KR100996463B1 - Microorganism with physiological activity that can control rising of blood glucose and can improve liver function and Food containing thereof - Google Patents

Abstract

The present invention relates to a microorganism having an inhibitory effect on blood glucose and an effect of improving liver function, and a food containing the microorganism, and more specifically, Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis ( Bacillus subtilis) KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus squarant (Bacillus circulans) A microorganism having a blood glucose raising inhibitory effect and liver function improving effect selected from the group of KS-80 strain (KCTC 11355BP), microbial preparations including the microorganisms, preparation of microbial preparations containing the microorganisms It relates to a method, a food comprising the microorganism, a method for producing a food comprising the microorganism.

Diabetes, blood sugar, glycated hemoglobin, liver function, fermented food

Description

Microorganisms with physiological activity that can control rising of blood glucose and can improve liver function and food containing

The present invention relates to a microorganism having an inhibitory effect on blood glucose and an effect of improving liver function, and a food including the microorganism. More specifically, Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis ( Bacillus subtilis) KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus squarant (Bacillus circulans) A microorganism having a blood glucose raising inhibitory effect and liver function improving effect selected from the group of KS-80 strain (KCTC 11355BP), a microbial preparation including the microorganism, preparation of a microbial preparation comprising the microorganism It relates to a method, a food comprising the microorganism, a method for producing a food comprising the microorganism.

According to a recent survey by the Epidemiological Subcommittee of the Korean Diabetes Association and the Health Insurance Review and Assessment Service, as of 2003, the number of diabetic patients in Korea was 4.29 million, 8.29% of the total population. It is estimated that 6.2 million people will be diagnosed by 2020 and 7.2 million by 2030. At that time, it is feared that one person for every seven people in Korea will have diabetes.

Diabetes is a chronic disease that is one of the leading causes of death in Korea, and the mortality rate from diabetes is increasing rapidly from 4.3 in 100,000 in 1983 to 13.1 in 1995, and is estimated to be 15.9 in 2005. Therefore, prevention and management of diabetes and prevention of complications are very important.

Diabetes is more fearful because it causes complications that cause other illnesses as well as itself, and prevention is best because it is difficult to cure once it develops. Once confirmed, diabetes is continuously treated. There is a difficulty to receive.

Therefore, there is an urgent need for the development of drugs or foods having no side effects for the prevention and / or treatment of diabetes.

Until now, much research has been focused on the development of a single substance having antidiabetic effect from a natural material that suppresses the rise of blood sugar.

However, many studies and commercial foods still do not produce satisfactory results on the effects of diabetes suppression.

Meanwhile, according to the National Statistical Office, liver disease accounts for about 10% of all Korean deaths.

In 2004, liver disease was the 6th leading cause of death for all people and 2nd for 40s.

Most Korean liver disease is caused by the hepatitis B virus, and an estimated 3 million people are infected with hepatitis B. The number of people infected with hepatitis C reaches 200,000.

Hepatitis lasts more than six months and is classified as chronic. After more than five years, 12 to 20 percent of patients develop cirrhosis, 20 to 23 percent of liver failure, and 6 to 15 percent of liver cancer.

The rapid development of new drugs for the treatment of liver disease tends to lead to many liver disorders caused by drugs. Drug-induced liver disorders can lead to various types of hepatobiliary diseases, ranging from simple liver enzyme levels to fatal liver cell necrosis and cirrhosis. have.

Therefore, there is an urgent need for the development of drugs or foods having no side effects for improving liver function.

Until now, much research has been focused on the development of medicines for the treatment of liver disease.

However, there is still no satisfactory results for the development of foods that have no side effects and are effective in improving liver disease.

The present invention is a microorganism having a blood glucose increase inhibitory effect and liver function improving effect, a microbial agent containing the microorganism, a method for producing a microbial agent containing the microorganism, a food containing the microorganism, the production of a food containing the microorganism To provide a method.

The present invention is Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis (Bacillus licheniformis) KS-30 strain ( KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) selected from the group of blood glucose inhibitory effect and liver A microorganism having a function of improving the function, a microbial agent containing the microorganism, a method for producing a microbial agent containing the microorganism, a food containing the microorganism, a method for producing a food containing the microorganism.

The present invention is a microorganism having a blood glucose increase inhibitory effect and liver function improving effect, a microbial agent containing the microorganism, a method for producing a microbial agent containing the microorganism, a food containing the microorganism, the production of a food containing the microorganism It may provide a method.

On the other hand, the microorganisms having the effect of inhibiting blood glucose increase and improving liver function have a high activity in addition to the effect of inhibiting blood glucose increase and improving liver function (GST activity), but also antioxidant activity (Antioxidant activity), hypertension inhibitory activity (ACE inhibitory activity), etc. With the use of the microorganism of the present invention, it is possible to provide a microbial agent having an antioxidant activity and / or an antihypertensive activity, a food having an antioxidant activity and / or an antihypertensive activity.

The present invention is a microorganism having a blood glucose increase inhibitory effect and liver function improving effect, a microbial agent containing the microorganism, a method for producing a microbial agent containing the microorganism, a food containing the microorganism, the production of a food containing the microorganism The method is shown.

The present invention is Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis (Bacillus licheniformis) KS-30 strain ( KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) selected from the group of blood glucose inhibitory effect and liver Microorganisms having a function improving effect are shown.

Bacillus sp. KS-25 strain of the present invention (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis (Bacillus licheniformis) KS-30 strain ( KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) selected from the group of blood glucose inhibitory effect and liver Separation process of the microorganisms having the effect of improving the function is as follows.

Cheonggukjang and doenjang, a traditional fermented food, are mixed at a ratio of 1 to 1, heat-treated at 60 ° C. for 30 minutes, 1 g of the solution is suspended in 9 ml of 0.85% NaCl, and diluted to 10 ⁰ to 10 ⁻⁷ . 100 μl of each dilution suspension was plated in PCA medium (DIFCO) and incubated at 28 ° C., and the cultured strains were screened at least three times in TSA medium and separated into single colonies by selecting different colonies. The isolated strain was liquid cultured, purified genomic DNA and amplified using a primer of 16S RNA, the amplified portion as a template (template) and the ITS1 primer (CTTGGTCATTTAGAGGAAGTAA) and ITS4 primer (TCCTCCGCTTATTGATATGC) The sequence was separated by sequencing.

