TW201238973A - MiRNAs in joint disease - Google Patents

Abstract

The present invention concerns microRNAs (miRNA), in particular mir-22, as an indicator of a tissue status or a disease such as osteoarthritis (OA) and as a target molecule for the discovery of a substance for the treatment of a joint disease. Further provided are methods and compounds for investigation, analysis and/or treatment of a joint disease, especially OA.

Description

201238973 VI. Description of the invention: [Technical field to which the invention pertains] The present invention relates to microRNAs (miRNAs), particularly mir-22, as indicators of tissue status or diseases such as osteoarthritis (〇A), and as an indication The target molecule for the treatment of arthritic substances. Further, methods and humans for investigating knife formation and/or treating Klang disease, particularly QA, are provided. 〇 [Prior Art] Arthritis is the most common joint disease in humans and is characterized by joint pain, inflammation, redness and swelling. Several different forms of arthritis are known. Rheumatoid arthritis (RA), neonatal systemic inflammatory disease, primary 2 = fluid joint a; and ankylosing spondylitis (AS), also chronic inflammation Μ-Γ: 'mainly f彡 彡 和 and pelvis joint. Juvenile idiopathic instant fire (JIA) is characterized by (4) inflammation (10) and occurs in age 16 gout, characterized by frequent episodes of acute inflammatory stagnation, which is due to elevated uric acid levels in the blood. Caused by joint infections, and dry arthritis can be: Two: in the dry disease patients. Osteoarthritis _ its ^ = abnormalities such as articular cartilage and subchondral bone degeneration. ~ Several OAs are the most common diseases in Western countries -: US L 曰 Ben and Germany have more than 21 million diagnosed symptoms 0 guang 0 t Bu due to population aging, must face increasing 0A disease = Symptoms, life products f are seriously affected. In addition, OA brings the direct and indirect cost burden of the F Γ economy. Current treatment; 201238973 Pain camp related to 〇A, m, slow, stop or even; /1 Because of the long-term search for possible subtraction, it is still not possible to reverse the OA process and the pharmacological treatment of its effects; The work "the disease and pathological results that cause structural and dysfunction of the synovial joint. It occurs when the distraction of the joint tissue is destroyed. The structural disability of cartilage can be = w:: The mechanical strain of the towel damages the healthy cartilage' and the pathologically damaged cartilage degradation in the physiological and/or ringing, disability is characterized by Progressive cartilage degradation, which eventually leads to the loss of the injured joint π S QA During the chronic progression, the cartilage is destroyed, the underlying bone tissue is released, and the injured joint needs to be surgically replaced. In addition to cartilage destruction, there is also a pathological regression of slippage and (d). The second effect of sputum is to produce inflammation. Morphological changes observed in sputum include cartilage erosion and varying degrees of synovial inflammation. These changes are attributed to the complex network of biochemical factors, including proteolytic enzymes that cause the breakdown of cartilage macromolecules, particularly collagen π, sputum and aggrecan. Cytokines significantly up-regulate matrix metalloproteinase (MMP) and cytokine gene expression, and passivation-compensated synthesis, for example, by activated synoviocytes, monocytes, or by IL-1 and TNF-α produced by cartilage itself. The exact cause of OA remains unsolved, but some causes are related to the birth and progress of the disease. The most important factor is age, but cyclical overload, obesity, joint relaxation and congenitality also play an important role. ^ Degradation of matrix components is generally recognized due to the extracellular protease, the increase and activation of MMP synthesis by the main moon 201238973, and the cytokine enlargement of the degenerative process. The diagnosis of 0 OA is generally based on the clinical examination of the affected joints. The indication is based on the indication, and the diagnosis is confirmed by X-ray. Typical changes that can be observed through light include narrowing of joint space, formation of bone spurs at the edges of the joints, subchondral sclerosis, subchondral cyst formation, bone remodeling, and joint effusion. Laboratory tests for diagnosing OA have not yet been achieved' because the standard of use is still normal in OA. These tests can only be used to identify other forms of arthritis, particularly inflammatory types of arthritis. Therefore, OA can only be diagnosed if the joint degradation has deteriorated enough to be seen with χ光. At present, it seems that the early disease is still undetectable, which hinders the timely treatment of joint damage that may be avoided from the beginning. Therefore, the improved tool for identifying 0A at an early stage is still a hope. The symptoms of the disease must not be treated by prisoner medicine because there is no drug-relieving drug (DMOAD). Therefore, today's disease management is to reduce the conversion of medicine, mainly inflammation, soothing pain and thus benign: defects, for the identification of early diseases: change = : = = to give prevention and ... early cure [invention] and A suitable method of improvement is to use a sputum negative and a composition. The aspect of the present invention differs from the aspect of 201238973 by providing an imRNA-based method and differentially expressed during the differentiation of chondrocytes, and the cultured bone (BMCS) can be solved. The inventors of the present invention unexpectedly discovered that mir-22-specific inhibition in chondrocytes increases cartilage formation markers, whereas overexpression of mir-22 in chondrocytes leads to a decrease in cartilage formation markers. In a first aspect, the invention provides for the use of mir-22 as a tissue state or disease indicator, and in the second aspect mir_22 as a tissue disease indicator. In a third aspect, the invention provides a method of identifying a change in tissue status, or a risk of a disease, preferably a joint disease, and/or identifying the presence of a disease and/or monitoring the progression of the disease in an individual, including detecting a sample The amount of mir-22. In a fourth aspect, the present invention provides a method for determining a medical dosage for tissue state or for preventing or treating a disease, preferably a joint disease, in an individual comprising the steps of: (final determination of mir 22 in an individual sample) The quantity 'and (b) determines the medical dose according to the amount of mir_22 in the test sample. In a fifth aspect, the present invention provides a method of adjusting a medical dose for tissue state change or preventing or treating a joint disease, comprising the following steps: a) determine the amount of mir_22 in the sample, and (b) determine the amount of mir-22 in one or more reference samples, and (c) test whether the amount of mir-22 in the sample is related to one or more references The amount of mir_22 in the sample is different' (d) The medical dose is adjusted according to whether the amount of mir-22 in the test sample is different from the amount of mir-22 in one or more reference samples. In the sixth aspect, the present invention provides assay 1 Substance-to-tissue state 201238973 or occurrence of (d) disease system and / face #effect square *, basin includes the following steps · (4) 骇 test sample stealing _22 amount; medium -22 amount, and (4) test test 2 exists Sample m Whether the amount of ir_22 is different from - or 5_ of mir22 in a plurality of reference samples, wherein the test sample is exposed to the system different from the one or more reference samples. In the seventh aspect, the present invention provides mir_22 in the third to the first Use of the method of any of the six aspects. ^ In an eighth aspect, the invention provides a kit for use in the method of any of the third to sixth aspects, comprising - or a plurality of detection tools In a ninth aspect, the invention provides the use of the method of any of the eighth to sixth aspects. In a tenth aspect, the invention is in the method of any of the third to sixth aspects Providing one or more nucleic acids for detecting a mir-22 gene, a gene product, or a functionally active variant thereof. In an eleventh aspect, the invention is provided in the method of any of the third to sixth aspects The peptide, the polypeptide or the protein of the functional activity variant of the Qin 22 gene is detected. The j of the twelfth aspect, the invention provides the nucleic acid of the tenth aspect, or the peptide, polypeptide or protein of the tenth aspect is the third to the Use in any of the six aspects of the method In a twelfth aspect, the invention provides a method of screening for a mir-22 antagonist, wherein the method comprises the steps of: (8) providing a mir-22 or mir-22 gene' (b) providing a compound, and In the fourteenth aspect, the present invention provides a mir-22 antagonist for tissue state alteration or prevention or treatment of joint diseases. In a sixteenth aspect, the present invention provides a method for modifying a tissue state or preventing or treating a joint disease, wherein the treatment is An effective amount of the fifteenth aspect of the pharmaceutical is administered to an individual at risk of developing or suffering from a joint disease. DETAILED DESCRIPTION OF THE INVENTION Before the present invention is described in detail, it should be understood that the invention is not limited to the specific methods, protocols and reagents described herein, as these may vary. It is also understood that the terminology used herein is for the purpose of describing the particular embodiments, and is not intended to limit the scope of the invention. The scope of the invention is limited only by the scope of the appended claims. As will be understood by those of ordinary skill in the art to which the present invention pertains, the technical and scientific terms used herein have the same meaning unless otherwise indicated. Preferably, the terms used herein are as "A multilingual glossary of biotechnological terms : (IUPAC Recommendations)", Leuenberger, HGW, Nagel, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Defined in Basel, Switzerland). Several documents are cited throughout this specification. The documents cited in the text 201238973 (including: all patents, patent applications, scientific publications, manufacturer's instructions, guides, GenBank registration number sequence submission) 'above or below, the full text is The manner of reference is incorporated. It is not to be considered as an approval in the text, and the present invention is not entitled to the present disclosure by the prior invention. The definition of the entire specification and the scope of the patent application, unless the context requires, the word "including" and its variations should be understood to mean the whole or the steps, or the group of the whole or the steps, but not the other. Or steps, or groups of whole or steps. A "nucleic acid" molecule is understood to be a polymeric or valency macromolecule synthesized from a nucleomonomer. A nucleotide single system is composed of a nucleobase, a five carbon sugar such as, but not limited to, ribose or 2'-deoxyribose, and one to three phosphate groups. Typically, polynucleotides are formed via phosphodiester bonds between individual nucleotide monomers. In the context of the present invention is meant a nucleic acid molecule comprising, by way of example not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA) and mixtures thereof, such as RNA-DNA hybrids. The terms "polynucleotide" and "nucleic acid" are used interchangeably herein. Nucleic acids can be synthesized, for example, by chemical synthesis, such as by the acid-based S-day method (see 'eg uhlmann, E. & Peyman A (1990) Chemical Reviews, 90, 543-584) 〇' nucleic acids can be endonuclease or Exonuclease degradation, particularly DN chymase and RN chymase found in beta cells. Therefore, it is advantageous to decorate the nucleic acid in order to stabilize it against degradation, thereby ensuring the nucleic acid concentration of sputum in the long-term cells (Beigelman et al. (1995) Nucle. 201238973 WO 95/11910

Acids Res. 23: 3989-94 WO 98/37240; WO 97/29116). Typically, this stabilization can be achieved by introducing one or more nucleoside interphosphorus groups or by introducing one or more non-phosphorus internucleotide groups. Suitable modified nucleotide structures are compiled in Uhlmann and Peyman (1990), supra (see also Beigdman et al. (1995)).

Nucleic Acids Res. 23: 3989-94; WO 95/11910; WO 98/37240, WO 97/29116). Modified internucleotide phosphate groups and/or non-phosphorus bridges between nucleic acids useful in one of the uses of the present invention include, for example, phosphonium phosphonates, phosphorothioates, amino phosphates, phosphorodithioates, and/or phosphoric acid The internucleotide analogs of esters, but not phosphorus, include, for example, a decane bridge; a carbonic acid bridge; a carboxylic acid oxime ester, an aminoethyl ester bridge, and/or a thioether bridge. Also, such modifications should improve the effectiveness of the pharmaceutical composition that can be used in one of the uses of the present invention. Nucleic acids can be selected from the group consisting of: polynucleotide probes, primers (eg, primer pairs)'s preferred primers for polymerase chain reaction (pCR), reverse transcription (RT) reactions, or DNA sequencing, peptide nucleic acids (PNA), locked nucleic acid (LNA), diol nucleic acid (〇Na), threose nucleic acid (TNA), microRNA (miRNA) and small interfering RNA (siRNA). The term "probe" as used herein refers to a single-stranded oligonucleotide, which is typically used to detect a target RNA and/or DNA sequence that is complementary to a probe sequence. The probe hybridizes to a single strand of nucleic acid (DNA4 RNA), and because the probe is complementary to the target sequence, its nucleotide sequence enables nucleotide pairing. The length of the probe depends on the intended use and the specificity required for the probe. Typically, the plate needle is 20-500 (ie 50, 55, 60, 65, 70, 75, 80, 201238973 85, 90, 95, 100, 110, 120, 130, 140 '150, i6〇, 〇〇 180, 190, 200, 300, 400, 500) nucleotides long, preferably 20-100 nucleotides, more preferably 2 〇 5 〇. For detection of microRNA probes between 12 and 30 nucleotides. Probes are used in various experimental settings such as, but not limited to, Southern and Northern blots, instant pcR and in situ hybridization (ISH), and microarray experiments. The probe may be unlabeled, directly labeled or indirectly labeled, for example, biotin which may later bind to the streptavidin complex. The label can be a molecule detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical or other physical methods. For example, suitable labels include 32P, fluorescent dyes, high electron density reagents, enzymes (e.g., commonly used in ELISA), biotin, dig〇xigenin or haptens, and other detectable entities. The labeling can incorporate nucleic acids at any position, such as at 3, 5, 5, or between. The term "probe" also encompasses nucleic acids whose composition is different in composition, such as, but not limited to, peptide nucleic acid (PNA), locked nucleic acid (LNA), glycol nucleic acid (GNA), and threose nucleic acid (TNA). The term "introduction" as used herein refers to a single-stranded oligonucleotide, which is typically used as the starting point for DNA-replicase. The primer system binds or hybridizes to the DNA template and typically comprises sequences that are complementary to the sequence to which the sequence is bound. The primer may also include another (d), for example, as a sequence of nuclease cleavage sites (e.g., Bam m, Hind m, etc.). The length of the tweezers is chosen according to the intended use. For example, a primer for amplifying DNA in a polymerase chain reaction (PCR) typically has at least 1 nucleus I' preferably preferably between 1 () and 5 (), ie 15, 16, 16, 18, 19 , 20, 21, 22, Μ^ 201238973 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50) nucleotides, more preferably between 15 and 30 nucleosides acid. A shorter primer of at least 5 nucleotides can be used for the sequencing of the DNA template. The term "priming" also includes the term "degenerate primer" which is a mixture of similar but not identical primers. Primers can be labeled or labeled by detectable molecules that are detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical or other physical methods. As used herein, the term 'microRNA' and its variations such as "miRNA" and "miR" include naturally occurring human 111, mature single miRNA, precursor miRNA (pre-miR) and variants thereof. . In some instances, the term "miRNA" includes both primary miRNA transcripts and duplex miRNAs. Unless otherwise noted, the name of a particular miRNA refers to a mature miRNA when used herein. For example, mir-22 refers to a mature miRNA sequence derived from pre-mir-22. Sequences of miRNAs, including human mature and precursor sequences (also known as stem-loop sequences), are reported in the following databases: The miRBase-microRNA database can be linked via the following link: http://microrna.sanger.ac. Uk or http://www.mirbase.org/ Publications including miRNA sequences are: Griffiths-Jones et al., Nucleic Acids Research, 2008, 36, Database Issue, D154-D158; Griffiths-Jones et al., Nucleic Acids Research , 2006, 34, Database Issue, D140-D144; Griffiths-Jones, Nucleic Acids Research, 2004, 32, Database Issue, D109-D111, Griffiths-Jones et al., Nucleic Acids Research, 2011, Vol. 39, Database Issue, D152-D157) ° 12 201238973 mir-22: The sequence of Homo sapiens mir 22 stem loop sequence hsa_mir-22 (Accession number: MI0000078): GGCUGAGCCGCAGUAGUUCUUCAGUGGCAAG CUUUAUGUCCUGACCCAGCUAAAGCUGCCAGUUG AAGAACUGUUGCCCUCUGCC (SEQ ID ΝΟ:1) Mature sequence: hsa-miR-22 (Login No.: MIMAT0000077): AAGCUGCCAGUUGAAGAACUGU (SEQ ID NO: 2) Subsequence: hsa-miR-22* (Accession number: MIMAT0004495): AGUUCUUCAGUGGCAAGCUUUA (SEQ ID NO: 3) This miRNA The column is "Identification of novel genes coding for small expressed RNAs" based on homology to miRNAs verified from mice. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294: 853-858 (2001), "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891 (2003)]. Its performance was later verified in humans ""Kaposi's sarcoma-associated herpes virus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, 13 201238973

