 21 <212> DNA <213> artificial sequence <220> <223> CXCR7-F <400> 25 cacgtctgcg tccaacaatg a 21 <210> 26 <211> 22 <212> DNA <213> artificial sequence <220> <223> CXCR7-R <400> 26 aatggagaag ggaacggcaa ag 22 <210> 27 <211> 24 <212> DNA <213> artificial sequence <220> <223> CXCR10-F <400> 27 tgccattctg atttgctgcc ttat 24 <210> 28 <211> 22 <212> DNA <213> artificial sequence <220> <223> CXCR10-R <400> 28 tgcaggtaca gcgtacagtt ct 22 <210> 29 <211> 23 <212> DNA <213> artificial sequence <220> <223> CXCR11-F <400> 29 tgctacagtt gttcaaggct tcc 23 <210> 30 <211> 25 <212> DNA <213> artificial sequence <220> <223> CXCR11-R <400> 30 aggctttctc aatatctgcc acttt 25 <210> 31 <211> 24 <212> DNA <213> artificial sequence <220> <223> CXCR12-F <400> 31 gctttctcca ggtactcctg aatc 24 <210> 32 <211> 25 <212> DNA <213> artificial sequence <220> <223> CXCR12-R <400> 32 ccaggtactc ctgaatccac tttag 25

Claims (12)

A pharmaceutical composition for enhancing the therapeutic effect of cancer, comprising C19 (EMT inhibitor-1) or a pharmaceutically acceptable salt thereof as an active ingredient. The pharmaceutical composition according to claim 1, wherein the composition enhances the activity of an anticancer agent. The pharmaceutical composition according to claim 2, wherein the anticancer agent is an immune cell therapy. The method according to claim 3, wherein the immune cell therapy is dendritic cell (dendritic cell), natural killer cell (natural killer cell), T cell (T cell), tumor-infiltrating lymphocyte (TIL), T cell receptor expression T cell (TCR-modified T cell, TCR-T), chimeric antigen receptor expressing T cell (CAR-modified T cell, CAR-T), lymphokine-activated killer cell (LAK), and chimeric At least one selected from the group consisting of antigen receptor expressing NK cells (CAR-modified NK cell, CAR-NK), the pharmaceutical composition. The pharmaceutical composition according to claim 1, wherein the composition inhibits the tumor microenvironment. The pharmaceutical composition according to claim 1, wherein the composition inhibits the extracellular matrix (extracellular matrix, ECM). The pharmaceutical composition according to claim 1, wherein the composition inhibits at least one selected from the group consisting of the Hippo-YAP/TAZ signaling pathway, the TGFβ signaling pathway, and the Wnt signaling pathway. The method according to claim 1, wherein the cancer is gastric cancer, liver cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, colon cancer, bone cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, colon cancer, anus Adrenal carcinoma, colon cancer, breast cancer, cervical cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, Cancer of the urethra, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary central nervous system lymphoma, spinal cord Tumor, brainstem glioma or pituitary adenoma, the pharmaceutical composition. A pharmaceutical composition for preventing or treating cancer comprising C19 (EMT inhibitor-1) or a pharmaceutically acceptable salt thereof, and an anticancer agent as active ingredients. The pharmaceutical composition according to claim 9, wherein the C19 or a pharmaceutically acceptable salt thereof, and the anticancer agent are administered in combination. The pharmaceutical composition according to claim 9, wherein the C19 or a pharmaceutically acceptable salt thereof and the anticancer agent are simultaneously administered in one formulation, or administered simultaneously or sequentially in separate formulations. A pharmaceutical composition for enhancing the therapeutic effect of an immune cell therapy, comprising C19 (EMT inhibitor-1) or a pharmaceutically acceptable salt thereof as an active ingredient.

Images