As a result of the above procedure, the species was identified by examining the NCBI DB. The primer sets used to identify the bacteria with 16S RNA were "Nucleic acid techniques in bacterial systematics (John Wiley and Sons, England)" and "nucleic acid research." (2000) 28 (1): 173-174.

The five microorganisms isolated by the above-mentioned method were respectively Bacillus sp. KS-25 strain, Bacillus subtilis KS-29 strain, Bacillus licheniformis KS- Thirty strains, Bacillus sonorensis KS-33 strain, Bacillus circulans KS-80 strain were named.

Physiological and biochemical properties of the strains are shown in Table 1 below.

Table 1. Physiological and Biochemical Characteristics of Five Strains

Item KS-25 KS-29 KS-30 KS-33 KS-80 Catalase reaction + + + + + Gram reaction + + + + + Cell morphology rod rod rod rod rod Spore formation + + + + + Growth 15 ℃ + + + + +      45 ℃ + + + + + Party use ability L-Arabinose
D-cyros
D-galactose
D-glucose
D-fractose
D-Mannose
D-mannitol
D-sorbitol
Methyl-αD-Glucopyranoside
N-acetyl glucoseamine
Amigdalin
Arbutin
Esculin Ferric Citrate
Salinity
D-cellobiose
D-Maltose
D-lactose
D-Melibiose
D-Sucrose
D-trehalose
Inulin
D-Melezitose
D-Raffinose
Starch
Glycogen
Silitol
Genthiobiose
D-Turanos
Potassium Gluconate Potassium 2-ketogluconate －
－
－
+
+
+
+
+
－
－
－
－
+
－
+
+
+
－
+
－
－
－
－
－
－
－
－
－
－
－ －
－
－
+
+
+
+
+
－
－
－
－
+
－
+
+
+
－
+
－
－
－
－
－
－
－
－
－
－
－ －
－
－
+
+
+
+
+
－
－
－
－
+
－
+
+
－
－
+
－
－
－
+
－
－
－
－
－
－
－ －
－
－
+
+
+
+
+
－
+
－
－
+
－
+
－
－
－
+
－
－
－
－
－
－
－
－
－
－
－ +
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+      Strain name Bacillus sp Bacillus subtilis Bacillus licheniformis Bacillus sonorensis Bacillus circulans

On the other hand, the microorganisms of the Korea Gene Bank (located at 52, Eeun-dong, Yuseong-gu, Daejeon) as a depositary institution, Bacillus sp. KS-25 is KCTC 11351BP, Bacillus subtilis KS-29 KCTC 11352BP, Bacillus licheniformis KS-30 is KCTC 11353BP, Bacillus sonorensis KS-33 is KCTC 11354BP, Bacillus circulans KS-80 is KCTC 11355BP Deposited on 25 June.

The present invention is Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis (Bacillus licheniformis) KS-30 strain ( KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) selected from the group of blood glucose suppression effect and liver Represents a microbial preparation comprising a microorganism having an effect of improving the function and a microorganism having an inhibitory effect on blood sugar including rice bran, sugars and purified water.

The present invention is Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis (Bacillus licheniformis) KS-30 strain ( KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) at least one microorganism selected from the group 0.001 to 0.02% by weight Represents a microbial preparation comprising a microorganism having a blood glucose elevation inhibitory effect and a liver function improving effect including 2 to 5% by weight of rice bran, 4 to 8% by weight of sugar and the remainder of purified water

The total microbial count of the microorganisms in the microbial preparation may include 1 × 10 ^{5 to} 1 × 10 ¹² cfu / g.

The formulation of the microbial agent may be formulated in any one formulation selected from the group of powders, pellets, tablets, pills, capsules.

The formulation of the microbial agent can be formulated in the form of powder or pellets.

The present invention is Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis (Bacillus licheniformis) KS-30 strain ( KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) any one or more microorganisms selected from the group, rice bran, sugars and A method for producing a microbial preparation including a microorganism having a blood glucose increase inhibitory effect and a liver function improving effect, comprising aeration of a mixture of microorganisms mixed with purified water.

The present invention is Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis (Bacillus licheniformis) KS-30 strain ( KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) any one or more microorganisms selected from the group 0.001-0.02 weight %, Rice bran 2-5% by weight, sugars 4-8% by weight and the remaining purified water,

The process of aeration of the mixture containing the microorganisms at 5 to 10 m ³ / hr for 1 to 3 hours at 2 to 6 hours at 20 to 25 ° C. was repeated 2 to 6 times a day for 15 to 21 days. It shows a method for producing a microbial preparation comprising a microorganism having a blood glucose increase inhibitory effect and liver function improving effect comprising the step carried out during.

The present invention represents a food comprising a microorganism having a blood glucose increase inhibitory effect and liver function improving effect.

The present invention is any one or more components selected from the group of rice bran, situation mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, ivory tea, Cheonggukjang; Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) , Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans (Bacillus circulans) KS-80 strain (KCTC 11355BP) any one or more selected from the group, rice bran, sugar and purified water Microbial agent comprising; represents a food comprising a microorganism having a blood glucose increase inhibitory effect and liver function improving effect.

The present invention is 60 to 99% by weight of any one or more components selected from the group of rice bran, green mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, bodhi, and cheonggukjang; Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) , Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans (Bacillus circulans) KS-80 strain (KCTC 11355BP) any one or more selected from the group, rice bran, sugar and purified water It represents a food containing a microorganism having a blood glucose increase inhibitory effect and a liver function-improving effect including a microbial agent comprising.

The present invention is 60 to 99% by weight of any one or more components selected from the group of rice bran, green mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, bodhi, and cheonggukjang; Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) , Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans (Bacillus circulans) KS-80 strain (KCTC 11355BP) any one or more selected from the group, rice bran, sugar and purified water 1 to 40% by weight of the microbial agent comprising; foods containing a microorganism having a blood glucose increase inhibitory effect and liver function improvement effect.

Any one or more components selected from the group of rice bran, situation mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, ivory tea, and cheonggukjang are preferably used in the form of powder.

The microbial agent which is one of the constituents of the food containing microorganisms having the effect of inhibiting blood glucose increase and improving liver function is Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans ) Any one or more microorganisms selected from the group of KS-80 strain (KCTC 11355BP) consisting of 0.001 to 0.02% by weight, rice bran 2-5% by weight, sugars 4-8% by weight and the balance of purified water can be used.