Cullen BR Proc Natl Acad Sci USA. 102:5570-5575(2005)., "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J , Phan Q, Chien M Cell. 129: 1401-1414 (2007). MicroRNAs (miRNAs) are endogenous small RNA molecules involved in regulating gene expression at the translational level. Furthermore, it is part of the cellular RNA interference (RNAi) mechanism. miRNAs are encoded by genes that are transcribed from DNA but not translated into proteins (non-protein-encoding RNA). It is first found in Caenorhabditis elegans and is found in plants and animals. The sequence of many miRNAs is highly retained among different species, showing that the miRNA pathway is part of a fairly ancient and important regulatory mechanism (Grosshans et al. J Cell Biol 156: 17-21 (2002)). miRNAs have been found to regulate approximately 3% of mammalian genes (Czech, NEJM 354: 1194-1195 (2006); Mack, Nature Biotech. 25:631-638 (2007); Eulalio, et al., Cell 132: 9-14 (2008)). Recently, miRNAs have been found to inhibit gene production by blocking transcriptional degradation resulting in transcriptional degradation, thereby regulating gene expression. A single miRNA may target 25 〇-5 不同 different mRNAs, which also indicates that such RNA is extremely important in a wide range of cellular functions 201238973. Many genes regulated by miRNAs are pathogenic genes. Therefore, any miRNA-regulatory functionality has great therapeutic potential. In animals, miRNAs are first expressed by genomic bodies called RNA transcripts called primary miRNAs (pri-miRNAs). It is transcribed by rnA polymerase II and forms a hairpin structure. In the nucleus, the dsRNA-specific ribonuclease Drosha acts on the pri-miRNA to a shorter length of about 70- to 100-nucleotide, called the stem-loop structure of the pre-miRNA, and then possibly Exportin-5 ( Exp5) Output it to the cytoplasm. (γί, et al. Genes Dev. 17:3011-3016 (2003)). In the cytoplasm, members of the Dicer' RNase III ribonuclease family cleave the pre-miRNA into a double-stranded guide/passenger (miRNA/miRNA*) duplex with a 3' overhang at the two ends. The two strands of the miRNA duplex are often mismatched in their sequence due to incomplete complementation, and when separated, the mature miRNA 'in many cases, between about 19 and 23 nucleotides long, is RNA-induced silenced Complex (RISC) or similar protein complexes are bound. RISC is also a protein complex that can cause target-specific mRNA degradation by small or short interfering RNA (siRNA) vectors. At present, the sensible miRNA is integrated into the RISC complex and binds to messenger RNA (mRNA) molecules with even complementary but substantial complements. . Passenger strands miRNA*, degradable. Transcription of the mRNA bound by the miRNA-RISC complex is then inhibited, resulting in reduced performance of the corresponding gene. In some cases, the bound mRNA is cleaved or de-adenylated and degraded. For a particular miRNA, a single precursor contains more than one mature sequence. In the other examples of 5 15 201238973 'multiple precursor miRNAs contain the same mature sequence. The terms "protein" and "polypeptide" are used interchangeably herein and refer to a peptide linking chain of any amino acid, irrespective of length or post-translational modification. Proteins (including protein derivatives, protein variants, protein fragments, protein fragments, protein epitopes or protein domains) useful in the present invention may be further modified by chemical modification. Such methods, such as chemically modifying polypeptides, include other chemical groups than native amino acids. Examples of such other chemical groups include, without limitation, glycosylated amino acids and squaric acid amino acids. A chemically modified polypeptide can provide advantageous properties, such as one or more to enhance stability, increase biological half-life, or increase water solubility, as compared to the original polypeptide. Chemical modifications suitable for use with the variants of the invention include, without limitation, PEGylation, glycosylation of the non-glycosylated parent polypeptide, or modification of the glycosylation in the parent polypeptide. As used herein, the term "variant" is understood to mean a polynucleotide or protein which differs in the length or sequence of one or more changes from the polynucleotide or protein from which it is derived. A polypeptide or polynucleotide of a derivative protein or nucleic acid variant is also referred to as a parent polypeptide or polynucleotide. The term "variant" includes "fragments" or "derivatives" of the parent molecule. Typically, a "fragment" is smaller in length or size than the parent molecule, and a "derivative" has one or more differences in sequence compared to the parent molecule. Also contemplated are modified molecules including, for example, but not limited to, post-translationally modified white (eg, glycosylation, biotinylation, phosphorylation, ubiquitination, palmitoylation or proteolytic lytic proteins and modified nucleic acids such as thiolated DNA) The term "variant" also encompasses mixtures of different molecules such as, but not limited to, RNA-DNA hybrids. Typically, the system is constructed by humans 16 201238973 = rutting by genetic engineering, and parent polypeptide or multinuclei Glycosylate is bis = biotin or polynuclear pure. However, it should be understood that the receptor of Tiancaicheng also covers the term "variant" as used herein. In addition, it can be used in the present invention to derive from the parent molecule. a substance, ortholog or paralog, or derived from an artificially constructed variant, the restriction being that the variant has at least one biological activity of the parent molecule, ie, functional activity. Alternatively or additionally, As used herein, a "variant" may be homologous to a particular degree of sequence from a parent polypeptide or a parent polynucleotide derived therefrom. More precisely, the protein variant and its parent in the context of the present invention The polypeptide has a sequence identity of at least 8%. The polynucleotide variants of the invention herein have at least 8% sequence identity with their parent polynucleotide. The term "at least 8% homologous sequence identity" is used throughout the specification. Reference to polypeptide and polynucleotide sequence comparison. This term preferably refers to at least 8%, at least 81%, at least 82% 'at least 83%, at least 84%, with respect to an individual reference polypeptide or an individual reference polynucleotide. At least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91°/' at least 92%, at least 93%, at least 94%, at least 95%, at least 96%' At least 97% 'at least 98%, or at least 99% sequence identity. The similarity of nucleotide and amino acid sequences, ie the percent sequence identity, can be determined by sequence alignment. These alignments can be several Algorithms known in the art are carried out, preferably by the mathematical algorithms of Karlin and Altschul (Karlin & Altschul (1993) 90: 5873-5877), with hmmalign (HMMER package, http://hmmer.wustl. Edu/) or by CLUSTAL algorithm 17 201238973 (Thompson, JD, Higgins, D. G & Gibson, TJ (1994) Nucleic Acids Res. 22, 4673-80) can be found, for example, at http://www.ebi.ac.uk/Tools/clustalw/ or at http://www.ebi.ac. Uk/Tools/clustalw2/index.html or available at http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/N PSA/npsa_clustalw.html. The preferred parameters used are system default parameters, which are set at http://www.ebi.ac.uk/Tools/clustalw/ or http://www.ebi.ac.uk/Tools/clustalw2/index. Html. The order of sequence ij consistency (sequence pairing) can be calculated using, for example, BLAST, BLAT or BlastZ (or BlastX). A similar algorithm is incorporated into the BLASTN and BLASTP programs of Altschul et al. (1990) J. Mol. Biol. 215: 403-410. The BLAST polynucleotide search was carried out in a BLASTN program with a score = 100 and a word length = 12 to obtain a polynucleotide sequence homologous to the nucleic acid encoding mir-22. The BLAST protein search was carried out in a BLASTN program with a score = 50 and a word length = 3 to obtain an amino acid sequence homologous to mir-22. In order to obtain a comparative vacancy alignment, Gapped BLAST as described in Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402 was used. When using the BLAST and Gapped BLAST programs, the default parameters for individual programs are used. Sequence alignment analysis can be supplemented by established homology localization techniques such as Shuffle-LAGAN (Brudno M., Bioinformatics 2003b, 19 Suppl 1:154-162) or Markov random fields. When the percentage of sequence identity is indicated in this application, these percentages are calculated relative to the full length of the longer sequence unless otherwise indicated. 201238973 The term "hybridization" can also be used as a measure of sequence identity or homology between two nucleic acid sequences. The nucleic acid sequence encoding the miRNA or a portion thereof can be used as a "hybridization probe" according to standard hybridization techniques. Hybridization of the mir_22 probe to the DNA or RNA of the test source is an indicator of the presence of mir-22 DNA or RNA in the test source. Hybridization conditions are known to those skilled in the art and can be found, for example, in Current Pr〇t〇c〇ls in Molecular Biology, John Wiley & Sons, N. Y., 6.3.1-6.3.6,

1991. "Moderate hybridization conditions" are defined as the equivalent of hybridization in 2 χ sodium/sodium citrate (ssc) followed by alt ssc, 〇 1 〇 /. The SDS is cleaned at 50 °C. "High stringency conditions" are defined as being relatively hybridized at 45 ° C in 6 氯化 sodium chloride / sodium citrate (SSC) followed by 02XSSc, 〇 1% SDS at 65 °C. The term "organization" as used herein refers to a cluster of cells of the same origin that consistently perform a particular function. Examples of tissues include, but are not limited to, bone, cartilage, connective tissue, muscle tissue, nerve tissue, and epithelial tissue. A variety of tissues work together to form an organ for performing a specific function. Examples of organs include, but are not limited to, joints, bones, muscles, blood, brain, heart, liver, kidney, stomach, and skin. For example, the joint system is formed by different tissues such as, but not limited to, bone, cartilage, synovium, muscle, ligament, and tendon. The term "joint" as used herein refers to the location where two or more bones are touched. This term can refer to a movable joint or an immovable joint. Alternatively, the joint may be a fibrous joint in which the bone is attached by a dense collagen-rich connective tissue; or a cartilage joint in which the bone is attached by cartilage. The joint can also be a synovial joint, in which the bone is not directly connected but has 201238973, she (4) (four) with the #σ tendon-linked articular cartilage = cyst =. Fine _ includes (but is not limited to) ball joints ‘, off or shoulder lang 1 joint and plane joints, such as elbows, knees, 骒« finger and toe joints. The stomach, and the pivot, such as the sacral spine and the pivotal "organic state" or "state of the organization" are used interchangeably in the text. The state of the tissue may be characterized by the morphology rejected by such tissue or may be characterized by the performance of - or a plurality of specific molecules, such as, without limitation, peptides, proteins, and nucleic acids, or combinations thereof. If the condition of the organization is similar to disease-free or injurious and sufficient to perform its specific function, the state of the organization can be considered "healthy" or "normal". If the tissue is unable to perform its function due to illness or injury, the state of the tissue can be visualized. It is "degraded", "disease" or "abnormal". In addition, if the form of the group 2 or its molecular expression pattern is "changed" or "changed" when compared with the normal tissue, the state of the organization can be regarded as "degradation", "disease" or "exception". Therefore, the pattern of organization or the pattern of expression of specific molecules in an organization can be used as an indicator of organizational status. Indicators of tissue status include (but do not) tissue degradation, such as cartilage degradation, bone degeneration and synovial degeneration, tissue inflammation such as cartilage inflammation or synovial inflammation, tissue remodeling such as cartilage remodeling, hardening, fluid accumulation or hyperplasia Tissues such as hyperplasia of wound healing processes, cyst formation or cancer. The terms "disease" and "disease" are used interchangeably herein and refer to abnormal conditions, particularly abnormal conditions such as illness or segregation, in which a tissue, organ or individual is no longer able to fully perform its function. Typical 20 201238973 Ground, but not necessarily, the disease system is associated with a specific symptom or symptom that indicates the onset of the disease. Therefore, the presence of this symptom or symptom can be an indicator of disease in a tissue, organ or individual. These changes in symptoms or signs can be indicators of the progression of the disease. The progression of the disease is typically characterized by an increase or decrease in the shape or sign of the "exacerbation" or "improvement" of the disease. Aggravation of a disease is characterized by a reduced ability of the tissue, organ, or individual to fully perform its function, and the "improvement" of the disease is typically characterized by an increased ability of the tissue, organ, or individual to fully perform its function. A tissue, an organ, or an individual at a risk of developing a disease is in a healthy state, but shows the potential for the disease to appear. Typically, the risk of developing a disease is associated with early or weak signs or symptoms of such diseases. In this case, the occurrence of the disease can still be prevented by treatment. Examples of diseases include, but are not limited to, traumatic diseases, inflammatory diseases, infectious diseases, skin symptoms, endocrine diseases, intestinal diseases, neurological disorders, joint diseases, genetic disorders, autoimmune diseases, and various types of cancers. The term "joint disease" as used herein refers to an abnormal condition of the joint, especially due to injury, trauma, degeneration, inflammation, infection or autoimmune factors. Joint diseases include rheumatoid arthritis (RA), ankylosing spondylitis (AS), juvenile idiopathic arthritis (JIA), gout, infectious arthritis, dry arthritis, and osteoarthritis (OA), Cancers such as chondrosarcoma, osteosarcoma, fibrosarcoma and multiple myeloma, tendonitis, bursitis, fractures and cartilage or bone damage. A "symptom" of a disease is a disease indication that is apparent to a tissue, organ, or individual having the disease, and includes, but is not limited to, pain, weakness, tenderness, strain, stiffness, and spasm of the tissue, organ, or individual. The "symptom 21 201238973 mega" or phlegm of the disease includes (but is not limited to) changes or changes, such as the presence, absence, increase or increase, reduction or reduction of specific W such as biomarkers or molecular markers, or the occurrence of symptoms Or increase. a The term "indicator" as used herein refers to a symptom or signal of a symptom, or is used to monitor symptoms. By "symptom" is meant the biological state of a cell, tissue or organ or the health and/or disease state of an individual. The indicator can be a molecule, including but not limited to, the presence or absence of a peptide, protein, and nucleic acid, or can be a change in the amount or pattern of such a molecule in a cell or tissue, organ, or individual. An indicator can be a sign of the onset, occurrence, or occurrence of a disease in an individual, or a further progression of the disease. The indicator can also be the death of the disease in the individual. For example, indicators related to joint diseases such as 〇A include, but are not limited to, transcription factors such as Sox-5, Sox-6, Sox-9,

Nfatl, pitxl, FoxO, HIF2A, SAF-1, RUNX-2, cytokines such as IL-Ιβ, IL-2, IL-7, IL_12, IL-18, GM-CFS, TNF-ci, NF-kB and INF -γ, phosphatase such as alkaline phosphatase (ALP), protease such as metalloproteinase (eg MMP-1, MMP-2, MMP-3, MMP-8, MIyIP-9, MMP-13, MMP-14), protein Polysaccharidase (eg ADAM-8, ADAM-12, ADAM-TS4, ADAM-TS5) and hemi-prolinase [eg cathepsin B, cathepsin K, cathepsin S) ), calpain, caspases-3, caspase-9, tissue inhibitors of metalloproteinases (eg TIMP-1, TIMP-2, TIMP-3) , TIMP-4), extracellular matrix components such as collagen (eg collagen II, VI, IX, X, XI), proteoglycan (eg sulfur 22 201238973 acid heparin, chondroitin sulfate, sulfuric acid) Keratin), aggrecan, elastin, hyaluronic acid, fibronectin, vasopressin, CD-RAP, CDMP, chondromodulin, and pleopoi piei〇tr〇phin). Typically, in tissues, organs or individuals with arthritis, particularly OA, one or more of these indicators will be higher or lower than tissues, organs or individuals that do not have arthritis. For example, compared to tissues, thieves, or individuals who do not have θΑ or are at risk of developing sputum, the extracellular matrix components collagen Η and X, and proteoglycans and CD-RAP are suffering from convulsions or are occurring. The risk of tissue, organs or individuals will be lower. In addition, compared with 〇A or tissues, organs or individuals not at risk of developing 〇A, the amount of factor S〇x9 and the tissue inhibitors of metalloproteinases ΤΙΜΡ-1 and ΤΙΜΡ-4 are in QA or in QA The risk of tissue, organs or individuals will decrease. Conversely, the cytokine positive-丨, il_6 spear TNF ct, and the metalloproteinases mmP-1, MMP-2, MMP-3, and MMP_9 are compared to tissues, organs, or individuals that do not have 〇A or are at risk of developing OA. The amount of phosphatase ALp is increased in tissues, organs or individuals with sputum A or at risk of developing sputum A. In the context of the present invention, a preferred indicator of tissue state or disease is miRNA' which includes, but is not limited to, MU21, (10).22, mir l4〇, =r-146a and mir_199a. Individual _22 is an excellent indicator of diseases such as joint dogs, especially OA. M. As used herein, "individual" means any benefit that can be obtained by the present invention. Preferably, the system is selected from the group consisting of: laboratory animals (eg, mice, atmosphere or rabbits), 23 201238973 domestic animals (including, for example, guinea pigs, rabbits, horses, scorpions, cattle, cotton goats, pigs) , chickens, ducks, camels, cats, dogs, tortoises, tortoises:: lizards) or primates include (black, scorpion (four), large scorpion or super good, the "individual" is human. "Sample" or "related sample" may be used interchangeably. A part or fragment of a tissue, organ or individual, typically less than an organ or an individual, intended to represent the entire organization, organ or individual - analysis, sample health supply (4) Information on the state of the tissue, or organ or state of disease. Examples of samples include, but are not limited to, fluids such as blood, serum H synovial fluid, urine, saliva, and lymphoids = or solid samples such as tissue extracts, cartilage , bone, synovial membrane, soft ' = connective tissue. Additional sample examples are cell culture or culture = (but not limited to) cartilage, bone, synovium, visual cells, cartilage? Tianyue; foster cells, chondrocytes, Synovial cells, bone cells Breaking 'cells, osteoblasts and/or inter-leaf stem cells. The analysis of the feeding month, field, and field samples can be based on visual or chemical basis. Includes (but is not limited to) morphological evaluation of the sample, 2: individual Microscope development or radiography Sweeping seedlings = (2) Detecting the presence or absence of a specific indicator or quantity: The term "reference sample" as used in the text refers to a sample of the sample analyzed in the same way. : The data is compared. The reference sample is used to provide the target; the information obtained in this book can be evaluated. The reference sample can be derived from healthy or normal tissues, organs or a body, thereby providing a healthy organization, The state of the organ or the usual reference sample and the shape of the relevant sample are positive. For the occurrence or presence of the disease or the disease or disease, the difference may be based on the tissue or ticket from which the sample may be derived from abnormal or Luo disease. In this way, the tissue status of the rickets is accurate or = J disease risk is low or no disease or the disease or disease 4 reference sample can also be derived from the same sample: the collection of points Tissue, organ or individual. The difference between the state of the earlier collection and the state of the relevant sample> The indicator--that is, the disease that changes with time is improved or aggravated: if there is a time gap between the sample and the relevant sample, reference Second > or at a later time point. This time period can be years (eg ^^^4'5, 10, 15, 20, 25, 3〇, 35, 4〇, 45, 5〇6〇, , 8〇, 90, 100 years), month (Bu 2, 3, 4, 5, 6, 7, 8, 9, 1〇, 1 Bu 12 months), week (for example, Bu 2, 3, 4, 56, 7, and 8 Sundays (for example, Bu 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 9〇, 1〇〇, 2〇 〇, 3〇〇, 4〇〇, 5〇〇日), hours (1, 2, 3, 4, 5, 6, 7, 8, 9, 1〇, η, 12 hours), minutes (for example 1, 2, 3, 4, 5, 1〇, 15, 2〇, 25, 30, 35, 40, 45, 50, 60 minutes, or seconds (for example! , 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60 seconds). The term "low" or "decreasing" means, such as mir-22, means that the amount of this indicator in the sample is less than 25 201238973 compared to the reference or reference sample. The indication of the term "raised" or "increased" is = in comparison to the reference (4) or reference sample, in the county

滑 5 ^^iRNA is the same as the synovial fluid of an individual who does not have 〇A, and the increased amount in the 'sample (eg, synovial fluid) indicates the presence or susceptibility of 〇A or the occurrence of convulsions. The possibility increases. In the reference sample, it can be "differently treated" with the relevant sample. If the two samples are treated in a substantial two way except for a single factor. This single factor includes, but is not limited to, the ::, concentration, or temperature of the storm. Therefore, the relevant sample may be exposed to the sample (4), or may be exposed to the inter-parameter or may be exposed to a different temperature than the reference sample. The quantity that can be exposed is not limited to 2 times, 5 times, 10 times, 20 times, 30 times, 4 times _ times, + 〇, 100-fold and/or 1000-fold increase or decrease in dose. Phase ° _

: Different times of exposure include (but are not limited to) more than 2-fold, 5_times, 1〇_倍, 2〇_倍, 3〇_倍, 4〇 J when exposed to the reference sample. , 100-times and/or 1000-times. Related samples can be violent ^ compared to the reference sample exposure temperature 増 or drop - double, 5 〇 1 〇 _ times, 20-times, 3 〇 · times, 40_ times, 5 times times, • times and / or 1000-times . In a non-limiting example, the correlation is exposed to a concentration of material that is 1 〇 times greater than the reference sample. The tube phase is then analyzed to determine the beneficial or detrimental effect of the increased concentration of the substance on the relevant sample. : The technician should be aware that this example is subject to the necessary modifications to meet different concentrations of 201238973 degrees, different exposure times, and/or different exposure temperatures. The term "agonist" as used herein refers to a substance that causes the action of a tissue, organ or individual, such as receptor signaling, gene expression, protein incorporation, and protein degradation. Typically, an agonist acts by triggering a specific reaction by binding to the active or ectopic binding of the acceptor molecule. Examples of agonists include, but are not limited to, nucleic acid molecules, such as mRN Ago miRNAs, or proteins such as hormones, cytokines, growth factors, neurotransmitters, and transcription factors. The term "antagonist" as used herein refers to a substance that blocks agonist repulsion. Typically, an antagonist acts by ectopic binding to the active site of the receptor molecule or to a binding site that is not normally involved in the regulation of receptor activity. Typically, the antagonist changes the binding site of the agonist in a manner that the structure defines the incorporation of 'in competition with the agonist, or in such a way that the agonist does not cause the effects normally caused by it. Antagonistically, according to the interaction of the antagonist-receptor complex, 4/3 is inverse or irreversible. Examples of antagonists include a scorpion, such as an siRNA or miRNA, or a protein such as a female hormone, a growth factor or a neurotransmitter, an image, or a term "mimetic" such as a target molecule such as a tissue, an organ, or a target line of the target line (#: role, such as receptor signal transmission, base " substances that are degraded by the action/or antagonist white. Therefore ^ structure, egg * synthesis and eggs such as agonists or antagonists) structure The target molecule may not be simulated (eg, by a specific reaction, for example, by (4) being the same (ie, by using at least its active site or the activity of a heterologous agonist or antagonist 201238973 typically, the simulated system is Individual agonists or antagonists have the same function, i.e., functionally equivalent. For example, a mimetic of mir_22 is administered at least its towel-type 22 activity, has a _22 function, and/or mimics mir-22 action. Substance 5 My "speech" as used herein refers to a molecule that binds to one or more specific molecules, such as peptone nucleus. Signal 4, 'knife can be used as an agonist or antagonist, including (Do not The nucleic acid is a sub-like 'siRNA or miRNA, or a protein such as a hormone, a cytokine, a growth factor or a neurotransmitter, an antibody or a transcription factor. The receptor can be localized in the cell membrane, in the cytoplasm and/or in the intracellular compartment. As used herein, "treatment" of a disease or condition means achieving one or more of the following: (a) reducing the severity of the condition; (b) limiting or preventing the symptomatic characteristics of the condition being treated; (c) inhibiting the symptomatic characteristics of the condition being treated (d) limiting or preventing the recurrence of the disease in an individual previously suffering from the condition; and (e) limiting or preventing the recurrence of symptoms in a patient previously having symptoms of the condition. As used herein, "prevention" of the disease or condition Or "preventing" means preventing the disease or condition in a patient. "5" "medicine", "pharmaceutical" and "drug" are used interchangeably herein to mean the use of a tissue, or a tissue or A substance or combination of substances. "Pharmaceutically acceptable" means approved by the federal or state government or listed in the US Pharmacopoeia or other general use for animals (more specifically The term "active ingredient" means a substance that has a biological activity in a pharmaceutical composition or formulation, that is, a pharmaceutical value. The composition of the drug is one or more Or the active ingredients which act independently. The active ingredient can be adjusted to be neutral or _. The medicinal oxime includes salts formed with _amino group, such as salts of sarnic acid, acetic acid, oxalic acid, tartaric acid, etc. And salts formed by the group such as, but not limited to, derived from sodium, potassium, bismuth=iron, isopropylamine, triethylamine, 2-ethylaminoethanol, diacid, Puka The term "preparation" and "composition" are intended to include both active compounding and encapsulating materials as a formulation for providing a capsule, and the active component of the carrier is surrounded by a carrier. The term "carrier" as used herein refers to pharmacologically, for example, but not limited to, a diluent, excipient or vehicle, and a potent ingredient. Such medicines may be liquid or solid = system including (but secret) sterile (iv), such as saline solution f = including, animal, plant or synthetic sources such as peanut oil, mineral oil, sesame oil and the like. The saline solution and the glycol solution can also be used as a liquid carrier, especially when the solution is used for intracavitary administration of the pharmaceutical composition, the saline preparation and the scorpion 1 preparation are suitable for oral administration. It also includes bulk and ingot solid excipients: also bag, suppository and dispersible granules. y A variety of substances may also be used as a diluent, a flavoring agent, a preservative, a preservative, a tablet disintegrating agent or an encapsulating substance. In the powder, the excipient is preferably a finely powdered solid which is admixed in a mixture of finely divided active ingredients. In the lozenge, the active ingredient of the present invention is mixed with a carrier having the desired binding properties in a suitable ratio and compressed into a desired shape and size. The powders and lozenges preferably contain from 5% to 80%, more preferably from 20% to 70%, of the active compound. Suitable pharmaceutical "excipients" include starch, glucose, lactose, sucrose, gelatin, pectin, dextrin, malt, rice, fun powder, chalk, tannin, magnesium carbonate, sodium stearate, magnesium stearate Glycerin monohydrate, talc, sodium carbonate, tragacanth, methylcellulose, sodium carboxymethylcellulose, skim milk powder, glycerin, propylene glycol, water, ethanol, low melting wax, cocoa butter and the like. For the preparation of suppositories, a low melting wax such as a mixture of fatty acid glycerides or cocoa butter is first melted and the active ingredient is uniformly dispersed therein, e.g., with stirring. The melted homogeneous mixture is then poured into a convenient size mold, allowed to cool, and solidified accordingly. Examples of suitable pharmaceutical carriers are also described in ''Remington® Pharmaceutical Sciences' by EW Martin. The term "adjuvant" refers to the addition, stimulation, activation, enhancement or modulation of activity on a composition at the cellular or humoral level. The immune response agent of the component, such as an immunological adjuvant, stimulates the immune system's response to the actual antigen, but does not itself have immunological effects. Examples of such adjuvants include, but are not limited to, inorganic adjuvants (eg, inorganic metal salts such as aluminum phosphate or aluminum hydroxide), organic adjuvants (eg, saponin or squalene), oil-based adjuvants (eg, Freund's complete adjuvant and Freund's incomplete adjuvant), cytokine 201238973 (eg IL-Ιβ, IL-2, IL-7, IL-12, IL-18, GM-CFS and INF-γ) , microparticle adjuvants (eg, immuno-stimulating complexes (ISC〇MS), microlipids or biodegradable microspheres), virions, bacterial adjuvants (eg, single-acidified lipid A or cell wall purine peptides), Synthetic adjuvants (eg, nonionic, segmented copolymers, cell wall purine peptide analogs or synthetic lipids VIII) or synthetic polynucleotide adjuvants (eg, polyarginine or polyserine). As used herein, "administering" includes in vivo administration, as well as direct administration to tissues, such as intravenous transplantation, in vitro. In the context of the present invention, oral administration, topical p, skin permeation and/or intraluminal (e.g., intravenous) administration are preferred.有效 The effective amount in the treatment is “a medical agent sufficient to achieve the desired purpose”. The effective amount of the therapeutic agent to be administered will vary depending on factors such as the nature of the agent, the size of the drug delivery, the animal species to which the therapeutic agent is administered, and the purpose of administration, and the effective amount in each case may be determined by a skilled practitioner according to the present technology. The method of establishment is determined by experience. Embodiments of the present invention are provided in the first section of the present invention, in which the mir-22 is found to be accidentally discovered by the genus or the disease η 75 mir Maoming. The external matrix component and the protease (4) tissue (4) or the presence, absence or progression of the disease are indicators of the state of the tissue or disease. Qin 22 has ... or changes to the state of the tissue or the symptoms of the disease. Within the present invention In the text, the second is the progress of the organization is more than the characteristics of the reading of the ginseng 22. The typhoid two It's (four) woven fabrics have different disease states, preferably characterized by ... compared with normal organs 31 201238973 or individual organs Or, compared to the same organ or individual at an earlier time point, which has a different amount of mir-22. In a second aspect, the invention relates to the use of mir_22 as a tissue state or disease indicator. Or the amount of mir-22 is different during the progression, and mir_22 is used as an indicator of the state of the tissue or disease. In the first and/or the first - or - r-vx " In, r 22 is (a) tissue state or disease / Or for) the occurrence of a state change or risk tissue diseases and / or (c) having an individual tissue or disease state change = and / or (d) refers to an individual tissue or target state or stage of progression of the disease. The amount of mir-22 is the amount of expression of mir-22 or the amount of mir_22 present. ^匕' mir-22 performance or mir_22 is present (4) histological =, or disease and / or (b) tissue state change or disease risk and / body with tissue state changes or disease and / or (d An indicator of tissue or progression or individuality in an individual. In the preferred embodiment m"22 is the amount of her 22 in an individual or in an individual sample. Change the implementation of the wealth, this 22 New (four) shows the state of the organization changed = disease, such as organizational status or disease aggravation or improvement. The state of the woven or disease has improved. Target, better risk indicators for the second Shengsheng. The amount of mir_22 changes, ^ physiochemical or disease for individuals with tissue state changes or disease = tr22 increased, also the amount of Zhong Qin 22 changes, such as ^. Furthermore, in the case of individual elevation or decline, the system shows the progress or stage of the tissue status or disease of 2012. Preferably, mir_22 is an indicator of tissue state or disease exacerbation. The amount of imr-u is the state of tissue or disease. The tissue is selected from the group consisting of bone, cartilage, sputum, muscle tissue, nerve tissue, and epithelial tissue. Second, the ::: state is tissue degradation, such as (but not limited to) cartilage degradation, osteophyte, synovial degeneration, tissue inflammation such as cartilage inflammation or synovial inflammation, such as cartilage remodeling, hardening, fluid accumulation or hyperplasia Sexual tissue: for the healing process of the wound healing, cyst formation or cancer. Particularly preferably, the group ς state is related to tissue degeneration or tissue inflammation, and more preferably to soft sputum, synovial degeneration, cartilage inflammation and/or synovial inflammation. Human month is another preferred, mir-22 amount, which is a disease of the joint, such as (but not limited to) arthritis, such as wind-like arthritis (RA), ankylosing spondylitis ( AS), juvenile idiopathic stagnation (JIA), gout, infectious arthritis, dry arthritis and osteoarthritis (OA), cancer such as chondrosarcoma, osteosarcoma, fibrosarcoma and multiple bone tumors , tendonitis, bursitis, fractures and cartilage or bone injury. In a particularly preferred embodiment, the disease is arthritis, and more preferably osteoarthritis. In a third aspect, the invention provides for identification in a subject (a) a change in tissue sorrow, or the presence of a disease and/or Or (b) a method of detecting a change in tissue state or disease and/or (c) and/or monitoring the progress or stage of the state of the tissue or disease, including detecting the amount of mir_22 in the sample. Preferably, it is at the RNA or DNA level to detect mir_22, more preferably via known methods such as, but not limited to, antibodies that bind and/or hybridize to mir-22 RNA or cDNA 33 201238973, Primer or nucleic acid probe. It is straightforward that the amount of 'mir-22' is in the individual or in the individual sample. The car thief is good, the amount of imr-22 is the amount of his _22 or the presence of mir-22 in the individual or individual sample. Preferably, the individual is a mammal, a creeper or a bird. More preferably, the health line is selected by the Xia Shun group of animals: experimental animals (such as mice, rats or rabbits), domestic animals (including, for example, guinea pigs, rabbits, sheep, goats, pigs, chickens, ducks, and , dogs, turtles, tortoises, snakes or gradual fields) or primates, horns, and humans. Particularly preferably, the individual is a human group = a sample of a plurality of solid samples, such as (but not limited to) tissue t, cartilage, bone, synovial membrane, perichondrium, sac, skin and social/monthly, liquid, Material, noodles and lymph. In the preferred embodiment, the job title is selected from the group of Shun Cheng group: the sac, the blood n serum, the urine and the synovial fluid. In particular, the sample is cartilage, synovial membrane, plasma, serum and/or synovial trace 22 by any known method using a specific nucleic acid for use in an acid such as a miRNA that binds to the miRNA in question. Known tools to speculate. Suitable methods include, but are not limited to, poly-linked reaction (PCR) techniques such as reverse transcriptase pCR or sequencing to PCR 'hybridization techniques such as northern blots, in situ hybridization or wafers', immunohistology or immunochemistry Or immunocytochemical techniques, such as too blotting, immunofluorescence or ELISA, mass spectrometry (MS), such as Lc/m high performance liquid chromatography (HPLC), especially ion exchange 201238973 for HPLC after calibration. Detecting the presence of mir_2 in an individual or individual sample is limited to the above-mentioned methods plus / (but not limited to) - or multiple sets of specific detection of mir-22 RNA or cDNA (eg for quantification of RT pCR), one or more nucleic acid probes that are capable of specificity and mib 22 RNA cDNA hybridization under standard conditions (eg for use in northern blot or wafer hybridization techniques), or multiple energies Specific detection of antibodies to mir-22 (eg for immunohistology or immunohistochemistry or immunochemical techniques, such as detection of mir-22 in histological tissue sections or immobilization on suitable carriers such as membranes, wafers, EusA plates) In the other preferred embodiment, the amount of ιη ΰ:·22 in the individual or individual sample is compared with - 参照 reference and/or reference sample. Preferably, the reference system is selected from the group consisting of: a healthy individual, a rickety individual, or an individual earlier or later than the test subject. Additionally or alternatively, the reference is an unorganized condition in which the presence of a disease, an altered state of the tissue, or the presence of a disease, or a representative value of a group, a change in the shape, or an increased or decreased risk of the disease. The white plate sample is preferably shot from a healthy individual, '_individual or from the same individual from the relevant sample. The t reference sample is collected by the individual who is the same as the relevant sample. The reference sample is preferably tied to The time difference between the reference sample and the relevant sample is collected, preferably in years (eg, 2, 3, 4, 5, 201238973 90, 100 years), 1 12 in the month. W, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months), weeks (for example, 1, 2, 3, 4, 5 ln ”, 4, 5, 6, 7, 8 weeks), 曰 (Example 5〇, 6〇, 7〇, 8〇9〇2〇, 25, 30, 35, 40, 45, hours (Bu 2, 3 〇, 100, 2〇〇, 30 〇, 400, 500 days), confusing;;; 5/, 6:7, 8, 9, 10, 1...2—), 40, 4S π 4, 5, 10, b, 20, 25, 30, 35, : 5 20: 2; 6 〇 minutes), or seconds, ^ or alternatively, this Γ, 35, 40, 45, 50, 60 seconds). In addition, or unorganized, it is a reference sample with a representative of a healthy individual, or a representative of a mir-22 that has a change of == or represents a tissue state change or decrease. (4) In the case of 'the reference or reference sample, the shot is born from health. ^ ^ The risk of a change in the state of the tissue or the risk of the disease or the presence of a mir-22 that represents the absence of an unorganized state or the presence of the disease Compared with the reference material, the increase in the amount of _22 with the towel indicates that (a) the tissue state deteriorates or the disease exists and/or (b) the tissue state deteriorates or the disease is tested and/or (e) Deterioration of the state of the organization or progress of the disease. In an embodiment wherein the reference is derived from an individual with a rickets or an individual with an increased risk of developing a tissue state change or disease or representing a change in the state of the tissue or the presence of the disease, a similar mir-22 quantity indicates In the individual (a) there is a deterioration of the tissue state or the presence of the disease and/or (b) an increase in the risk of tissue deterioration or disease and/or (c) a deterioration in the state of the tissue or progression of the disease. In an embodiment, wherein the reference or reference sample is derived from a healthy individual or is associated with a reduced risk of developing a tissue state change or disease, or an individual having a mir_22 amount that represents an unorganized state change or disease present in 201238973 compared to The reference, a similar mir_22 quantity in the relevant sample, shows (a) a change in tissue status or improvement or absence of disease and/or a decrease in the risk of aggravation of the tissue or a decrease in the risk of the disease and/or a deterioration in the state of the tissue. Or the progress of the disease has slowed down. In an embodiment, wherein the reference or reference sample is derived from a healthy individual or has an increased risk of developing a tissue state or a disease or an individual having an amount of mir_22 representative of an unorganized state change or disease present compared to the reference A decrease in the amount of mir_22 in the subject's sample indicates (a) a change in tissue status or improvement or absence of disease and/or (b) a decrease in the risk of developing a tissue condition or disease and/or (c) a deterioration in the state of the tissue or The progress of the disease has slowed down. In an embodiment, wherein the reference or reference sample is derived from an individual with a rickets or an individual with an increased risk of developing a tissue state change or disease or representing a value of a tissue state change or disease, a similar amount of mir-22 The system shows (a) the presence of tissue deterioration or the presence of the disease and/or (b) an increased risk of developing tissue deterioration or disease and/or (c) a deterioration in tissue status or progression of the disease. In an embodiment, wherein the reference or reference sample is derived from a rickety individual or an individual with an increased risk of developing a tissue state change or disease or representing a tissue state change or a disease present value, elevated mir-22 The quantity system shows (a) the presence of tissue deterioration or disease and/or (b) an increased risk of tissue deterioration or disease and/or (c) progression of tissue condition or progression of the disease. In an embodiment, wherein the reference or reference sample is derived from an individual having a disease of 201237 201238973 or an individual having an increased risk of developing a tissue state or disease or representing a change in the state of the tissue or the presence of the disease, the reduced mir The -22 amount indicates that the individual has (a) a change in tissue status or an improvement or absence of disease and/or (b) a decrease in the risk of developing a tissue condition or disease and/or (c) a deterioration in the state of the tissue or a slow progression of the disease. In an embodiment, wherein the § Xuan reference or the reference sample is derived from an individual at an earlier time point that is the same as the related individual, the elevated mir-22-a amount in the relevant sample is not in the 9 Hai individual (a) Deterioration of the tissue state or the presence of the disease and/or (b) an increased risk of tissue deterioration or disease and/or (c) deterioration of the tissue state or progression of the disease. In an embodiment, wherein the reference or reference sample is derived from an individual at an earlier time point that is the same as the relevant individual, the reduced mir-22-a amount in the relevant sample indicates (a) a change in tissue state in the individual or Improved or no disease present and/or (b) decreased tissue risk or decreased risk of disease and/or (c) worsened tissue condition or slow progression of disease. In an embodiment, wherein the reference or reference sample is derived from an individual at an earlier time point that is the same as the related individual, a similar mir-22-a amount in the relevant sample indicates that (a) tissue deterioration occurs in the individual Or a similar risk of disease and/or (b) deterioration of tissue status or progression of disease and/or (c) deterioration of tissue status or disease persistence. In a fourth aspect, the invention provides a method for determining a pharmaceutical dosage for a change in tissue status or for preventing or treating a disease in an individual, comprising the steps of: (a) determining the amount of mir-22 in an individual sample, and determining if necessary The amount of mir-22 in the reference or reference sample, and (b) in accordance with the amount of mir-22 in the relevant sample, as determined by the amount of mir-22 in the relevant sample and reference sample and reference sample 38 201238973, Medical dose. In the context of the present invention, the amount of mi 22 is preferably ligated at the RNA or DNA level to detect 'better via known methods such as, but not limited to, the rmm gene, the gene product and/or An antibody, primer or nucleic acid probe that specifically binds to and/or hybridizes. The sample may be a liquid or a solid, preferably a liquid sample such as, but not limited to, blood, gold, plasma, synovial fluid, urine, = and lymph, and a solid sample is a tissue sample, such as (but not limited to bone, Bone, larvae, perichondrium, sac, skin, and symmetry. The reference sample is preferably produced from a healthy individual, a rickety individual, or from an individual associated with the same. When the reference sample is collected by the same individual as the relevant sample The reference time sample is collected at a later time point than the phase secret. Alternatively or additionally, the reference sample is a healthy individual with a table, or represents a presence or absence of a tissue state change or disease presence, or represents a A