Food containing a microorganism having the effect of inhibiting blood glucose increase and improving liver function is any one formulation selected from the group of powders, pellets, tablets, pills, and capsules. It can be formulated as.

Food containing a microorganism having the effect of inhibiting blood glucose increase and improving liver function may be formulated into a powder or pellet formulation.

The present invention shows a method for producing a food comprising a microorganism having a blood glucose increase inhibitory effect and liver function improving effect.

The present invention is 60 to 99% by weight of any one or more components selected from the group of rice bran, green mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, ivory tea, soybean; Bacillus sp.KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) , Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans (Bacillus circulans) KS-80 strain (KCTC 11355BP) any one or more selected from the group, rice bran, sugar and purified water Mixing 1 to 40% by weight of a microbial agent comprising a mixing step such that the water content of the mixture in which the microbial agent is mixed is 20 to 60% by weight,

First fermentation of the mixture of the microbial agent is mixed at 80 ~ 85 ℃ for 2-6 hours (hr),

After the first fermentation, the second fermentation for 20 to 40 days (day) at 25 to 30 ℃,

Tertiary fermentation for 1 to 3 hours at 80 to 85 ° C. after the secondary fermentation, and

It shows a method for producing a food comprising a microorganism having a blood glucose increase inhibitory effect and liver function improving effect comprising the step of drying the third fermented product.

The food containing microorganisms having the effect of inhibiting blood sugar rise and improving liver function was not detected harmful microorganisms such as Escherichia coli and Staphylococcus aureus, and beta-glucan (β-glucan) was 4.4 g / 100 g and glutamic acid (glutamic acid). acid) was 2.83g / 100g and aspartic acid was 2.00g / 100g, and high activity was found in Antioxidant activity, ACE inhibitory activity, and GST activity. Was detected. In addition, experiments in type 2 diabetic mice (KKAy mice) have been shown to be effective in lowering blood glucose and glycated hemoglobin levels. Animals in SD rats intraperitoneally injected with carbon tetrachloride (CCl ₄ ) In experiments, AST (SGOT), ALT (SGTP), alkaline phosphatase (ALP), and lactate dehydrogenase (LDH) levels were found to be effective.

Microorganisms having a blood glucose increase inhibitory effect and liver function improving effect of the present invention, microbial preparations containing the microorganisms, a method for producing a microbial preparation containing the microorganisms, foods containing the microorganisms, the production of foods containing the microorganisms According to various methods of the method, in order to achieve the object of the present invention, a microorganism having a blood glucose increase inhibitory effect and liver function improvement effect under the above-mentioned conditions, a microbial preparation including the microorganism, including the microorganism It is desirable to provide a method for producing a microbial agent, a food containing the microorganism, and a method for producing a food containing the microorganism.

In the context of the present invention mentioned above, the sugar is any one selected from the group of molasses, sugar (including white sugar, brown sugar, brown sugar), glucose, fructose, malt, syrup, dextrin, oligosaccharide, honey, aspartame, sugar alcohol One or more may be used, wherein the sugar alcohol means any one or more selected from the group consisting of sorbitol, xylitol, erythritol, paratinose, mannitol, maltitol, inositol, and quercitol.

Hereinafter, the present invention will be described in detail with reference to Examples and Test Examples. However, these are intended to explain the present invention in more detail, and the scope of the present invention is not limited thereto.

Example 1-1 Preparation of Microbial Formulations

Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) , Bacillus sonorensis (Bacillus sonorensis) KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) are mixed with the same weight ratio, respectively, 0.01kg, rice bran 4kg, molasses 2kg and 4kg of brown sugar is mixed with drinking water so that the total weight is 100kg, and 22.5 ± 2.5 ℃ is maintained and aeration of 10m ³ / hr of air for 4 hours is performed 4 times a day. And cultured for 21 days to prepare a microbial preparation.

The microbial preparation prepared above was 1.1 × 10 ¹⁰ cfu / g.

Example 1-2 Preparation of Microbial Formulations

A microbial preparation was prepared in the same manner as in Example 1-1 except for using Bacillus sp. KS-25 strain (KCTC 11351BP) alone as a seed.

Example 1-3 Preparation of Microbial Formulations

A microbial preparation was prepared in the same manner as in Example 1-1, except that Bacillus subtilis KS-29 strain (KCTC 11352BP) was used as a seed.

Example 1-4 Preparation of Microbial Formulations

A microbial preparation was prepared in the same manner as in Example 1-1 except for using Bacillus licheniformis KS-30 strain (KCTC 11353BP) alone as a seed.

Example 1-5 Preparation of Microbial Formulations

A microbial preparation was prepared in the same manner as in Example 1-1, except that Bacillus sonorensis KS-33 strain (KCTC 11354BP) alone was used as a seed.

Example 1-6 Preparation of Microbial Formulations

A microbial preparation was prepared in the same manner as in Example 1-1 except for using Bacillus circulans KS-80 strain (KCTC 11355BP) alone as a seed.

Example 2-1 Preparation of Fermented Foods

60% by weight of the functional ingredient consisting of rice bran, green mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, ivory tea, and cheonggukjang and 40% by weight of the microbial preparation prepared in Example 1-1 were mixed.

The functional ingredient and the microbial agent mixture were first fermented at 82.5 ± 2.5 ° C. for 4 hours, followed by secondary fermentation at 27.5 ± 2.5 ° C. for 30 days, followed by tertiary fermentation at 82.5 ± 2.5 ° C. for 2 hours, and finally Fermented food was prepared by hot air drying at 87.5 ± 2.5 ° C. for 2 hours, wherein the total fermented food was 3.3 × 10 ⁵ cfu / g.

The functional component in the above is 10% by weight of rice bran, 2% by weight of mushrooms, 5% by weight of noni, 5% by weight of green tea, 5% by weight of turmeric, 5% by weight of broccoli, 5% by weight of agaricus, 5% by weight of chlorella, 5% of tea %, Cheonggukjang made of 13% by weight of the composition, wherein the functional ingredient was used as a powder ground to 100 mesh.

Example 2-2 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 2-1, except that the microbial preparation was prepared in Example 1-2.