change in the state of the tissue or an increased risk of the disease or a reference sample of the amount of mir-22. In a preferred embodiment, the need to maintain or change, ie, to increase or decrease the dose of the drug, is based on the amount of mir_22 in the sample. The decision 'is preferably compared to a reference or reference sample. It is envisaged that in the embodiment where the reference or reference sample is derived from a healthy individual or has a tissue state change or The risk of disease is reduced or with an mir_22dan representing an unorganized state change or disease: and compared to the reference or reference sample, it must be raised in the relevant two books (five) -22 f: 'then decide It is necessary to transfer to a doctor to increase the amount of tissue in the individual or to prevent or treat the disease. It is also envisaged that in the examples, where the reference or reference sample is derived from a healthy individual or occurs with Wind of tissue status or disease = reduced or with an individual representing the amount of mi in the absence of an unorganized state or disease and comparing the reduced amount of mir-22 in the relevant sample compared to the reference or reference sample, Decided to maintain medical dose < Reduce the dose of medicine that is beneficial to the change of tissue status in an individual or to prevent or treat a disease. ', force also envisages 'in the examples' where the reference or reference sample is derived from a healthy individual or with a wind that has undergone a change in tissue state or disease, or with an amount that represents a change in the state of the tissue or the presence of the disease. The individual, and comparing the reference or reference sample, to determine a similar amount of mir_22 in the relevant sample, determines whether the medical dose must be maintained or a medical dose that would favor tissue changes in the individual or prevent or treat the disease. In an embodiment, wherein the reference or reference sample is derived from a disease of the individual = or has an increased risk of developing a tissue state change or disease; = an individual having a value indicative of an altered state of the tissue or the presence of the disease, and The reference or reference sample, which determines a similar amount of rmr-22 in the relevant sample, determines whether the medical dose must be maintained or a medical dose that is beneficial to the change in the tissue state of the individual or to prevent or treat the disease. In an embodiment, wherein the reference or reference sample is derived from a rickety = individual or an individual with an increased risk of developing a tissue state change or disease, or an individual having a value indicative of an altered state of the tissue or the presence of the disease, and comparable. The reference object or the reference sample is measured, and the reduced dose of 201238973 in the relevant sample is determined, and the medical dose must be _(d) or reduced in the individual = text, or prevent or treat the disease. Individuals:: The raw or reference sample is derived from an individual with a rickety with an increased risk or a value greater than the value of the reference or second disease, and is approximately 22决/乂: Hundreds, determine the elevated median state in the relevant sample to change the amount or increase the medical dose that is beneficial to the individual's right sputum* or treatment of the disease. Related Individual 2: Compared with 2: the reference object or reference sample is derived from the individual with or from the reference sample Hu, and compared to the reference to determine the amount of _22 that must be maintained by the doctor, then change or ride or , or increase the amount of medicine that is beneficial to the tissue state of the individual to treat the disease. The relevant individual is the same as the upper or secondary reference or the reference sample is derived from the reference or reference sample, and the point is _ body', and compared with the reference, it is necessary to maintain the reduced amount of Qin 22, then change or prevent 5feV, In or lower the amount of the drug that is beneficial to the tissue state in the individual. The related individuals are the same ^ 1 zhonghai reference or reference sample is derived from the reference or reference sample, ^ early point of the individual, and compared to the reference to determine the need to maintain a similar amount of Mr · 22 in the sample, then The state of the woven state is changed to "washing" or increasing or decreasing the medical dosage of the group in the fifth prevention or treatment of the disease. The invention provides for adjusting the state of the tissue for treatment. A method of medical dose of joint disease, comprising the steps of 201238973: (a) determining the amount of mir-22 in a sample, and (b) determining the amount of mir_22 in one or more reference or reference samples, (c) testing Whether the amount of mir_22 in the sample is different from the amount of mir-22 in one or more reference samples' (d) according to whether the amount of mir-22 in the test sample is related to one or more reference or reference samples The amount of mir-22 is different, and the dose is adjusted. The amount of mir-22 is preferably tied to the RNA or DNA level to better detect the mir-22 by better known means such as, but not limited to, mir-22. Gene, gene product and/or its functionally active variant specificity An antibody, primer or nucleic acid probe of the parent and/or parent. The sample may be a liquid or a solid, preferably the liquid sample is a body fluid sample such as, but not limited to, blood, blood/month, plasma, synovial fluid, urine, Saliva and lymph, and solid samples are tissue samples such as, but not limited to, cartilage, bone, synovium, perichondrium, sac, skin, and connective tissue. In a preferred embodiment, one or more references The sample or reference sample is maintained or changed according to the measured amount of mir_22 in the sample, that is, the dose is increased or decreased. It is envisaged that, in the embodiment, the reference or reference sample is derived from a healthy individual or has an occurrence tissue. The state & or the risk of the disease is reduced or with an amount of mir_22 representing the presence of an unorganized state change or disease, and the amount of mir-22 raised in the relevant sample is determined as compared to the reference or reference sample, The pharmaceutical dosage is then maintained or increased to facilitate changes in the state of the tissue or to prevent or treat the disease in the individual. v In the examples where the reference or reference sample is injected from a healthy individual or with a hair Decreased tissue status or risk of disease or band 42 201238973 Individuals with mir-22 levels representing changes in tissue status or disease, and compared to the reference or reference sample, the relevant sample was measured, low mir- 22, which maintains or reduces the pharmaceutical dosage which is beneficial to the change of the tissue state in the individual or the prevention or treatment of the disease. In an embodiment, wherein the reference or reference sample is derived from a healthy individual or may have a change in tissue state or disease. Risk reduction 戋 = = represents the limb of the mir-22 in the absence of an unorganized state change or disease and compared to the reference or reference sample, the ^mn-22 i ' in the relevant sample is determined to be maintained and lowered Or reducing the amount of the drug that is beneficial to the individual, 'and' '0-like change, or to treat the disease. The reference or reference sample is derived from an individual whose risk of rickets tissue changes or the risk of the disease increases or is greater than the value of the change in the dt or the presence of the disease, and the phase is 22% Similar treatments for the prevention or treatment of diseases in the relevant sample benefit from changes in the state of the tissue in the individual or the secondary or reference sample is derived from the rickets; the risk of the disease is increased or compared to the reference or reference sample or disease; The value of the individual, and the amount of mir-22, then maintain or decrease the measurement to reduce the prevention of the relevant sample or the disease in the (four) body tissue state changes or the stalk derived from the disease with a representative of Yang ^ 43 201238973 Compared to the illuminant or reference sample, the amount of phase mir-22 is determined, then the maintenance or 掸Λ 7 is elevated or pre- (four) treatment of disease state changes in the example where the reference-related individual Individuals at the same earlier time point are better than == holding or increasing the individual's change: == medical dose of the disease. Wenfeiding prevention or treatment of diseases: in the case where the individual of the reference or reference sample is compared with the reference or reference, the sample is reduced to the relevant sample or Decrease the medical condition that is beneficial to the change or prevention of tissue status in an individual: the medical dose of Erguang disease. In the embodiment, the reference substance or the same earlier time point, compared to the second = reference, sample "It is determined that similar mir_2 in the relevant sample maintains, increases or decreases the medical dose that is beneficial to the tissue state in the individual. In a sixth aspect, the present invention provides a method for determining the beneficial and/or deleterious effects of a disease in a substance, comprising the steps of (4) determining the amount of η in the relevant sample, and (b) determining - or more ^ According to the amount of mir_22 in the sample, and (4) detecting whether the amount of mir-22 in the relevant sample is different from that of - or more than mir_22 in the sample or reference sample, where the relevant sample is violent^ The method of the object is different from - or a plurality of reference samples. 'J' 44 201238973 Preferably, the amount of mir-22 is detected at the RNA or dna level, more preferably via known tools such as, but not limited to, the mir_22 gene, the product and/or Functionally active variants specifically bind to and/or heterozygous anti-sputum, primer or nucleic acid probes. The sample may be a liquid or a solid, preferably the liquid sample is a body fluid sample such as, but not limited to, blood, serum, blood pooling, synovial fluid, urine, reading and leaching (10), and the solid sample is a tissue sample, for example (but not Limited to cartilage, bone, synovium, perichondrium, sac, skin and connective ridges and woven. In a preferred embodiment, the beneficial and/or detrimental effects of the substance on the state of the tissue or the disease are determined according to the measured amount of mir_22 in the sample. ^ ^佳地,健—or comparison of multiple reference or reference samples] It is envisaged that in an embodiment, wherein the reference or reference sample is derived from a healthy individual or an individual with a reduced risk of developing a tissue state or (4) or a V representative of an unorganized state change or disease, and is equivalent to The reference substance or the reference sample is determined to have an amount of _22 increased by the relevant sample, and the substance has a detrimental effect on the state of the tissue or the occurrence of the disease. It is also envisaged that in the actual towel, the towel reference or the participating body is derived from a healthy individual or is at risk of having a tissue state change or disease = low or with a mir_22 amount representing the absence of an unorganized state or disease. 'And compared to the reference or reference sample, the amount of decrease in the relevant sample is determined, and the mosquito f has a favorable effect on the tissue state or disease occurrence. It is also envisaged that in embodiments, wherein the reference or reference sample is derived from a healthy individual or carries a risk of developing a tissue state change or disease 45 201238973 reduced or with mi r- 2 2 representing an unorganized state change or disease present The individual of the quantity, and comparing the reference or reference sample, to determine a similar amount of mir-22 in the relevant sample, determines that the substance has no effect on the tissue state or disease occurrence or has only a very limited effect. In an embodiment where the reference or reference sample is derived from a rickety = individual or an individual with an increased risk of developing a tissue state change or disease or may have a value representative of an altered state of the tissue or the presence of the disease, as compared to ° The reference or reference sample is measured in a similar mir 22 in the relevant sample, and it is determined that the substance has no effect on the tissue state or disease occurrence or has only a very limited effect. 〃 In the actual _ towel, where the fine or refractory system is derived from Luo: = body or with the occurrence of tissue state changes or ... or reference samples, determine the relevant sample to reduce the έ έ 该 该 __ status or An individual who has a habit of money, in which a reference or reference sample is derived from an individual with a risk of dying; ^ 较 ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ The effect ^ 物 诚 "has occurred; the relevant Γ Τ琢 Τ琢 或 或 或 或 或 或 或 或 或 或 或 或 或 或 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关 相关The amount of elevated mir_22 in the sample, 46 201238973 determines that the substance has a detrimental effect on the state of the tissue or the occurrence of the disease. In an embodiment, wherein the reference or reference sample is derived from the same earlier point as the relevant individual.豸, comparing the reduced amount of mir_22 in the relevant sample compared to the reference or reference sample, determines that the substance has a beneficial effect on the tissue state or disease occurrence. In an embodiment, wherein the reference or reference sample is derived Self and phase An individual at an earlier point in time at the same time determines that the substance has no effect on the tissue state or disease occurrence or has only a very limited effect compared to the reference or reference sample 'measured to a similar amount of mir-22 in the relevant sample. In a seventh aspect, the invention provides the use of mir-22 in any of the methods of the aforementioned aspects of the invention. Thus, the use of mir-22 is provided in a subject, as detailed above (a) In the presence of a change in state or disease and/or (b) a risk of developing a tissue state change or disease and/or (c) a method of monitoring the state of the tissue or the progression and stage of the disease, including the detection of mir-22 The use of mir-22 is also provided in a method for determining a change in tissue status or a medical dose for preventing or treating a disease in an individual, comprising the steps of: (a) determining the amount of mir-22 in an individual sample, and determining if necessary The amount of mir-22 in the reference or reference sample, and (b) according to the amount of mir-22 in the relevant sample, the medical dose is determined according to the comparison of the amount of mir-22 in the relevant sample and the reference sample and the reference sample as needed. Furthermore, 'mir-2 The use of 2 is contemplated as a method for adjusting a medical dose for a change in tissue state or prevention or treatment of a joint disease, as detailed above - which comprises the steps of: (a) determining the amount of mir-22 in the sample, and (b) Determination of one or more reference or reference samples 201238973 in this mir-22 罝 '(c) test sample for the presence of mir-22 in the sample and the amount of mir-22 in one or more reference samples Different '(d) adjust the dose according to whether the amount of mir-22 in the test sample is different from the amount of mir-22 in one or more reference or reference samples. The use of mir-22 is provided for the determination of substance to tissue. A method for the beneficial and/or deleterious effects of a state or disease occurrence, as detailed above, comprising the steps of: (a) determining the amount of mir-22 in the relevant sample, and (b) determining or measuring or referenced The amount of mir 22 in the sample and (c) the detection of the relevant sample is whether the amount of mir 22 in the relevant sample is different from the amount of _22 in one or the reference sample, wherein the relevant method is Different from—or multiple reference samples. In any of the above-mentioned methods, if the product and/or its functional activity becomes a solid (4), the relevant sample is a body fluid sample. The body sample is _ sample and the liquid group is selected: Α χ , , the tissue sample is composed of the following tissue and the liquid i is the second; the bone capsule, skin and knot serum, plasma, synovial fluid, 】, And in the group selected: blood, in the case, the sample is from the lower = two saliva and lymph. Among the better sacs, blood, blood, blood, and blood, they are selected: cartilage, synovium, medium, sample ossicle, :, urine, and synovial fluid. In a particularly preferred embodiment, the sample is a cell for nourishing blood: month and ' or slippery night. An alternative sample is selected from the group consisting of lower cells, chondroblasts: synovial membrane, bone marrow cells, cartilage soft moon cells, synovial cells, bone cells, 48 201238973 osteoclasts, Osteogenic stem cells, stem cells and/or inter-leaf stem cells. In an eighth aspect, the invention provides a tool for use in any aspect of the invention, and which includes one or more detection mir_22. In the preferred set, and in the case of %, or a plurality of tools for detecting mir 22 are tools for determining the performance of mir 22, and more preferably at the gene and/or RNA level: particularly good, ___ or a plurality of tools consisting of the following: a nucleic acid, preferably DNA or RNA, a peptide and a protein. Preferably, single or multiple antibodies are used. Preferably, the means for detecting πιίι··22 is a naturally occurring nucleic acid such as DNA or RNA or chemically modified nucleic acid complementary to the sequence of rmr-22 and/or its precursor. In a preferred embodiment of the kit, further comprising (a) a container, and/or (b) a data carrier. Particularly preferably, the data carrier includes, for example, but is not limited to, the following: (1) a description of the method for determining the risk of joint disease and/or determining the presence of joint disease and/or monitoring the progression of joint disease' (ii) Detection, preferably in the sample, preferably from the instructions of the tool and/or kit of mir-22 in the individual sample, (out) quality information such as the tool and/or kit batch number used to detect mir_22 Information on the correct storage or operation of the kit, manufacturing or assembly, or expiration or shelf life. A '(iv) information about buffers, diluents, reagents used to detect mir-22 and / or information on tools that detect mir-22, (v) information about the interpretation of the data obtained when performing the above methods for measuring and/or monitoring joint disease progression, (vi) when the application is unsuitable and/or unsuitable Warnings related to possible misunderstandings or erroneous results 'and/or (vii) warnings of possible misunderstandings or erroneous results when using unsuitable reagents and/or buffers. 49 201238973 In a ninth aspect, the invention provides the use of the kit of the eighth aspect in any of the methods of the invention. Thus, the use of the kit is provided for determining the individual, as detailed above (a) changes in tissue status or disease and/or (b) risk of tissue state changes or disease and/or (c) monitoring of tissue status In a method of altering the progression or stage of a disease, it includes detecting the amount of mir-22. The use of the kit is also provided in a method for determining a pharmaceutical dosage for tissue state change or prevention or treatment of a disease in an individual, as detailed above, comprising the steps of: (a) determining the amount of mir-22 in an individual sample. And, if necessary, determine the amount of mir_22 in the reference or reference sample for comparison with the amount of mir-22 in the relevant sample, and (b) in accordance with the amount of mir 22 in the relevant sample, as appropriate, in accordance with the relevant sample and reference The drug dose is determined by comparison with the amount of mir-22 in the reference sample. Furthermore, the use of the kit is contemplated as a method for adjusting a medical dose for tissue state change or prevention or treatment of joint disease, as detailed above, comprising the steps of: (a) determining the mir-22 in the sample. (b) determining the amount of mir-22 in one or more reference or reference samples, and (c) detecting whether the amount of mir_22 in the sample is related to the amount of mir-22 in one or more reference samples. Different, and (d) according to whether the amount of mir_22 in the relevant sample is different from the amount of mir_22 in one or more reference or reference samples, the dose of medicine is withered. The use of the kit is also provided in a method for determining the beneficial and/or detrimental effects of a substance on the state of the tissue or the occurrence of a disease, as described above, which comprises the following steps: (the determination of the amount of mir_22 in the relevant sample and (b) Measuring the amount of mir_22 in one or more reference or reference samples and (c) examining whether the amount of mir_22 201238973 in the relevant sample is different from the amount of mir_22 in one or more reference or reference samples, Wherein the related sample is exposed to the substance in a different manner than the one or more reference samples. In a tenth aspect, the invention, as detailed above, in the method of any aspect of the invention, provides one or more for detecting mir A nucleic acid of a -22 gene, a gene product or a functionally active variant thereof. In a preferred embodiment, the nucleic acid is a naturally occurring nucleic acid such as DNA or RN A or chemically modified. Preferably, the nucleic acid is composed of the following Selected from the group: nucleic acid probe, polyaluminum or peptide nucleic acid (pna), microRNA (miRNA), small interfering RNA (siRNA), locked nucleic acid (LNA), primer of polymerase chain reaction (PCR), anti Transcription (RT) The primer and the primer for DNA sequencing. The excellent 'this nucleic acid has strong binding to mir-22. Therefore, an exemplary LNA of about 8 nucleotides is suitable for detecting mir-22, as long as this sequence It is unique in the overall microRNA sequence. In an eleventh aspect, the invention, as detailed above, is provided in a method of any aspect of the invention for providing a mir-22 gene, a gene product, and a functional activity thereof a peptide, polypeptide or protein labeled on a variant and/or microRNA. In a preferred embodiment 'the peptide, polypeptide or protein is a protein ligand, preferably an antibody, fragment or derivative thereof, (darpin) or anti-alcoal, or the polypeptide or peptide is a probe, preferably a mass spectrometric probe. In a preferred embodiment, the protein ligand is a recombinantly produced antibody and, if appropriate, Modified 'for example, a buccal antibody, a humanized antibody, a multifunctional antibody, a bispecific or oligo specific antibody, a single antibody, and a F(ab) or F(ab)2 fragment (see, for example, EP-B1-0) 368 684, 51 201238973 US 4,816,567 , US 4,816,397 , WO 88/01649 , WO 9 3/06213 or WO 98/24884). Additionally or alternatively, the classical antibody protein backbone for anti-mir-22 is used as a protein ligand, for example, lipoalin-based anti-carrier protein (Beste et al. Human (1999) Proc. Natl. Acad. Sci. USA, 96, 1898-1903). The natural ligand binding site of lipoprotein, such as retinol binding protein or post-biliary binding protein, can be altered, For example, the "combined protein design" method, in which the system binds to a selected incomplete antigen, is conjugated to mir-22 (Skerra, 2000, Biochim. Biophys. Acta, 1982, 337-50). Other known protein backbones can be used as an alternative to antibodies for molecular assays (Skerra (2000) J. Mol. Recognit., 13, 167-187). In a twelfth aspect, the invention provides the use of the nucleic acid of the tenth aspect of the invention, and/or the peptide, polypeptide or protein of the eleventh aspect of the invention, in a method of any aspect of the invention. In a preferred embodiment, the nucleic acid is used in the form of a naked, transgenic vector or complexed with a liposome or gold particle. Examples of transgenic vectors are viral vectors, such as adenoviral vectors or retroviral vectors (Lindemann et al. (1997), Mol. Med., 3, 466-76; Springer et al. (1988) Mol. Cell., 2, 549 -58). Complexes with liposomes typically achieve very efficient transfection, particularly skin cells (Alexander and Akhurst, 1995, Hum. Mol. Genet. 4: 146-a79-85). In lipofection, a monolayer lipid system consisting of cationic lipids is prepared by ultrasonic treatment of the microplast suspension. The DNA is ionically bound to the surface of the liposome in such a manner that the ratio of the total charge positive charge and all the plastid DNA lines are combined by the liposome. Except for Feigner, p. L. et al. (1987), Proc. Natl. Acad. 52 201238973

Sci USA, 84, 7413 - 7414 used in the lipid mixture of DOTMA (1,2-dioleyloxypropyl-3-tridecyl ammonium bromide) and DOPE (dioleylphospholipid thioglycolamine) There are many synthetic lipid preparations and their efficacy in transfecting various cell lines (B ehr et al. (1989) Proc. Natl. Acad. Sci. USA, 86, 6982-6986; Zhao and Huang (1991) ), Biochim. Biophys. Acta, 1189, 195-203; Feigner et al. (1994) J. Biol. Chem., 269, 2550-2561). Examples of lipid formulations are DOTAP N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium sulfate or DOGS (di-octadecylamine) Glycinel spermine). An auxiliary substance that increases the transfection of a nucleic acid into a cell can be, for example, a protein or peptide that binds to DNA, or a synthetic peptide-DNA molecule that enables the nucleic acid to be transported into the nucleus of a cell (Schwartz et al. (1999) Gene Therapy 6:282; Brand6n et al. (1999) Nature Biotech., 17, 784). Auxiliary substances also include molecules that release nucleic acids into the cytoplasm of cells (Planck et al. (1994) J. Biol. Chem" 269, 12918; Kichler et al. (1997) Bioconj. Chem, 8, 213) ' or for example, lipoproteins (uhlmann and Peyman (1990), supra). In addition, a particularly suitable form can be obtained by coating the above-mentioned nucleic acids on gold particles and blasting them into tissues or cells using so-called genes (Wang et al. People (1999) J.

Invest. Dermatol. 112:775-81, Tuting et al. (1998) J. Invest. Dermatol. 111:183-8). In a twelfth aspect the invention provides the use of the mir-22 or mir-22 gene or a functionally active variant thereof as a target molecule for the discovery of a mir-22 antagonist or mimetic thereof. In a preferred embodiment, the mir-22 or 53 201238973 is contacted with soil: see: ί : functionally active variants and experimental combinations directly or indirectly or detecting test compound fine-22 or Qin 22 gene ρρ二二The compound is a chemical score*, for example (but not the same & 7.: organic compound, lipid, carbohydrate, peptide, : 25 two SI has 1 scoop to about 8 amino acids' especially There are 10 receivers and oligos, preferably with about 10 to about 90 cores with 15 to fibrils. Particularly good for small chemical groups of about 15^^·laboratory synthesis Or, it is a non-polymerizable organic compound having a knives of about gram of gram, which is preferably from 400 g/m to 1000 g/mole. The test compound changes the amount of mir-22, for example, increasing or decreasing the amount of expression or the presence of 22. The test compound having a low mir-22 amount in the context of the present invention is particularly preferred. In the fourteenth aspect of the present invention, A method of screening for a mire 22 antagonist mimetic comprising the steps of: (4) providing a mir22, 22 gene, and (b) providing a test compound And (c) measuring or speculating the effect of the test compound on the mir-22 or mir-22 gene. In a fifteenth aspect of the invention, there is provided a mir for tissue state alteration or prevention or treatment of joint disease. An antagonist or a mimetic thereof. In the context of the present invention, a mir-22 antagonist or mimetic thereof can be any, low or inhibit mir-22 function or reduce the extent or presence of mir-22 expression = molecule or composition. Examples include (but not limited to): 1. Nucleic acids, such as nucleotides, oligoribonucleotides, especially dsRNA, ssRNA, siRNA, miRNA, shRNA, etc. known in the art, 2. Lifting resistance or protein , for example, destabilizing or inhibiting the protein of miRNA function 54 201238973, an antagonist antibody or fragment thereof or a transcriptional antagonist of the indicated miRNA, and/or 3. a small molecule compound with antagonism. Alternatively or additionally The antagonist of the present invention may be in the form of a crude or pure natural product extract. The extract may be prepared according to standard procedures such as water and/or alcohol and/or organic solvent extraction, and/or column chromatography. And/or by animal, plant or microorganism Sources such as snake venom, leaves or microbial fermentation broth precipitation. Another aspect of the invention is the use of the antagonist or mimetic thereof for the treatment of joint diseases, particularly degenerative arthritis such as osteoarthritis. Preferably, mir -22 antagonists or mimics thereof are used to treat pain 'particularly to reduce joint pain in degenerative joint diseases. In addition, mir-22 antagonists are used in the manufacture of pharmaceuticals for the treatment of joint diseases and/or for treatment as shown above Joint pain. In a sixteenth aspect of the invention, a medicament comprising a mir-22 antagonist or a mimetic thereof for use in the present invention or for the treatment of joint pain is provided. In a preferred embodiment, the medicament further comprises a pharmaceutically acceptable carrier and/or excipient and, if desired, one or more additional active substances. Additional active substances are effective against the same disease or against different diseases or conditions or symptoms. Thus, additional active substances include such materials which have a beneficial effect on the treatment of joint diseases and/or the treatment of joint pain as indicated above. Further, additional active substances suitable for treating different diseases or conditions or symptoms in combination with the active ingredients of the present invention are also included. It also encompasses the characterization of additional miRNAs and/or their gene products, such as exemplary additional active agents of individual miRN^ agonists or antagonists. Additional active substances also include food supplements believed to be beneficial to the individual's diet and/or for the treatment of joint disorders and for the treatment of joint pain and/or any of his or her diseases, conditions or symptoms as described above, for example (but not Limited to vitamins, minerals, fiber, fatty acids or amino acids. For the manufacture of a medicament, the mir-22 antagonist of the present invention or a mimetic thereof is usually administered with one or more pharmaceutically acceptable additives or adjuvant substances, such as a physiological buffer solution, such as a gasified sodium, depending on the type of administration. = liquid, deionized water, stabilizers such as proteases or nuclease antagonists, = aprotinin, ε-aminocaproic acid also. 4. pepstatin A or chelating agents such as EDTA ' Gel formulations such as white petrolatum, low viscosity paraffin and/or yellow wax are blended together. Further suitable additives are, for example, detergents such as Triton mir-22-1 sodium sulphonate, and polyols such as polyethylene glycol or glycerol, sugars such as sulphur or glucose 'd-ion Compounds such as amino acids such as glycine or gums are taurine or beet, and/or proteins such as bovine or human serum albumin detergents, polyols and/or zwitterionic compounds are preferred. ° The physiological buffer solution preferably has a pH of about 6.0 to 8.0, particularly a pH of about 7.4 and/or about 200 to 400 milliosmoles per liter, = preferably about 290 to 310 milliosmoles per liter of penetration. Pressure. medicine. = pH is generally based on the use of suitable organic or inorganic buffers, such as phosphate buffer, tris buffer (叁 (hydroxymethyl) amine burn), HEPES buffer ([4-(2-hydroxyethyl)) ) Piper] ethanesulfonic acid) or buffer (3-morpholin-1-propanesulfonic acid) to adjust. The choice of individual buffers will generally depend on the desired molar concentration of the buffer. Phosphate buffer = is suitable for use, for example, in injection and infusion solutions. For the manufacture of medicines, the mir-22 antagonist of the present invention or its simulation 56 201238973 may also be formulated with nevi, microlipids or other lipid complexes, or may be conjugated to a protein, peptide, nucleic acid (for example, An aptamer or gel, for example based on hyaluronic acid, or a similar sustained release formulation. The medicament is preferably in unit dosage form. In this form, the preparation can be finely divided into unit doses containing appropriate amounts of the active ingredient. The unit dosage form can be a package preparation containing discrete quantities of preparation such as a packaged lozenge, capsules and vials or ampoules. Further, the unit dosage form can be a capsule, an injection ampule, a lozenge, a sachet, or a lozenge, or it can be in any suitable form. In a seventeenth aspect, the present invention provides a method for altering a tissue state or preventing or treating a joint disease, wherein a therapeutically effective amount of the medicament of the sixteenth aspect is administered to an individual at risk of developing or suffering from a joint disease. In a preferred embodiment, the medicament is administered orally, topically, percutaneously, or intraluminally. Intraluminal administration includes, but is not limited to, intravenous and intraarticular administration. The medicine may be used in a conventional manner, for example, by an oral dosage form, such as a lozenge or a capsule, by means of a mucous membrane, such as a nose or an oral cavity, in the form of a deposit under the skin, by injection, infusion or coagulation of the medicament of the present invention. Glue is administered. It is also possible to administer the drug locally for the treatment of the specific arthritis as described above, if appropriate, in the form of a liposome complex. Furthermore, the treatment can be carried out by a transdermal therapeutic system (TTS) which is capable of controlling the release of the drug over time. The TTS is known, for example, from ΕΡ 0 944 398 A, EP 0 916 336 A, EP 0 889 723 A1 or EP 0 852 493 A1. If only a relatively small amount of a solution or suspension, for example from about 1 to about 20 ml, is administered to the body, an injectable solution is generally employed. 57 201238973

'ή is carried out via so-called detours. In a preferred embodiment of any aspect of the phase in February, the tissue state is "Bei% is preferably selected from the group consisting of bone, cartilage, II, perichondrium, sac and connective tissue. Injury, and/or characterized by it, 'and the amount of regulatory molecules, signal-transferring molecules, and/or degenerate molecules of the woven towel,' in another preferred embodiment of any aspect of the invention 'this disease II I# i The sputum disease is preferably selected from the group consisting of: osteogenic 1 X 'rheumatoid arthritis, dry arthritis, infectious arthritis, stiffness, vertebral inflammation, bursitis (inflammation), Dermatomyositis, fibromyalgia, pain, arthritis, juvenile idiopathic arthritis (Stil's disease), mixed connective tissue disease, rheumatic polymyalgia, polymyositis, reactive joints Inflammation (Wright's syndrome), scleroderma, scapular tendonitis, Sjogren's syndrome, systemic lupus erythematosus, and/or characterized by joint physical or metabolic damage caused by joint inflammation or joint degeneration, preferably 58 201238973, where the disease is Arthritis. Additionally, non-limiting aspects and embodiments of the invention are as follows. The diagnostic methods include measuring the amount of one or more miRNAs in a patient sample and using assays, results to diagnose and/or predict optimal treatment for the patient. The compositions of the present invention include mir-22 antagonists useful as miRNA antagonists which can be introduced into patients for the treatment and reduction of one or more symptoms associated with joint diseases, particularly osteoarthritis. Diagnostic methods include measuring the amount of one or more miRNAs in a patient sample and using the test results to diagnose and/or predict the optimal treatment for the patient. The composition of the present invention comprises a mir_22 agonist/mir_22 antagonist for use as a miRNAs/miRNA agonist/antagonist, which can be introduced into a patient for the treatment and reduction of one or more inflammatory diseases, particularly bony Arthritis-related symptoms. In one or more aspects of the invention (eg, using miRNA# as a biomarker), detecting mi RN A can be performed by any known method = knowing the nuclear gt, for example, with the indicated ancestors The combination of specific nucleic acid tools is performed. One aspect of the present invention relates to a material for use in a biological sample for the manufacture of a material for the treatment of a carbohydrate or a lipid metabolism.