Example 2-3 Preparation of Fermented Food

Fermented food was prepared in the same manner as in Example 2-1, except that the microbial preparation was prepared in Example 1-3.

Example 2-4 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 2-1, except that the microbial preparation was prepared in Example 1-4.

Example 2-5 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 2-1, except that the microbial preparation was prepared in Example 1-5.

Example 2-6 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 2-1, except that the microbial preparation was prepared in Example 1-6.

Example 3-1 Preparation of Fermented Foods

80% by weight of the functional ingredient consisting of rice bran, green mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, ivory tea, and cheonggukjang and 20% by weight of the microbial preparation prepared in Example 1-1 were mixed.

The functional ingredient and the microbial agent mixture subjected to the inoculation step were first fermented at 82.5 ± 2.5 ° C. for 4 hours, followed by secondary fermentation at 27.5 ± 2.5 ° C. for 30 days, and 3 hours at 82.5 ± 2.5 ° C. for 3 hours. After fermentation, finally fermented food was prepared by hot-air drying at 87.5 ± 2.5 ° C. for 2 hours, wherein the fermented foods were 3.3 × 10 ⁵ cfu / g.

The functional ingredient in the above is 15% by weight of rice bran, 5% by weight of mushrooms, 6% by weight of noni, 6% by weight of green tea, 6% by weight of turmeric, 6% by weight of broccoli, 6% by weight of agaricus, 6% by weight of chlorella, 6% by weight of tea % And Cheonggukjang made of 18% by weight, wherein the functional ingredient was used as a powder ground to 100 mesh.

Example 3-2 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 3-1, except that the microbial preparation was prepared in Example 1-2.

Example 3-3 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 3-1, except that the microbial preparation was prepared in Example 1-3.

Example 3-4 Preparation of Fermented Food

Fermented food was prepared in the same manner as in Example 3-1, except that the microbial preparation was prepared in Example 1-4.

Example 3-5 Preparation of Fermented Food

Fermented food was prepared in the same manner as in Example 3-1, except that the microbial preparation was prepared in Example 1-5.

Example 3-6 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 3-1, except that the microbial preparation was prepared in Example 1-6.

Example 4-1 Preparation of Fermented Foods

99% by weight of the functional ingredient consisting of rice bran, green mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, ivory tea, and cheonggukjang and 1% by weight of the microbial preparation prepared in Example 1-1 were mixed.

The functional ingredient and the microbial agent mixture subjected to the inoculation step were first fermented at 82.5 ± 2.5 ° C. for 4 hours, followed by secondary fermentation at 27.5 ± 2.5 ° C. for 30 days, and 3 hours at 82.5 ± 2.5 ° C. for 3 hours. After fermentation, finally fermented food was prepared by hot-air drying at 87.5 ± 2.5 ° C. for 2 hours, wherein the fermented foods were 3.3 × 10 ⁵ cfu / g.

The functional component in the above is 21% by weight of rice bran, 5% by weight of mushrooms, 7% by weight of noni, 7% by weight of green tea, 7% by weight of turmeric, 7% by weight of broccoli, 7% by weight of agaricus, 7% by weight of chlorella, 7% by weight of tea % And Chonggukjang made up by a composition ratio of 24% by weight, wherein the functional ingredient was a powder ground to 100 mesh.

Example 4-2 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 4-1, except that the microbial preparation was prepared in Example 1-2.

Example 4-3 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 4-1, except that the microbial preparation was prepared in Example 1-3.

Example 4-4 Preparation of Fermented Food

Fermented food was prepared in the same manner as in Example 3-1, except that the microbial preparation was prepared in Example 1-4.

Example 4-5 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 4-1, except that the microbial preparation was prepared in Example 1-5.

Example 4-6 Preparation of Fermented Foods

Fermented food was prepared in the same manner as in Example 4-1, except that the microbial preparation was prepared in Example 1-6.

Example 5 Microbial Analysis and Characteristics of Fermented Foods

The number of general bacteria, E. coli, yeast, and Staphylococcus aureus of the fermented food prepared in Example 2-1 was examined and the results are shown in Table 2 below.

As shown in Table 2, the general bacterial count was 3.3 × 10 ⁵ / g. Escherichia coli, Staphylococcus aureus and yeast were not detected.

Table 2. Measurement of bacterial counts of fermented foods

Analysis test item result Way General bacterial count 3.3 × 10 ⁵ / g Standard Agar Plate Culture Coliform group Voice / 2.22 g BGLB method Yeast Voice / 0.1 g Potato dextrose (10%)
Agar Plate Culture Staphylococcus aureus Voice / 0.01 g Reputation smear culture

Example 6 Characteristics of Microorganisms in Fermented Foods

In order to investigate the characteristics of the microorganisms present in the fermented food prepared in Example 2-1, the number of bacteria according to artificial gastric juice, artificial intestinal fluid and heat treatment was measured and the results are summarized in Table 3 below.

As shown in Table 3, there was no growth inhibition of fermented strains by artificial gastric juice (pH 1.4) and artificial intestinal fluid (pH 6.8).

On the other hand, even after 10 hours of heat treatment at 95 ℃, even after 24 hours after the heat treatment, the number of bacteria is similar to the untreated group, and 5.45 × 10 ¹⁰ bacteria were detected when the storage time passed 72 hours, the fermentation of the present invention Fermented microorganisms of food are considered to have excellent thermal stability.

These results suggest that the microorganisms in the fermented foods can function as probiotics that can reach the esophagus, stomach, small intestine and large intestine.

Table 3. Changes in the Number of Viable Cells by Treatment Conditions

Test Items result week Test Methods Normal
Viable count No treatment 2.91 × 10 ⁵ / g One Standard Agar Plate Culture Artificial gastric fluid treatment 2.71 × 10 ⁵ / g 2 Standard Agar Plate Culture Artificial serous treatment 3.35 × 10 ⁵ / g 3 Standard Agar Plate Culture After heat treatment; 0 hours 1.32 × 10 ⁵ / g 4 Standard Agar Plate Culture After heat treatment; 24 hours 1.20 × 10 ⁵ / g 4 Standard Agar Plate Culture After heat treatment; 48 hours 2.31 x 10 ⁸ g 4 Standard Agar Plate Culture After heat treatment; 72 hours 5.45 × 10 ¹⁰ 4 Standard Agar Plate Culture

Note 1. According to the food hygiene test guideline, the number of common bacteria is measured according to the standard agar plate culture method.

Note 2. The sample was suspended in 10 times of artificial gastric juice (pH 1.4) and treated at 37 ° C for 2.5 hours, followed by bacterial count measurement.

Note 3. Samples were suspended in 10 times the amount of artificial intestine (pH 6.8) and treated at 37 ° C for 2.5 hours, followed by bacterial count measurement.

Note 4. The sample was suspended in 10 times the amount of physiological saline and heated at 95 ° C. for 10 minutes, and then kept at 35 ° C. for 0, 24, 48 and 72 hours, followed by bacterial counting.

* Artificial gastric juice: 1.2 mL of 1M hydrochloric acid was added to 0.1 g of sodium chloride, adjusted to 50 mL with ion-exchanged water, and prepared to have a pH of 1.4 at 37 ° C.

* Artificial intestinal fluid: 0.544 g of potassium dihydrogen phosphate was dissolved in ion-exchanged water, and then 5.9 mL of 0.2 M aqueous sodium hydroxide solution was added, and the total amount was made 50 mL with ion-exchanged water, and the pH was adjusted to 6.8 at 37 ° C.

Physiological saline: 0.85 g of sodium chloride was dissolved in ion-exchanged water, and the total amount was 100 mL.

Example 7 Analysis of Ingredients of Fermented Foods

As a result of analyzing the components of the fermented food prepared in Example 2-1, as shown in Table 4, the content of beta-glucan (β-glucan) contained in a large amount of mushrooms appeared to be relatively high as 4.4g / 100g and specifically, Among amino acids, glutamic acid was 2.83g / 100g and aspartic acid was 2.00g / 100g.

Table 4. Physicochemical Analysis of Fermented Foods

Analysis test item result Detection limit week Way ergosterol 1.26mg / 100g HPLC method β-glucan 4.4g / 100g Enzyme method amino acid One Amino acid autoanalyzer arginine 1.13g / 100g lysine 0.66g / 100g histidine 0.58g / 100g phenylalanine 0.89g / 100g tyrosine 0.54g / 100g leucine 1.37g / 100g isoleucine 0.74g / 100g methionine 0.30g / 100g valine 0.98g / 100g alanine 1.07g / 100g glycine 0.99g / 100g proline 0.92g / 100g glutamic acid 2.83g / 100g serine 0.89g / 100g threonine 0.76g / 100g aspartic acid 2.00g / 100g tryptophan 0.25g / 100g cystine 0.37g / 100g

Note 1. After formic acid treatment, hydrochloric acid hydrolysis

Example 8 Enzyme Activity of Fermented Foods

The fermented food prepared in Example 2-1 was water-extracted and lyophilized to investigate the activity and inhibitory effect on the sample and the results are shown in Table 5 below.

As shown in Table 5, the fermented food prepared in Example 2-1 had high activity in antioxidant activity, antihypertensive activity (ACE inhibitory activity), and liver function improvement (GST activity). Therefore, the fermented food of the present invention was found to have the effect of antioxidant activity, hypertension inhibitory activity, liver function improving ability.

Table 5. Various Enzyme Activities

Item Antioxidant activity
(%) ACE inhibitory activity
(%) GST activity
(%) Measures 55.4 ± 1.9 72.1 ± 0.5 92.4 ± 2.4 density 1mg 1mg 100 µg

Antioxidant activity: Antioxidant activity was determined using Blois and MS (eg. MS Antioxidant determination by the use of stable free radicals. Nature, 191), using the reducing power of 1, 1-diphenyl-2-picrylhydrazyl (DPPH). : 1199 (1958)). 800 μl of DPPH solution (12.5 mg of DPPH dissolved in 100 mL of EtOH) was added to 200 μl of the sample, followed by reaction for 10 minutes, and the absorbance was measured at 525 nm to compare the activity with the sample-free control.

ACE inhibitory activity: Cushman et al. (Cushman DW and Cheung. HS Spectrophotometic assay and properties of the angiotensin-converting enzyme of rabbit lung.Biochemical Pharmacology, 20: 1637-1648 (1971) 50 μl of the ACE solution extracted from the rabbit lung powder from 50 μl of the extract obtained by treating the same amount of ethyl acetate with the same volume of the sample solution, and the substrate solution (100 mM of pH 8.3). 2.5 ml of sodium borate buffer solution was mixed with 50 μl of 300 mM NaCl and 25 mg Hip-His-Leu), and then reacted at 37 ° C. for 30 minutes, and then stopped with 1N HCl. The amount of hippuric acid liberated in the reaction solution was calculated by measuring the absorbance at 228 nm, and the inhibition rate was determined using no sample as a control.

GST activity: Hepatic function improvement activity is William H's method (Habig William H, Pabst MJ, Fleischner G, Gatmaitan Z, Arias IM, Jakoby WB.The identity of glutathione S-transferase B with ligandin, a major binding protein of liver.Proc Natl Acad Sci USA 71: 3879-3882 (1974)) was partially modified and measured as follows. To 100 µl of 0.1mM potassium phosphate buffer (pH 6.5), 10 µl of sample, 15 µl of GST enzyme solution (1.5 unit) and 10 µl of glutathione (Glutathione, GSH) were added, followed by pre-incubation at 25 ° C for 5 minutes. incubation). 10 μl of substrate 1-chloro 2,4-dinitrobenzene was added thereto and reacted at 25 ° C. for 5 minutes, and then 350 μl of 20% TCA was added to stop the reaction. After the reaction was mixed (vortexing), centrifugation at 8000 rpm for 5 minutes, the supernatant was taken, and the absorbance was measured at 314 nm. The GST activation activity was calculated as follows.

GST activation activity (%) = (B-S / C) × 100

C: A ₃₁₄ of Control (without sample)

S: A ₃₁₄ of Sample

B: A ₃₁₄ of reactants (products)

Example 9 Acute Oral Toxicity Test Using Mice of Fermented Foods

The fermented food prepared in Example 2-1 was evaluated for safety through an acute oral toxicity test using a mouse. First, the fermented food prepared in Example 2-1 was suspended in drinking water to prepare a test solution of 250 mg / mL, and then, 5,000 mg / kg of the male and female mice, 5 weeks old, were forcibly administered by using a probe (test group). ). The control group was administered to 20mL / kg drinking water to investigate the weight change. As a result, as shown in Table 6 and Table 7, 7 days and 14 days after administration, the test group of both sexes showed no difference in body weight compared to the control group.