Detecting the presence of m丨RN A in a biological sample can be a tool for any miRNA to be tested. It can be used as a marker for the miRNA or cDNA. For example, if you use it for quantitative RT ΡΓ1? p ^, you can use the same tool as the labeling reagent. For example, =, ΓΑ or Α Α specific hybridization phase: northern ink dot or wafer hybridization technology. Additional work 59 201238973

The present invention relates to the determination of joint diseases such as listening to collected samples of OA or joint disease in an individual.

According to the sample. There is an increase in the amount showing that the individual suffers from "Sheng Guanming"

1 disease 'such as the increased risk of OA listening to the collected samples, whether the mir-22 activity of mir-22 is related to one or more ginseng (10) extracts, synovial fluid, serum or blood illusion, especially 4 The number of known miRNAs in tissue or tissue secrets is comparable to the amount of miRNA in the comparison sample from the H group without the joint disease, especially the sputum, under certain conditions, with detectable amount . For example, miRNAs are more common in synovial membranes of individuals with 〇A. In the synovial membrane of the individual A, the amount can be increased to a higher amount. In the case of mir-22, an elevated amount in the patient showed an increase or increased likelihood of 〇A presence or occurrence of OA. In some cases, the amount of miRNA labeling is compared to a control group to determine whether this amount is reduced or increased. The control group can be an external control group, such as a miRNA from a patient sample known to have no joint disease, particularly 〇A. In other cases, the external control group may be a miRNA derived from a tissue/tissue fluid sample of a miRNA that is not detectable (or generally equivalent, regardless of the disease state of the individual) or a known amount of 201238973. RNA. The internal control group can be a miRNA from a test tissue/tissue fluid sample. The characteristics of the miRNA control group may be the same or different from those measured from the patient's serum or plasma miRNA. In the context of the present invention, an antagonist of a miRNA can be any molecule or composition that reduces or inhibits the function or amount of the miRNA referred to. Examples include, but are not limited to: 1. Nucleic acids, for example, as known in the art, oligonucleotides, oligoribonucleotides, particularly dsRNAs known in the art,

ssRNA, siRNA, miRNA, shRNA, ssDNA, ssDNA/RNA hybrid or chemically modified nucleic acid, and the like. 2. Antagonizing a peptide or protein, such as a protein that inhibits or inhibits the function of the moon b, an antagonist antibody or a fragment thereof or a miRNA of the indicated miRNA, 3. a small molecule compound with an antagonistic action, 4 A composition comprising one or more of 1-4 and possible excipients. Thus, one subject of the invention is the use of an antagonist for the treatment of joint diseases, in particular degenerative joint diseases, such as osteoarthritis: nnRNA antagonists can also be used to treat joint pain, in particular to reduce degenerative joints. joint pain. In addition, the miRNA antagonist can be 5 St::, π therapy-disease and/or medical treatment for the treatment of joint diseases as described above. Compound: Γ: The term "chemical molecule" covers non-polymeric "ini as曰 / ~ hydrophobic compound, peptide, preferably peptide with about and lychee, basic acid', especially with 1GJL 25 amines The base acid, human-text, parent has about 10 to about 9 nucleotides, especially 61 201238973 is 2 with 15 to 25 nucleotides. Particularly preferred are small chemical molecules, especially laboratory synthetic or natural, having from about 200 g/mol to about 15 gf, especially from 400 g/m to 1 g/mole. A non-polymerizable organic compound of a preferred molecular weight. Knife Alternatively, the antagonist of the present invention may be in the form of a crude or pure natural product extract. The extract may be prepared according to standard procedures, such as water and/or alcohol and/or organic solvent extraction, and/or column chromatography and/or precipitation from animal, plant or microbial sources such as snake venom, leaves or microbial fermentation broth. ' The term "binding protein" or "binding peptide" refers to a protein or peptide species that binds to and inhibits mir-22, including, but not limited to, multiple or monoclonal antibodies, antibody fragments, and anti-mir-22 proteins. A scaffold, such as an anti-carrier protein against mir-22. The preparation of antibodies or antibody fragments is carried out according to methods well known to those skilled in the art, for example, immunization of mammals, such as rabbits, with mir-22, if appropriate, for example, in Freund's adjuvant and/or milk oxidation. In the presence of a gel (see, for example, Diamond, Β·Α· et al. (1981) The New England Journal of Medicine 1344-1349). Multiple antibodies formed by an immune response in an animal can then be isolated from the blood using well known methods and, for example, by column chromatography purification. Individual antibodies can be, for example, according to known Winter &

Milstein's method for preparation (Winter, G. & Milstein, C. (1991) Nature, 349, 293-299) ° According to the invention, the term antibody or antibody fragment, also know, refers to an antibody or antigen-binding portion thereof , which is recombinantly prepared, and if modified, 2012 2012973, modified, eg, chimeric, humanized, multifunctional, bispecific or oligo specific, single antibody, and F(ab) or F (ab) 2 Fragments (see, for example, EP-B1-0 368 684, US 4,816,567, US 4,816,397, WO 88/01649, WO 93/06213 or WO 98/24884). An anti-mir-22 protein backbone can also be used as a surrogate for classical antibodies, such as lipocalin-based anti-carrier proteins (Beste et al. (1999) Proc. Natl. Acad. Sci. USA, 96, 1898-1903). The natural ligand binding site of lipocalin, such as retinol binding protein or post-biliary binding protein, can be altered, for example, by the "combined protein design" method, whereby the system binds to the selected incomplete antigen, This is in combination with mir-22 (Skerra, 2000, Biochim. Biophys. Acta, 1982, 337-50). Other known protein backbones are known as alternatives to antibodies for molecular assays (Skerra (2000) J. Mol. Recognit., 13, 167-187). The term "nucleic acid against mir-22 gene or mir-22 itself" refers to double-stranded or single-stranded DNA or RNA, for example, which inhibits or activates the expression of the mir-22 gene or the activity of mir-22, and includes (not limited to Antisense nucleic acids, aptamers, siRNA (small interfering RNA), miRNA, shRNA (short hairpin RNA) and ribozyme. The nucleic acid can, for example, be chemically synthesized, for example according to the phosphotriester method (see, for example, Uhlmann, E. & Peyman, A. (1990) Chemical Reviews, 90, 543-584). An aptamer is a nucleic acid that binds to a polypeptide with high affinity, and this is mir-22. Aptamers can be isolated by selection methods such as SELEmir-22 from a large pool of different single stranded RNA molecules (see, 63 201238973 eg Jayasena (1999) Clin. Chem., 45, 1628-50; Klug and Famulok (1994) M Mol. Biol. Rep., 20, 97-107; US 5,582,981). The aptamer fluid can be synthesized and selected in its mirror image form, such as L-ribonucleotides (Nolte et al. (1996) Nat. Biotechnol., 14, 1116-9; Klussmann et al. (1996) Nat. Biotechnol., 14, 1112- 5). The form isolated by this method enjoys the advantage of being not degraded by natural ribonuclease, and thus has better stability. Nucleic acids can be degraded by endonucleases or exonucleases, particularly by DNase and RNase found in cells. Therefore, it is advantageous to modify the nucleic acid to stabilize it against degradation, thereby ensuring high nucleic acid concentration in the cells for a long period of time (Beigelman et al. (1995) Nucleic Acids Res. 23: 3989-94; WO 95/11910; WO 98/ 37240 'WO 97/29116). Typically, this stabilization can be accomplished by introducing one or more internucleotide phosphorus groups or by introducing one or more non-phosphorus internucleotide groups. Suitable modified internucleotide systems are compiled in Uhlmann and Peyman (1990), supra (see also Beigdman et al. (1995)

Nucleic Acids Res. 23:3989-94; WO 95/11910; WO 98/37240; WO 97/29116" may be used in phosphoric acid in one of the uses of the invention, modified internucleotide phosphate groups and/or non-phosphorus bridges For example, decyl phosphonate, phosphorothioate, amino phosphate, dithiophosphoric acid vinegar and/or acid vinegar, and non-nuclear acid acid analogs include, for example, Shixia oxygen bridge; carbonation bridge A carboxylic acid oxime ester, an aminoethyl ester bridge, and/or a sulphur bridge. It is also desirable that this modification should improve the effectiveness of the pharmaceutical composition that can be used in one of the uses of the present invention. 64 201238973 Suitable antisense nucleic acid system Also described, for example, in Zheng and Kemeny (1995) Clin. Exp. Immunol., 100, 380-2; Nellen and Lichtenstein (1993) Trends Biochem. Sci·, 18, 419-23, Stein (1992) Leukemia, 6, 697-74 or Yacyshyn, BR et al. (1998) Gastroenterology, 114, 1142). Manufacture and use of siRNA as an RNA interference tool in down-regulating or shutting down gene expression (herein the mir-22 gene expression) Described in Elbashir, SM et al. (2001) Genes Dev., 15, 188 or Elbashir, SM, etc. Human (2001) Nature, 411, 494. Ribozyme is also a suitable tool for inhibiting the translation of nucleic acids. This is the RAK gene because it can specifically bind and cleave mRNA. For example, it is described in Amarzguioui et al. 1998) Cell. Mol. Life Sci·, 54, 1175-202; Vaish et al. (1998) Nucleic Acids Res., 26, 5237-42; Persidis (1467) Nat. Biotechnol., 15, 921-2 or Couture and Stinchcomb (1996) Trends Genet, 12, 510-5. The nucleic acid is preferably used as or as an antagonist of mir-22. For the manufacture of the medicine 'the mir-22 antagonist of the invention' is in accordance with The type of administration, usually with one or more pharmaceutically acceptable additives or adjuvant substances, such as physiological buffer solutions, such as sodium carbonate solution, deionized water, stabilizers such as proteases or nuclease antagonists, preferably Aprotinin, ε-aminocaproic acid or pepstatin A or a chelating agent such as EDTA, a gel formulation such as white petrolatum, low viscosity stone and/or yellow wax, etc. are formulated together. 65 201238973 mir 22 lL% of the second addition agent is, for example, a stripping agent such as Trit〇n or glycerin, by, and a polyhydric alcohol such as polyethylene glycol or glycerol sugar such as sugar or glucosinolate. The knee-washing-dimerizing physiological buffer solution preferably has a pH of about 6.G-8.0, particularly a pH of about 6.8-7.8, especially a pH of about 7*, and/or about 2〇0_4〇0. The milligrams per liter, preferably about osmolality per liter of osmolality. The pH of the pharmaceutical product is generally a suitable organic or inorganic buffer, for example, preferably an acid buffer, (10) a buffer (叁 (hydroxy) aminomethane), HEpES buffer (0 (2) Hydroxyethyl) piperidine] ethanesulfonic acid) or M 〇 ps buffer (3 morpholin-1-propane sulfonic acid) to adjust the choice of individual buffers generally in accordance with the desired buffer molar concentration And set. Phosphate buffers are suitable, for example, for injection and infusion solutions. The medicine may be used in a conventional manner, for example, by an oral dosage form, such as a sharp agent or a capsule, by means of a mucous membrane such as a nose or an oral cavity, in the form of a skin under the skin implanted by injection, infusion or containing the medicament of the present invention. Glue is administered. Further, it is possible to administer the drug locally, to treat the specific arthritis as described above, and if appropriate, in the form of a liposome complex. Furthermore, the treatment can be carried out by a transdermal therapeutic system (TTS) which is capable of controlling the release of the drug over time. The TTS can be known, for example, from EP 0 944 398 Al, EP 0 916 336 A1, EP 0 889 723 A1 or EP 0 852 493 A1, to a solution or suspension of 0 66 201238973, for example from about 1 to about 20 The body η 'is generally used injection solution. If a larger liquid is administered, for example, about - or more liters, then the second is used. Second, in relation to the infusion solution, in the case of injecting the solution, hair., 'in the main shot, the penetration of sputum and blood or tissue fluid = Γ, ϊ is not obvious to itself or only notices that it is not obvious ς% pain sensation . It is therefore not necessary to dilute the formulation of the invention prior to use. However, in the case of a relatively large amount of administration, the formulation of the present invention should be diluted to a degree at least about the isotonic solution before administration. An example of an isotonic solution is a G9% sodium chloride solution. In the case of infusion, dilution can be carried out, for example using sterile water, and administration can be carried out via so-called bypass. The above nucleic acids can be used in the form of naked, transgenic vectors or in combination with lipids (especially cationic lipids) or gold particles. It may be formulated as a liposome (wherein a nucleic acid such as a cargo is carried in a membrane lipid layer such as a lipid bilayer), or may be a substrate such as a glucan, a peptide or other polymer. Examples of transgenic vectors are viral vectors, such as adenoviral vectors or retroviral vectors (Lindemann et al. (1997), Mol. Med., 3, 466-76; Springer et al. (1988) Mol. Cell., 2, 549 -58). Complexes with liposomes typically achieve very high transfection efficiencies, especially skin cells (Alexander and Akhurst, 1995,