Table 6. Weight change (cancer)

Administration group
Before administration
After dosing (days) 7 14 Test group 32.1 ± 0.7 (5) 35.8 ± 1.8 (5) 35.8 ± 1.7 (5) Control 31.7 ± 0.6 (5) 35.3 ± 1.8 (5) 37.9 ± 1.2 (5)

* Weight is expressed as mean ± standard deviation (unit: g)

* Display mouse count in parentheses

Table 7. Weight change (number)

Administration group
Before administration
After dosing (days) 7 14 Test group 26.0 ± 0.9 (5) 28.8 ± 1.0 (5) 31.2 ± 0.9 (5) Control 26.3 ± 0.8 (5) 30.1 ± 1.2 (5) 32.0 ± 1.2 (5)

* Weight is expressed as mean ± standard deviation (unit: g)

* Display mouse count in parentheses

Example 10 Animal Experiments Using KK-A ^y / Ta Jcl (Genetic Obesity Type 2 Diabetes Model) Mice

In order to verify the efficacy of the fermented food prepared in Example 2-1 for diabetes was examined the effect on KK-A ^y / Ta Jcl mice.

The experimental animals and diets were fed 30 KK-A ^y / Ta Jcl (genetic obesity type 2 diabetes models) mice from Clea (Tokyo, Tapan) and fed free with AIN-93G feed for 1 week. After adapting to the breeding environment, it was used for the experiment. After 1 week, the experiment was conducted by dividing into three experimental groups of control group (A), test group 1 (B), and test group 2 (C) by randomized complete block design (10) for each group (see Table 8). The room temperature was 23 ± 2 ℃, the humidity was 50 ± 5%, and the lighting cycle was adjusted every 12 hours. The diet and drinking water were allowed to be ingested freely by individuals in each group for 10 weeks.

Table 8. Composition of Feed (g / 100g Diet)

Group A (control) AIN-93G diet 100% by weight Group B (Test Group 1) AIN-93G diet 99.92% by weight + fermented food 0.08% by weight Group C (Test Group 2) AIN-93G diet 99.6% by weight + fermented food 0.4%

(1) We examine mouse weight, dietary intake and water intake

The body weight, dietary intake and water intake of the mice were examined during the experiment. Body weight was measured at a certain time every week, and dietary intake and water intake were measured as the difference between the intake and the remaining amount. As a result, as shown in Table 9, the higher the fermented food content, the lower the weight, but no significant difference. The average intake was 6.70g / day, 6.40g / day, 5.93g / day in group A, B and C, respectively, and the dietary intake decreased significantly as the content of fermented foods increased (p <.0001). In the drinking water intake, the A group was 28.42ml / day, B was 23.16ml / day, C was 18.70ml / day, and the higher the fermented food content was, the more significant decrease was observed (p <.0001). From the results, the fermented food prepared in Example 2-1 of the present invention was shown to have the effect of suppressing the following symptoms, polymorphism, which is a typical symptom of diabetes, and the effect is high in group C having the highest content of fermented food. Burned out.

Table 9. Body weight, diet and water intake of KK-Ay mice

Initial weight (g) Weight after 10 weeks (g) Daily weight change (g / day) Food
(g / day) Water intake
(ml / day) Group A 32.09 ± 0.54 43.53 ± 2.97 5.71 ± 0.49 6.70 ± 0.30 ^a 28.42 ± 2.48 ^a B group 32.12 ± 1.15 41.57 ± 3.50 5.69 ± 0.42 6.54 ± 0.41 ^a 23.16 ± 2.20 ^b Group C 32.86 ± 1.10 42.21 ± 2.21 5.57 ± 0.50 5.93 ± 0.29 ^b 18.70 ± 1.64 ^c

* Significance of the difference among the group (p <.0001)

(2) Measurement of blood sugar of mouse

Blood glucose was measured every week for 10 weeks during the experiment. Whole blood was collected from the tail vein at a fixed time every week without fasting time, and measured using a glucose strip (ACCU-CHEK Sensor, Roche, Basel, Switzerland) using Glucose-oxidase method. Indicated.

As shown in FIG. 1, the blood sugar levels of group A, B and C before the experimental diet were increased at 313 mg / dL, 301 mg / dL, and 311 mg / dL until the second week after the experimental diet. Significant (p <.05, p <.01, p <.001, p <.0001) decreases from week 4, beginning to decrease. The blood sugar levels of group A, group B and group C at the beginning of the experimental diet were 440 mg / dL, 394 mg / dL, and 392 mg / dL, respectively, and at 10 weeks after the end of the experiment, the blood glucose of group A was 353 mg / dL and B. The blood sugar of the group was 235 mg / dL, and the blood sugar of the C group was 186 mg / dL, and the blood sugar value of the C group was 167 mg / dL lower than that of the A group. As the amount of fermented food added to the feed increased as compared with the initial blood sugar value, the decrease in blood sugar was increased, and the fermented food was found to be effective in significantly lowering the blood sugar level.

(3) Measurement of plasma glucose concentration of mouse

Plasma glucose concentration of the mice was measured and shown in FIG. 2.

As shown in FIG. 2, after 10 weeks of experiment, blood samples of group A, B, and C mice were collected to measure plasma glucose concentration. Group A was 494.60 ± 125.61mg / dL, and Group B was 313.20 ± 88.58mg / dL, C. Group 260.60 ± 65.65mg / dL, a significant decrease (p <.01) in the diet group of group B and C compared to group A, it was confirmed that the effect of reducing the glucose of 200mg / dL.

(4) Measurement of plasma insulin concentration of mouse

Plasma insulin concentrations of mice were measured and shown in FIG. 3.

As shown in FIG. 3, after 10 weeks, the blood sample was analyzed by blood samples. The plasma insulin concentration of group A was 896.72 ± 66.35ng / mL, the group B was 766.64 ± 263.88ng / mL, and the group C was 837.86 ± 84.62ng / mL. Compared with the group, serum insulin was slightly decreased in the diet group of group B and C, but it was not significant.

(5) Measurement of concentration of glycated hemoglobin of mouse

The concentration of glycated hemoglobin in mice was measured and shown in FIG. 4.

HbA1c, part of hemoglobin in erythrocytes, is glycosylated by non-enzymatic binding to glucose slowly during the survival of blood cells. Therefore, the degree of glycation of HbA1c can be used to measure the blood glucose concentration, the survival time of blood cells. Therefore, glycated hemoglobin is widely used as the most basic indicator of glycemic control, and the glycated hemoglobin value (glycated homoglobin value) can be used to estimate the blood glucose concentration over the past several weeks. The measurement of glycated hemoglobin is a good guide to integrating changes in blood glucose over a long period of time and can be measured with a single blood sample.

As shown in FIG. 4, after 10 weeks, the mice of group A, B, and C were collected to measure glycated hemoglobin concentration. As a result, group A was 7.0%, group B was 5.9% and group C was 5.4%. In comparison, the concentration of glycated hemoglobin decreased significantly as the content of fermented food increased.

The glycemic control targets of diabetes recommended by the American Diabetes Association include fasting blood glucose 80-120 mg / dL, pre-bed blood sugar 100-140 mg / dL, and HbA1c <7%. Although the concentration of glycated hemoglobin in group B was about 5.9% and that of glycated hemoglobin in group C was about 5.4%, the fermented food prepared in Example 2-1 of the present invention had an effect of lowering blood glucose. It could be seen (see Fig. 4).

Fermented foods containing microorganisms having a blood sugar suppression effect of the present invention is expected to have an effective therapeutic effect to lower blood sugar and be useful for type 2 diabetes patients to prevent long-term complications such as cardiovascular disease and stroke. In particular, it is thought that plasma glucose can be lowered from 170 mg / dL to 135 mg / dL or less (see Table 10).

Table 10. Comparison of glycated hemoglobin and plasma glucose levels ^*

Glycated hemoglobin Average Plasma Sugars 6% 135mg / dL 7% 170mg / dL 8% 205 mg / dL 9% 240mg / dL 10% 275mg / dL 11% 310mg / dL 12% 345 mg / dL

As described above, although described with reference to a preferred embodiment of the present invention, those skilled in the art will be variously modified and modified within the scope of the present invention without departing from the spirit and scope of the invention described in the claims below. It will be appreciated that it can be changed.

Example 11 Effect of Fermented Food on Liver Damage in Rats Induced by Carbon Tetrachloride

In order to verify the effect of improving the liver function of the fermented food prepared in Example 2-1, carbon tetrachloride (CCl ₄ ) is intraperitoneally injected into rats (Sprague Dawley male rats) to induce liver disease and then ingested liver The effect on function was investigated.

Carbon tetrachloride (CCl ₄ ) is a representative substance that is toxic to liver cells because it decreases protein synthesis and glycogen levels in the liver, inhibits microsomal enzymes and necroses liver cells. Since it is possible to induce liver diseases such as fatty liver and cirrhosis, it has been widely used experimentally to clarify the effects of the administered substances.

Rats were bred for 5 weeks in a diet of carbon tetrachloride and olive oil at a ratio of 1: 1 and intraperitoneally injected with 0.1mL per 100g body weight twice a day for 3 days.

Experimental animals and diets were fed from rats with an average body weight of 110 ± 10g from the central laboratory animals and fed to AIN-93G feed for one week while being adapted to the breeding environment. After 1 week, the experiment was divided into three experimental groups of normal group (A), carbon tetrachloride group (B), and fermented food intake group 1 (C) after administration of carbon tetrachloride (6 animals per group) by randomized complete block design. Table 11). The room temperature was 23 ± 2 ℃, the humidity was 50 ± 5%, the lighting cycle was adjusted every 12 hours, and diet and drinking water were allowed to be ingested freely by individuals in each group for 5 weeks.

Table 11.The composition of the feed (g / 100g diet) and

Group A AIN-93G diet 99.6% by weight + fermented food 0.4% B group AIN-93G diet 100% by weight Group C AIN-93G diet 99.6% by weight + fermented food 0.4%

(1) weight and liver weight of rats

The weight and liver weights of the rats measured during the experiment are shown in Table 12. Body weight gain was the smallest in the group B administered with carbon tetrachloride alone (4.80g / day), but there was no significant difference between groups. To determine the effect of fermentation of carbon tetrachloride and carbon tetrachloride on liver weight, liver weight per 100 grams of body weight was higher in group B administered with carbon tetrachloride alone. It was decreased in C after fermentation. However, there was no significant difference. Jeon and Park (Jeon JR. Park JR. 2002. Effect of Eucommia ulmoides leaf water extract on hepatotoxicity of carbon tetrachloride-induced rats.J korean Soc Food Sci Nutr 31: 124-130), Lee et al. (Lee SB, Cho TS, Yoon KW, Lee JC, Lee SM, Shim SB. 1998. A study on hepatoprotective effect of PS-1 from Artemisia iwayomogi.J Appl Pharmacol 6: 119-129) and Kim et al. Hepatotoxicity by carbon tetrachloride in the study of J. Korean Soc. Food Sci. Nutr. Vol 37., No. 5, pp.548-554) The induced rat group reported a significant increase in liver weight percentage compared to the normal group, which is in agreement with the results of this experiment, and these results suggest that fermented products can restore liver damage.

Table 12. Body weight and liver weight of rats

Groups ¹⁾ Initial body weight (g) Final body weight (g) Change of
body weight
(g / day) Liver
(g / 100g body weight) A 132.03 ± 2.59 348.29 ± 15.14 5.15 ± 0.34 2.87 ± 0.06 B 132.22 ± 5.46 333.88 ± 14.67 4.80 ± 0.42 3.04 ± 0.14 C 132.09 ± 6.54 340.56 ± 32.42 4.97 ± 0.88 2.97 ± 0.29

(2) Measurement of liver function enzyme activity of rat

After 5 weeks of breeding, the blood was collected and measured for AST (SGOT), ALT (SGPT), alkaline phosphatase (ALP) and lactate dehydrogenase (LDH). As a result, serum AST, ALT, ALP and LDH activities were significantly increased in the carbon tetrachloride administered group (B) compared to the normal group (A) as shown in Table 13. Hepatic toxic substances such as carbon tetrachloride induce necrosis of liver cells and destruction of liver tissue, thereby increasing the outflow of AST, ALT, ALP and LDH into the blood. In this embodiment, carbon tetrachloride impaired liver function.