Hum·Mol·Genet·4:146-a79-85). In lipofection, a monolayer lipid system consisting of cation lipids is prepared by ultrasonic treatment of the microplast suspension. The DNA system maintains the ratio of positive charge to total charge. 67 201238973 and all plastid DNA systems are ionicly bound to the surface of the liposome by means of liposome recombination. In addition to Feigner, PL et al. (1987), Proc. Natl. Acad. Sci USA, 84, 7413 - 7414, DOTMA (1,2-dioleyloxypropyl-3-tridecyl ammonium bromide) and In addition to the DOPE (dioleylphospholipid thioglycolamine) lipid mixture, a large number of lipid formulations have been synthesized and tested for their efficacy in transfecting various cell lines (Behr et al. (1989) Proc. Natl. Acad. Sci. USA, 86, 6982-6986; Zhao * Huang (1991), Biochim Biophys. Acta, 1189, 195-203; Feigner et al. (1994)] Biol. Chem., 269, 2550-2561). Examples of lipid formulations are DOTAP N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylsulfonylsulfate or DOGS (di-octadecylamine) Glycolyl spermine). Auxiliary substances that increase the transfection of a nucleic acid into a cell can be, for example, a protein or peptide that binds to DNA, or a synthetic peptide-DNA molecule that enables the nucleic acid to be transported into the nucleus of a cell (Schwartz et al. (1999) Gene Therapy 6:282; Brand0n et al. (1999) Nature Biotech, 17, 784). Auxiliary substances also include molecules that release nucleic acids into the cytoplasm (Planck et al. (1994) J. Biol. Chem., 269, 12918; Kichler et al. (1997) Bioconj. Chem, 8, 213), or for example, liposome (Uhlmann and Peyman (1990), supra). In addition, a particularly suitable form can be obtained by coating the above nucleic acids on gold particles and blasting them into tissues or cells using so-called genes (Wang et al. (1999) J. Invest. Dermatol. 112:775 -81, Tuting et al. (1998) J. Invest. Dermatol. 111: 183-8). 68 201238973 Another subject of the invention is the mir-22 or mir-22 gene as a marker for finding mir-22 antagonists for the treatment of joint diseases, in particular degenerative joint diseases such as osteoarthritis, or joint diseases, For example, rheumatoid arthritis, and/or for the treatment of joint pain, in particular the reduction of joint pain in degenerative joint diseases. Preferably, the mir-22 antagonist can be used in the form of a pharmaceutical as described above. Thus, the invention also relates to a method of screening for a mir-22 antagonist, wherein the method comprises the steps of: (a) providing a mir-22 or mir-22 gene, (b) providing a test compound, and (c) measuring or detecting The effect of the test compound on the mir-22 or mir-22 genes. In general, the mir-22 or mir-22 gene line is provided in an assay system and is brought into direct or indirect contact with a test compound, in particular a biological or chemical test compound, such as a chemical compound library. The effect of the test compound on the mir-22 or mir-22 gene is then measured or speculated. Thereafter, the appropriate antagonist is analyzed and/or isolated. For the screening of chemical compound libraries, high throughput analysis known or commercially available to those skilled in the art is preferred. According to the present invention, the term "chemical compound library" means a plurality of chemical compounds derived from any of a variety of sources, including chemically synthesized molecules and natural products, combined, or by combinatorial chemistry techniques. In general, the effect of a test compound on the mir-22 or mir-22 gene is measured or detected by heterogeneous or homogeneous analysis. As used herein, heterogeneous analysis is an analysis that includes one or more washing steps, and such cleaning steps are not required in the analysis of the homogeneous phase 69 201238973. Only reagents and compounds are mixed and measured. A suitable functional analysis can be benchmarked against the performance of mir-22. In particular, the present invention relates to the following aspects: 1. Mir-22 is used as an indicator of tissue status or disease. 2. Use of Mir-22 as a tissue status or disease indicator. 3. The use of Mir-22 according to aspect 1 or Mir-22 according to aspect 2, wherein the amount of mir-22 is the following indicator: (a) tissue state or disease and/or (b) tissue state change or The risk of the disease, and/or (c) the individual has a tissue state change or disease, and/or (d) the progress or stage of the tissue state or disease in the individual. 4. A method of determining (a) a change in tissue status or the presence of a disease, and/or (b) a risk of developing a tissue state change or disease, and/or (c) monitoring the progress or stage of a tissue state or disease, This includes detecting the amount of mir-22. 5. The use according to the Mir-22 or Mir-22 of the third aspect or the method of the fourth aspect wherein the amount of mir-22 is the amount of mir-22 in the individual or in the individual sample. 6. The use of Mir-22 or Mir-22 according to aspect 5, further comprising comparing the amount of Mir-22 in the individual or sample to the amount of mir-22 in one or more of the reference or reference samples. 201238973 7. The use or method of Mir-22 or Mir-22 according to the sixth aspect, wherein the reference is selected from the group consisting of: a healthy individual, a rickety individual or an earlier or later time than the test subject The individual of the point, or the value of the amount of mir-22 that represents an increase or decrease in the risk of an unorganized state or disease, an altered state of the tissue, or the presence or presence of a disease or a change in the state of the disease. 8. The use or method of Mir-22 or Mir-22 according to the seventh aspect, wherein the reference sample is selected from the group consisting of: a reference sample derived from a healthy individual, a reference sample derived from a ricket individual, or derived from The reference sample collected at an earlier or later time point, as with the relevant sample, has an increased or decreased risk of representing a healthy individual or representing the presence or absence of a tissue state change or disease present or representing a change in tissue state or disease. Reference sample of mir-22 amount. 9. The use or method of Mir-22 or Mir-22 according to aspect 7, wherein the reference is a healthy individual, or an individual with a reduced risk of developing a tissue state or disease, or represents an unorganized state change or The mir-22 amount of the disease or the use or method according to the eighth aspect, wherein the reference sample is derived from a healthy individual, or is derived from an individual having a reduced risk of developing a tissue state or disease, or includes a representative of a healthy individual Or no disease state, or a decrease in the amount of mir_22 in which the tissue state changes or the risk of the disease decreases, wherein the elevated Mir_22 amount is indicative of: (a) the presence of tissue deterioration or disease and/or (b) tissue status Increased risk of exacerbation or disease and/or (c) deterioration of tissue status or progression of the disease. 201238973 10. The use or method of Mir-22 or Mir-22 according to the seventh aspect, wherein the 5 HAI reference is an individual with rickets' or an individual with an increased risk of developing a tissue state or disease, or represents an organized state The value of the change or disease, or the use or method of Mir-22 or Mir-22 according to the eighth aspect, wherein the reference sample is derived from a rickets, or is derived from an increased risk of developing a tissue state change or disease. An individual, or a mir-22 degree or amount that represents an individual in the presence or absence of a disease, or an increased risk of a change in tissue status or disease, wherein a similar Mir-22 quantity is displayed in the individual: (a) an organized state Deterioration or the presence of disease and/or (b) increased risk of tissue deterioration or disease and/or (c) deterioration of tissue status or progression of the disease. 11. Use or method according to the Mir-22 or Mir-22 of the seventh aspect, wherein the reference is the same individual at an earlier time point, or the use or method of VIir-22 or Mir-22 according to the eighth aspect , wherein the reference sample is derived from an individual collected at an earlier time point as the relevant sample, wherein 〃 (i) the elevated mir-22 amount in the relevant sample shows the individual + (a) tissue deterioration or disease Presence and/or (b) increased tissue risk or increased risk of disease and/or (c) deterioration of tissue status or disease progression, (ii) decreased mir-22 levels in relevant samples (a) tissue status Alteration or improvement or absence of disease and/or (b) decreased tissue risk or decreased risk of disease and/or (c) deterioration of tissue status or progression of disease. 72 201238973 (iii) A similar mir_22 quantity in the relevant sample shows (a) a similar risk of tissue deterioration or disease and/or (b) deterioration of tissue status or progression of disease and/or (c) tissue status Deterioration or disease persists. 12. A method for determining a medical dosage of a tissue state change or preventing or treating a disease in an individual, comprising the steps of: (a) determining the amount of mir-22 in the individual sample, and determining the reference or reference sample as needed The amount of mir_22 is used to compare with the amount of mir-22 in the relevant sample, and (b) according to the amount of mir-22 in the relevant sample, as needed, according to the amount of mir-22 in the relevant sample and the reference or reference sample. Compare, determine the dose of medicine. 13. A method of adjusting a medical dose for tissue state change or preventing or treating a joint disease, comprising the steps of: (a) determining the amount of mir_22 in the sample, and (b) determining one or more reference or reference The amount of mir-22 in the sample, (C) test the test sample as to whether the amount of mir-22 in the relevant sample is different from the amount of mir-22 in one or more reference or reference samples, (d) according to the relevant sample Whether the amount of mir-22 is different from the amount in one or more reference or reference samples, the medical dose is adjusted. 14 _ A method of determining the beneficial and/or detrimental effects of a substance on the state of a tissue or disease, comprising the steps of: (8) determining the amount of mir_22 in the relevant sample, 73 201238973 (b) determining one or more reference or reference samples The amount of mir-22, and (c) the relevant sample. The amount of mir-22 in the relevant sample is different from the amount in one or more reference or reference samples, and the manner in which the relevant sample is exposed to the substance It is different from one or more reference or reference samples. 15. The use of Mir-22 or mir-22 according to any one of aspects 5 to 11 or the method of any of aspects 5 to 14, wherein the relevant sample is tissue and/or body fluid. 16. The use or method of Mir-22 or Mir-22 according to the fifteenth aspect, wherein the tissue sample is selected from the group consisting of tissue extract, synovial tissue and cartilage, and the body fluid system is composed of the following group Selected from: synovial fluid, serum, blood pooling and urine. 17. Use of mir-22 in a method according to any of aspects 4 to 16. 18. A kit for use in a method according to any of aspects 4-16, comprising one or more tools for detecting mir-22. 19. The kit of claim 18, wherein the one or more tools for detecting mir-22 are tools for determining the amount of mir-22 expression, preferably at the gene and/or RNA level. 20. The kit according to the 18th or 19th aspect, wherein the one or more tools for detecting mir-22 are selected from the group consisting of: a nucleic acid, preferably DNA or RNA, a mixture of the two or a chemically modified nucleic acid , peptides and proteins, preferably single or multiple antibodies. The method of any one of clauses 18 to 20, wherein the kit further comprises (a) a container, and/or (b) a data carrier, wherein the data carrier includes, for example, the following information: Ο) A description of the method for determining the risk of joint disease and/or measuring the presence of joint disease and/or monitoring the progression of joint disease, (ii) detecting, preferably in the sample, preferably from the individual sample mir-22 Instructions for the use of tools and/or kits, (iii) quality information such as information on the tools and/or kit batch numbers used to detect mir-22, manufacturing or assembly locations or expiration dates or shelf life, Information on the correct storage or operation of the group, (iv) Information on the tools used to detect mir-22 buffers, diluents, reagents and/or mir-22, (v (c) information about the information obtained when performing the above methods for measuring and/or monitoring the progression of joint disease, (vi) warnings of possible misunderstandings or erroneous results when applying unsuitable methods and/or unsuitable tools, And / or (vii) when not suitable for use When the agent and / or buffers, possible misunderstandings errors or warnings Results. 22. The use of the kit of any of the aspects of any of the aspects of any of the aspects of any of 23. A nucleic acid for detecting a mir-22 gene, a gene product or a functionally active variant thereof, in a method of any of aspects 4 to 16. 24. The nucleic acid according to the 23rd aspect, wherein the nucleic acid is selected from the group consisting of a locked nucleic acid (LNA), a nucleic acid probe, a polyamine or a sinus 75 201238973 peptide nucleic acid (PNA), a microRNA (miRNA), Small interfering RNA (siRNA), primers for polymerase chain reaction (PCR), primers for reverse transcription (RT) reactions, and primers for DNA sequencing. The nucleic acid according to the 24th aspect comprises a nucleotide sequence of at least 8 nucleotides. 26. A method of any one of the methods of any one of the 4 to 16 aspect, wherein the mir-22 gene, the gene product or a functionally active variant thereof is tested for a triumph, polymorphism or protein. 27. The peptide, polypeptide or egg according to the 25th aspect

^ > -1", wherein the J white or polypeptide is a protein ligand, preferably an antibody, a fragment or a derivative thereof, or an anti-carrier protein, or wherein the polypeptide or peptide is a mass spectrometric probe 28. 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。. The mir-22 or mir-22 gene or its functional activity is used for the target molecule to find a mir-22 antagonist.

3. The use according to the 29th aspect, wherein the m ” ” ^ ^ core 22 gene or a functionally active variant thereof is directly or in contact with the test compound, and the effect of the test compound on the mir_22 ° E gene is measured or detected.虱mir-2 31. A method for screening mir-22 antagonists, wherein the method comprises/(a) providing a mir-22 or mir-22 gene, (b) providing a test compound, and 76 201238973 (c) Measurement or debt test, the effect of the compound on the mir-22 or mir-22 gene. 32. A mir-22 antagonist for tissue state change or prevention or treatment of joint disease. 33. The medicine for the prevention or treatment of a joint disease, preferably an inflammatory joint disease. 34. The medicine according to the 33rd aspect, further comprising a pharmaceutically acceptable carrier and/or excipient, and optionally Or a plurality of additional active substances. 35. A method of altering tissue status or preventing or treating a joint disease, wherein the therapeutically effective amount of the pharmaceutical according to the 33rd or 34th aspect is administered to an individual at risk of developing or suffering from a joint disease 36. As in the 35th aspect The method wherein the medicine is administered orally, topically, percutaneously, or intraluminally, preferably intravenously or intra-articularly. 37. Mir-22 or mir-22 according to any one of aspects 5 to 11, Or a method according to any one of aspects 5 to 14 and 35 to 36, the use of the kit of the 22nd aspect, the nucleic acid of any of the 23 or 25 aspect, the peptide or polypeptide of the 26th or 27th aspect or The protein, or the use of the nucleic acid, peptide, polypeptide or protein of the 28th aspect, or the Mir-22 antagonist of the 32nd aspect, wherein the tissue state is tissue damage, preferably selected from the group consisting of: bone Damage to cartilage, synovium, perichondrium, sac, and connective tissue, and/or characterized by changes in the amount of regulatory molecules, signaling molecules, and/or degenerating molecules present in the tissue. 77 201238973 38. According to Sections 5 through 11 Or a method according to any one of aspects 5 to 14 and 35 to 36, the use of the kit of the 22nd aspect, any aspect of the 23rd or 25th aspect Nucleic acid, a peptide, polypeptide or protein of the 26th or 27th aspect, or a nuclear of the 28th aspect The use of a peptide, a polypeptide or a protein, or the Mir-22 antagonist of the 32nd aspect, wherein the disease is a joint disease, preferably selected from the group consisting of osteoarthritis and rheumatoid joints. Inflammation, dry arthritis, infectious arthritis, ankylosing spondylitis, bursitis (inflammation), dermatomyositis, fibromyalgia, gouty arthritis, juvenile idiopathic arthritis (Stil's disease) Mixed connective tissue disease, rheumatic polymyalgia, polymyositis, reactive arthritis (Wright's syndrome), scleroderma, scapular tendonitis, Sjogren's syndrome, systemic lupus erythematosus, and / Or characterized by physical or metabolic damage to the joint caused by inflammation of the joint or joint deterioration, and more preferably, the disease is osteoarthritis. Other aspects of the invention are as follows: 1. [predictive method] A method for determining an increased risk of arthritic disease in a subject, comprising: a) measuring the amount of mir-22 in the biological sample of the subject; and b The amount of mir-22 in the sample is compared to the amount of mir-22 suitable for the control group, wherein an increased amount of mir-22 is measured in the sample compared to the control group, thereby determining that the subject has a joint The risk of increased disease. 78 201238973 2. [Diagnostic method] A method for diagnosing an arthritic disease in a subject, the method comprising: a) measuring the amount of mir-22 in the biological sample of the subject; and b) placing the mir-22 in the sample The amount was compared with the amount of mir-22 suitable for the control group, wherein an increased amount of mir-22 was measured in the sample compared to the control group, whereby the subject was determined to have joint disease. 3. [Patient Classification] A method of treating a subject suffering from a joint disease, the method comprising: a) measuring the amount of mir-22 in the biological sample of the subject; b) measuring the amount of mir-22 in the sample with a suitable control The amount of mir-22 in the group is compared; and c) when the amount of mir-22 is increased in the sample compared to the control group, the pharmaceutical composition for treating joint disease is administered to the patient, thereby treating the patient Object. · 4. [Dose optimization] A method for determining a medical dose for treating a subject suffering from a joint disease, the method comprising: a) measuring the amount of mir-22 in the biological sample of the subject; b) The amount of mir-22 is compared with the amount of mir-22 suitable for the control group; and c) when the amount of mir-22 is increased in the sample compared to the control group, the dose of the pharmaceutical composition is increased; or when compared In the control group, a reduced amount of mir-22 was measured in the sample, and the dose of the pharmaceutical composition was reduced, thereby determining the medical dose of the subject. 79 201238973 5. [Screening analysis] A method for determining the effect of a substance or test compound on a joint disease, the method comprising: "vector a" measuring the weight of mir_22 in a sample treated with a substance or test compound, b) in a therapeutic sample The amount of mir-22 is compared with the amount of _ for the control group; and _

If the amount of increase is measured in the sample compared to the control group, the substance is determined to have a detrimental effect, or if the amount of mir-22 is decreased in the sample compared to the control level, the substance is determined. There is a beneficial effect by which the decision determines the effect of the substance or test compound on the disease. The method of any of aspects 1-4, wherein the amount of mir-22 is measured by using a plurality of nucleic acid probes. 7. The method of any of aspects 1-6, wherein the suitable control group is a biological sample from a healthy subject. 8. The method of claim 6, wherein the suitable control group is a sample treated with an unsewed substance. The method of any of the preceding aspects, wherein the joint disease is osteoarthritis. ' 1 〇 · [Method of treatment with mir-22 antagonist] A method for treating joint disease in a subject, which comprises administering a mir-22 antagonist to a joint disease, thereby treating a joint disease of the subject . 11. The method of claim 10, wherein the mir-22 antagonist is selected from the group consisting of: siRNA, shRNA, antisense RNA, and nuclear transzyme. The method of claim 10, wherein the mir-22 antagonist is substantially complementary to at least a portion of the mir-22 precursor form (SEQ ID NO: 1). 13. The method of claim 10, wherein the mir-22 antagonist is substantially complementary to at least a portion of the mir-22 mature (SEQ ID NO: 2) or mir-22* (SEQ ID NO: 3). 14. The method of claim 10, wherein the miRNA-146a antagonist is a nucleic acid molecule of from about 6 to about 20 nucleotides in length. 15. The method of claim 10, wherein the miRNA-146a antagonist is a nucleic acid molecule of modified LNA or modified PNA. 16. The method of claim 10, wherein the joint disease is osteoarthritis. 17. The method of claim 10, wherein the miR-146 antagonist is administered to increase one or more markers of cartilage formation in the subject chondrocytes. 18. The method of clause 17, wherein the one or more chondrogenic markers are selected from the group consisting of collagen II, protein polysaccharide, Sox9, collagen X, ALP, CD-Rap, MMP-1 and mMP-3. 19. The method of clause 11, wherein the mammal is a human. 20. A kit containing one or more tools for detecting mir-22 and a suitable pair of objects. The invention is described in more detail by way of examples and figures, which are not to be construed as limiting the scope of the invention. 201238973 EXAMPLES Example 1: Characterization of mir_22 in chondrocytes and stem cells during its culture characteristics The performance of mir-22 was measured during the culture of primary chondrocytes and bone marrow-derived mesenchymal stem cells (BMSC) to evaluate during the indicated time period. Within these cells, the amount of mir-22 expression fluctuated normally. Chondrocytes were cultured in pellets to supplement 2 mM L-face valeric acid (Sigma-Aldrich), lx non-essential amino acid (Sigma-Aldrich), 10 nM dexamethasone (Sigma-Aldrich), 10 pg/ml Insulin, 5.5 pg/ml transport protein, 5 ng/ml sodium selenite (Sigma-Aldrich), 44 pg/ml ascorbic acid (Sigma-Aldrich) and \10 ng/ml TGF-β(R&D Systems) in DMEM medium Train for 0, 1, 4, 7 or 14 days. BMSCs were cultured in pellets in the same medium for 0, 1, 4, 7, 14 or 21 days. Chondrocytes and BMSCs were collected and each pellet was individually processed for RN A isolation. The analysis of secreted proteins was performed by collecting supernatants throughout the culture period and pooling them. For the extraction of RNA, the pellets were collected after seven days of culture and homogenized by Mixermill (Retsch). Protease K digestion was performed on homogeneous cells. Total RNA (including miRNA) was eluted from the Qiagen miRNeasyPlus Micro kit. RNA was reverse transcribed to cDNA using a reverse transcriptase kit and an RNase inhibitor (Life Technologies) according to the manufacturer's instructions. The mir-22 expression characteristics of chondrocytes and BMSCs were determined by Taqman probes by miRNA-specific quantitative real-time PCR according to methods well known to those skilled in the art. The characteristics of the 668 miRNA and 82 201238973 additional reference genes were determined using ABI Taqman® microRNA low density array (TLDA, Applied Biosystems, Foster City, CA). This analysis consists of three steps: multiple RT, pre-amplification, and single-tap TaqMan PCR. All steps are performed according to the manufacturer's instructions. The real-time PCR was performed on the AB 7900HT sequence detection system. For performance analysis, a comparative Ct method is applied. Figure la illustrates the performance of mir_22 in the chondrocyte mass during culture and Figure 2 illustrates the expression of mir_22 in BMSC during culture. The performance of mir-22 was detectable in the chondrocyte mass of about 23 cycles (9) = 23), while BMSC was 23 throughout the experiment. The culture conditions are such as to select the reflection conditions of the healthy differentiated cartilage. As can be seen from Fig. la and Fig. 2, the mir_22 expression of the two cell types was stable during the culture, with only very small fluctuations. This stable performance represents the opposite of the performance of mir-199a and mir-140 (Fig. lb) which increased over time in parallel experiments under the same conditions, while mir_199a and mir-140 have been determined by the inventors. MicroRNAs labeled in the physiological cartilage state; on the other hand, the inventors have revealed that the expression of mir-146a associated with osteoarthritic cartilage 'appears the same performance stability as mir-22 throughout the culture. Therefore, the amount of expression of mir_22 is lower in physiological cartilage than in the marker of differentiated physiological (i.e., non-osteoarthritis) cartilage. Therefore, the lower mir-22 expression is an indicator of the presence of innocent A relative to the marker of differentiated physiology (i.e., non-osseous arthritis) cartilage. Example 2: Overexpression and knockdown of mir-22 in BMSCs The expression of protein collagen II, proteoglycan, Sox9, collagen X, ALP and CD-Rap is known to be altered in the joints of arthritis. 83 201238973 Therefore, its individual performance is an indicator of the presence or absence of OA. In order to study the role of mir-22 in 〇A, it was measured at the level of mRNA (collagen II, proteoglycan, sox9 and collagen X) or protein (CD-Rap) in bmsC after chondrocyte differentiation. It overexpresses or knocks down the effects on these molecules. In three independent experiments (V15, V18, V20), transfection of pan-virions containing DNA encoding mir-22 (herein referred to as: mir-22) or MRP (also referred to herein as empty vector) BMSOMir-22 has been cloned into pLenti9 (a lentiviral vector containing a portion of the HIV1 LTR sequence (see figure below). Pan-virions are manufactured by Vectalys, Inc. (Toulouse, France). The infection was performed at a multiplicity of infection (MOI) of 5. To enhance the infection, 8 pg/ml polybrene was added and the assay disk was centrifuged at 50 〇 xg for 90 minutes at 32 ° C. The next day, by centrifugation (30 〇xg, 5 minutes) A high-density mass consisting of 2.5χ105 cells was formed in a 96-well cone-shaped assay dish (Eppendorf).

84 201238973 After 7 days of lumps culture, cells were harvested and their RNAs were isolated according to the same method as shown in Example 1. cDNA synthesis was performed using a reverse transcriptase kit and an RNase inhibitor (Life Technologies) according to the manufacturer's instructions. The expression levels of the four chondrogenic markers collagen II, proteoglycan, Sox9, and serotonin X were determined by quantitative real-time PCR. The TaqMan reaction was performed using the TaqMan® Universal PCR Master Mix and the FAMTM-calibrated gene specificity analysis of the target genes ACAN, COL2A1, COL10A1, and SOX9 (see table below). All gene specificity analyses consisted of FAMTM dye-calibrated TaqMan® MGB probes. PCR was performed using ABI Prism 7900 (Life Technologies). The ribosomal protein L37a (RPL37a) was used as a reference gene. The following sequences were selected for the RPL37a line: reference pre-introduction: GGCACTGTGGTTCCTGCAT, reference anti-introduction: ACAGCGGAAGTGGTATTGTACGT. The MGB reference probe is calibrated with VIC and has the following sequence: CCGCCAGCCACTGTCT. For performance analysis, a comparative Ct method is applied. Target gene gene symbol accession number gene specificity analysis ID proteoglycan ACAN ΝΜ—0132 27 Hs00153936_ml Collagen, type I, αΐ COL2A1 ΝΜ_0331 50 Hs00264051_ml Collagen, type X, αΐ COL10A1 ΝΜ_0004 93 Hs00166657-ml 85 201238973 SRY (Sex SOX9 NM—0003 Hs00165814 ml (box) -box 9 46 In a different experiment (ie V15, V18, V20), -22 overexpresses four different labeled proteins (ie collagen 11) The effect of the amount of proteoglycan, proteoglycan, S〇x9 and collagen X) is shown in Figure 3 (see Figure 3 A_D). Each experiment included four samples = 4). In experiments V15, V18 and V20 (see Figure 3A), the amount of expression of the marker protein CD RAp was tested using elisa according to methods well known to those skilled in the art. The amount of protein was cultured in pellets and quantified using an ELISA kit according to the manufacturer's instructions: CD RAp (MIA) (Roehe). Each of the single pellet culture supernatants obtained at the time of each medium change during the entire three-week culture period was collected and concentrated, and the amount of the protein was measured by ELISA for the mono-branches. The amount of the medium used for the pellets during the culture was the same. The performance of all five labeled proteins tested was significantly reduced by mir_22 overexpression compared to the amount of performance measured by the control cells. Overexpression of mir-22 showed a downregulation of the performance of these proteins. Therefore, the high mir-22 amount is an indicator of the decrease in the performance of these markers. Therefore, the amount of mir_22 increased as compared to the normal control group is an indicator of the presence of 〇A. Used in three different experiments (V21, V22, V23)

The miRIDIAN hairpin inhibitor hsa-mir-22 (Dharmacon) knocked out mir-22 in BMSC (this article also refers to: mir-22 inh) and compared the four labeled proteins to collagen, compared to the control cells. Proteoglycan, 86 201238973

The effect of Sox9 and collagen X. BMSCs were treated in a monolayer culture with a 30 nM miRIDIAN hairpin inhibitor hsa-mir-22. The miRIDIAN microRNA hairpin inhibitor Negative Control # 1 (Dharmacon) was used as a negative control group. On the next day, a high-density mass consisting of 2.5 x 105 cells was formed by centrifugation (30 〇 x g, 5 minutes) in a 96-well conical bottom assay disk (Eppendorf). The pellets are cultured for up to 3 weeks. All subsequent analytical steps were performed as described in the mir-22 overexpression. In two different, independent experiments (ie, V21, V22, V23), mir-22 knockdown on five marker proteins (ie, collagen π, protein more than cells measured, all four trials Marker protein

The effect of the performance (Pujol JP sugar, S〇X9, collagen Χ and CD-RAP) is shown in Ε. The parental test system tested four samples & = 4). Compared with 1IL-1, it inhibited the synthesis of the second and IX ujol JP 1998) and decreased the synthesis of proteoglycan 87 201238973 (proteoglycan). It has been confirmed to be present in the 〇A joint. Therefore, the effect of IL-1 treatment on the expression levels of the marker proteins: collagen II, proteoglycan, Sox9 and collagen X in differentiated BMSCs was determined. To investigate the effect of IL-1, additional samples were prepared in experiments V22 and V23, in which the cell lines were additionally treated with cytokine L-1. BMSC pellet culture was prepared as described earlier. After 7 days of differentiation (as described above), the pellet was cultured in the absence of TGF and in the presence of 〇.〇5 ng/ml IL-1 (R&D Systems). Two weeks after the start of the agglomeration, RNA was extracted after stimulation with IL-1 for 7 days. During the IL-1 stimulation, the supernatant was collected for 2 weeks (total culture period of 3 weeks). The effect of IL-1 treatment on mir-22 knockdown is shown in Figures 5A-D. The amount of collagen II, proteoglycan, Sox9, and collagen X was slightly increased by IL-1 treatment compared to the amount of expression measured by the control cells. However, this increase was lower than the increased amount of expression without IL-1 (see Example 2 and Figure 4 above), which shows a partially reversed mir-22 knockdown effect. Figure 6 is a graph further showing the percentage change in the amount of expression of four marker proteins: collagen π, proteoglycan, Sox9 and collagen X (A) due to overexpression or knockdown of mir-22 compared to the untreated control group. And the effect of IL-1 treatment on mir-22 knockout (B). [Simple description of the diagram] Figure la: mir-22 expression in the chondrocyte mass during culture. Figure lb: Performance of mir_22, mir-140, mir-146a and mir-199a in the chondrocyte mass during culture. 88 201238973 Figure 2: mir-22 expression in mesenchymal stem cell mass during culture. Figure 3: Overexpression of mir-22 on three marker genes and one marker protein in three different experiments: collagen H (A); proteoglycan (Β); Sox9 (C); collagen x ( D); CD-RAP (Ε).

Figure 4: Effect of mir-22 knockdown on the expression of three marker genes and one marker protein in three different experiments: Collagen II

(A); proteoglycan (b); Sox9 (C); collagen X (D); CD-RAP (E). Figure 5: Effect of mir-22 knockdown on the expression levels of three marker genes and one marker protein in three different experiments: collagen 11 (A); proteoglycan (B); Sox9 (C); Collagen X (D). Figure 6: Relative changes in the performance of three marker genes and one marker protein in response to mir_22 overexpression or knockdown (A), and the effect of IL-Ιβ treatment on mir-22 knockdown (B). Sequence Listing - Free text data SEQ ID NO: 1 Homo sapiens mir22 Stem loop sequence hsa-mir-22 (Accession number: MI0000078) SEQ ID NO · 2 hsa-miR-22 (Accession No. MIMAT0000077) SEQ ID NO : 3 hsa -miR-22* (accession number: MIMAT0004495) References 1. Grosshans et al., J Cell Biol 156 · 17-21 (2〇〇2) 89 201238973 2. Czech, NEJM 354: 1194-1195 (2006); 3. Mack, Nature Biotech. 25:631-638 (2007); 4. Eulalio et al., Cell 132:9-14 (2008) 5. Yi, et al. Genes Dev. 17 · 3011-3016 (2003) 6. Leuenberger et al., Helvetica Chimica Acta, CH-4010 Basel, Switzerland (1995) 7. Uhlmann and Peyman, Chemical Reviews, 90, 543-584 (1990) 8. Jayasena, Clin. Chem., 45, 1628- 50 (1969) 9. Klug and Famulok, Mol. Biol. Rep., 20, 97-107 (1994) 10. US 5,582,981 11. Nolte et al., Nat. Biotechnol., 14, 1116-9 (1996) 12 Klussmann et al., Nat. Biotechnol., 14, 1112-5 (1996) 13. Beigelman et al., Nucleic Acids Res 23: 3989-94 (1995) 14. WO 95/11910 15. WO 98/37240 16. WO 97/29116 17. Beigelman et al., Nucleic Acids Res. 23:3989-94 (1995) 18. Griffiths-Jones et al., Nucleic Acids Research, 36, Database Issue, D154-D158 (2008) 90 201238973 19. Griffiths-Jones et al., Nucleic Acids Research, 34, Database Issue, D140-D144 (2006) 20. Griffiths-Jones, Nucleic Acids Research, 32, Database Issue, D109-D111 (2004) 21. Lagos-Quintana et al., Science. 294: 853-858 (2001) 22. Michael et al., Cancer Res. 1:882-891 (2003) 23. Cai et al., Proc Natl Acad Sci USA. 102:5570-5575 (2005) 24. Landgraf et al., Cell. 129:1401-1414 (2007) 25 Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90: 5873-5877 (1993) 26. Thompson et al., Nucleic Acids Res. 22, 4673-80 (1994) 27. Altschul et al., J Mol. Biol. 215: 403-410 (1990) 28. Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997) 29. Brudno, Bioinformatics 2003b, 19 Suppl 1:154-162 30. Current Protocols In Molecular Biology, John Wiley & Sons, NY, 6.3.1-6.3.6, (1991) 31. Martin, Remington's Pharmaceutical Sciences 32. EP 0 368 684 B1 33. US 4,816,567 34. US 4,816,3 97 91 201238973 35. WO 88/01649 36. WO 93/06213 37. WO 98/24884 38. Beste et al., Proc. Natl. Acad. Sci. USA, 96, 1898-1903 (1999) 39. Skerra, Biochim Biophys. Acta, 1482, 337-50 (2000) 40. Skerra, Mol. Recognit., 13, 167-187 (2000) 41. Lindemann et al., Mol. Med·, 3, 466-76 (1997) 42. Springer et al., Mol. Cell., 2, 549-58 (1988) 43. Alexander and Akhurst, Hum. Mol. Genet. 4: 146-a79-85 (1995) 44. Feigner et al., Proc Natl. Acad. Sci USA, 84, 7413 . 7414 (1987) 45. Behr et al” Proc. Natl. Acad. Sci. USA, 86, 6982-6986 (1989) 46. Zhao and Huang, Biochim. Biophys. Acta, 1189, 195-203 (1994) 47. Feigner et al., J. Biol. Chem., 269, 2550-2561 (1994) 48. Schwartz et al., Gene Therapy 6:282 (1999) 49. Branden Et al., Nature Biotech., 17, 784 (1969) 50. Planck et al., J. Biol. Chem., 269, 12918 (1994) 51. Kichler et al., Bioconj. Chem, 8, 213 (1997) 92 201238973 52. Wang et al., J. Invest. Dermatol. 112:775-81 (1999) 53. Tuting et al., J. Invest. Dermatol. 111:183-8 (1998) 54. EP 0 944 398 A1 55. EP 0 916 336 A1 56. EP 0 889 723 A1 57. EP 0 852 493 A1 58. Diamond et al” The New England Journal of Medicine : 1344-1349 (1981) 59. Winter and Milstein, Nature, 349, 293-299 (1991) 60. Zheng and Kemeny, Clin. Exp. Immunol., 100, 380-2 (1995) 61. Nellen and Lichtenstein, Trends Biochem. Sci., 18, 419-23 (1993) 62. Stein, Leukemia, 6, 697-74 (1992) 63. Yacyshyn et al., Gastroenterology, 114, 1142 (1998) 64· Elbashir et al., Genes Dev., 15, 188 (2001) 65. Elbashir Et al., Nature, 411, 494 (2001) 66. Amarzguioui et al., Cell. Mol. Life Sci., 54, 1175-202 (1998) 67. Vaish et al., Nucleic Acids Res., 26, 5237 -42 (1998) 68. Persidis, Nat. Biotechnol., 15, 921-2 (1997) 93 201238973 69. Couture and Stinchcomb, Trends Genet., 12, 510-5 (1996) 94 201238973 Sequence Listing <11 〇 > Sanofi <120> miRNAs of joint diseases (-) <130> DE2010/287 <160> 3 <170> BiSSAP 1.0 <210> 1 <211> 85 <212> RNA <213> Homo sapiens <220> &l t;221>Source<222> 1..85 <223>/Molecule_Type="RNA" /Body ="Homo sapiens"<400> 1 ggcugagccg caguaguucu ucaguggcaa gcuuuauguc cugacccagc uaaagcugcc 60 aguugaagaa cuguugcccu Cugcc 85 <210> 2 <211> 22 <212> RNA <213> Homo sapiens <220>221>Source<222>

<223>/Molecule_Type="RNA 201238973/Organization="Homo sapiens"<400〉 2 aagcugccag uugaagaacu gu 22 <210> 3 <211> 22 <212> RNA <213&gt Homo sapiens <220> <221>Source<222> 1..22 <223>/Molecule_Type=" /Body ="Homo sapiens<400> 3 aguucuucag uggcaagcuu ua 22 2

Claims (1)

201238973 VII. Scope of application for patent: 1. A kind of Mir_22 used as a tissue state or disease indicator. 2. Use of Mir-22 as a tissue status or disease indicator. 3. The following methods are determined in an individual, (a) changes in tissue status or disease, and/or (b) risk of tissue state changes or disease, and/or (c) monitoring of tissue status or disease progression Or stage, which includes detecting the amount of mir-22. 4. A method for determining a medical dose for altering tissue status or preventing or treating a disease in an individual, comprising the steps of: (a) determining the amount of mir_22 in an individual sample, and optionally determining a reference or reference sample in mir-22 The amount is used to compare the amount of mir-22 in the relevant sample, and (b) according to the amount of mir_22 in the relevant sample, the medical dose is determined according to the comparison of the amount of mir_22 in the relevant sample and the reference or reference sample as needed. . 5. A method of using a medical dosage for tissue state change or for preventing or treating a joint disease, comprising the steps of: (a) determining the amount of mir-22 in the sample, and (b) determining - or multiple references The amount of mir-22 in the sample or reference sample, (C) test the test sample for the presence of the amount of mir-22 in the relevant sample 201238973 is different from the amount of mir-22 in one or more reference or reference samples, and d) Adjust the medical dose according to whether the amount of mir-22 in the relevant sample is different from the amount in one or more reference or reference samples. 6. A method of determining the beneficial and/or deleterious effects of a substance on the state of a tissue or disease, comprising the steps of: (a) determining the amount of mir-22 in the relevant sample, and (b) determining one or more reference species Or refer to the amount of mir-22 in the sample, and (c) test whether the relevant sample is different from the amount in one or more of the reference or reference samples in the presence of the mir-22 in the relevant sample, wherein the relevant sample is exposed to The manner of the substance is different from one or more of the reference or reference samples. 7. Use of mir-22 in a method as claimed in any one of claims 3 to 6. 8. A kit for use in a method according to any one of claims 3 to 6, which comprises one or more detection mir-22 tools. 9. The use of a kit as set forth in claim 8 for use in the method of any one of claims 3 to 6. A method for detecting a mir-22 gene, a gene product, or a functionally active variant thereof, for use in a method according to any one of claims 3 to 6. A peptide, polypeptide or protein for detecting a mir-22 gene, a gene product or a functionally active variant thereof, for use in a method according to any one of claims 3 to 6. 12. The use of a nucleic acid as claimed in claim 10 or a peptide, polypeptide or protein according to claim 11 of the patent application, for use in the method of any one of claims 3 to 6. 13. Use of the mir-22 or mir-22 gene or a functionally active variant thereof as a target molecule for the discovery of a mir-22 antagonist. 14. A method of screening for a mir-22 antagonist, wherein the method comprises the steps of: (8) providing a mir-22 or mir-22 gene, (b) providing a test compound, and (c) measuring or testing a test compound The effect of the mir-22 or mir-22 genes. 15. A mir-22 antagonist for use in altering tissue status or preventing or treating joint disease. 201238973 16. A medicine comprising a mir-22 antagonist for preventing or treating a joint disease, preferably an inflammatory joint disease. 17. A method of altering tissue status or preventing or treating a joint disease, wherein a therapeutically effective amount of an antagonist as in claim 15 of the patent application, or a pharmaceutical administration as in claim 16 of the patent application is in the process of occurrence Individuals at risk of joint disease or those suffering from joint disease