In the C group ingesting the fermented food prepared in Example 2-1, all the AST, ALT, ALP and LDH levels were significantly reduced by the administration of carbon tetrachloride, and it was confirmed that the fermented food had an effect on improving liver function.

Table 13. Enzyme Activity of Liver in Rats

Group ¹⁾ AST ^* ALT ^*** ALP ^* LDH ^** A 93 ± 12 ^b 51 ± 5 ^b 349 ± 21 ^b 288 ± 72 ^b B 131 ± 14 ^a 65 ± 15 ^a 489 ± 60 ^a 527 ± 82 ^a C 95 ± 5 ^b 51 ± 5 ^b 369 ± 46 ^b 355 ± 93 ^b

As described above, although described with reference to a preferred embodiment of the present invention, those skilled in the art will be variously modified and modified within the scope of the present invention without departing from the spirit and scope of the invention described in the claims below. It will be appreciated that it can be changed.

The present invention is Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis (Bacillus licheniformis) KS-30 strain ( KCTC 11353BP), Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) selected from the group of blood glucose inhibitory effect and liver It is possible to provide a microorganism having an effect of improving the function, it is possible to provide a food that can suppress the rise in blood sugar by using the microbial agent containing the microorganism in the food, to prevent and / or treat diabetes and liver disease, etc. By contributing, you can contribute to industrial development.

1 is a test group (B, C) ingesting a food containing a microorganism having a blood glucose increase inhibitory effect of the present invention and a control group (A) not ingesting a food containing a microorganism having a blood sugar rise inhibitory effect of the present invention. It is a graph showing the change in blood glucose of KKAy mice.

Figure 2 of the experimental group (B, C) ingested food containing a microorganism having a blood glucose increase inhibitory effect of the present invention and a control group (A) not ingesting a food containing a microorganism having a blood glucose increase inhibitory effect of the present invention Graph showing mouse plasma glucose content.

Figure 3 of the experimental group (B, C) ingested food containing the microorganisms having a blood glucose increase inhibitory effect of the present invention and the control group (A) who did not take a food containing a microorganism having a blood sugar rise inhibitory effect of the present invention It is a graph showing the concentration of mouse plasma insulin.

Figure 4 of the experimental group (B, C) ingested food containing the microorganisms having a blood glucose increase inhibitory effect of the present invention and the control group (A) who did not eat a food containing a microorganism having a blood sugar rise inhibitory effect of the present invention It is a graph showing the concentration of mouse glycated hemoglobin (HbA1c).

Claims (11)

Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) Inhibition effect of any one of the blood sugar level selected from the group of Bacillus sonorensis (Bacillus sonorensis) KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) and improving liver function Microorganisms. Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) , Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans (Bacillus circulans) KS-80 strain (KCTC 11355BP) any one or more selected from the group, rice bran, sugar and purified water Microbial agent comprising a microorganism having a blood glucose increase inhibitory effect and liver function improving effect. Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) Bacillus sonorensis (Bacillus sonorensis) KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) any one or more microorganisms selected from the group 0.001-10% by weight, rice bran A microbial agent comprising a microorganism having an inhibitory effect on blood sugar rise and improving liver function, including 0.5 to 10% by weight, 0.5 to 10% by weight of sugar, and the balance of purified water. The microorganism preparation according to claim 2 or 3, wherein the total number of microorganisms in the microbial preparation is 1 × 10 ^{3 to} 1 × 10 ¹³ cfu / g. The microbial preparation of claim 2 or 3, wherein the formulation of the microbial preparation comprises a microorganism having a blood glucose raising inhibitory effect and a liver improving effect, which are powders or pellets. Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) One or more microorganisms, rice bran, sugars and purified water selected from the group of Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) A method for producing a microbial preparation comprising a microorganism having an effect of inhibiting blood sugar rise and improving liver function, including aeration of a mixture of the mixed microorganisms. Bacillus sp. KS-25 strain (KCTC 11351BP), Bacillus subtilis KS-29 strain (KCTC 11352BP), Bacillus licheniformis KS-30 strain (KCTC 11353BP) , Bacillus sonorensis KS-33 strain (KCTC 11354BP), Bacillus circulans KS-80 strain (KCTC 11355BP) any one or more microorganisms selected from the group 0.001-10% by weight, rice bran 0.5 Mixing 10% by weight, 0.5-10% by weight of sugar and the remainder of purified water, and mixing the mixture of the microorganisms at a temperature of 5 to 10 m ³ / hr at an interval of 2 to 6 hours at 20 to 25 ° C. Method for producing a microbial preparation comprising a microorganism having a blood glucose increase inhibitory effect and liver function improving effect comprising the step of performing aeration for 2 to 6 times a day repeatedly for a period of time for 3 to 30 days. Improvement of liver function and improvement of hepatic glucose effect including any one or more ingredients selected from the group of rice bran, situation mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, bocha, and cheonggukjang and the microbial preparation of claim 2 or 3 Food containing microorganisms having an effect. 60 to 99% by weight of any one or more components selected from the group of rice bran, situation mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, voila tea, and cheonggukjang and the microbial preparations 1 to 40 of claim 2 or 3. Food comprising a microorganism having a blood glucose increase inhibitory effect and a liver function improving effect comprising a weight%. 10. The blood sugar according to claim 8 or 9, wherein the food is shaped into any one formulation selected from the group of powders, pellets, tablets, pills, capsules. Food containing microorganisms having a synergistic inhibitory effect and an effect of improving liver function. 60 to 99% by weight of any one or more components selected from the group of rice bran, situation mushroom, noni, green tea, turmeric, broccoli, agaricus, chlorella, voila tea, and cheonggukjang and the microbial preparations 1 to 40 of claim 2 or 3. Mixing the weight%, but mixing the microbial agent so that the water content of the mixture is 20 to 60 weight%, First fermentation of the mixture of the microbial agent is mixed at 80 ~ 85 ℃ for 2-6 hours (hr), After the first fermentation, the second fermentation for 20 to 40 days (day) at 25 to 30 ℃, Tertiary fermentation for 1 to 3 hours at 80 to 85 ° C. after the secondary fermentation, and Method for producing a food comprising a microorganism having a blood glucose increase inhibitory effect and liver function improving effect comprising the step of drying the third fermentation.

Images