KR101845865B1 - food include the microorganism products and method thereof - Google Patents

Abstract

The present invention segregates and identifies microorganisms having antioxidant activity, liver function improving activity and hypertension inhibiting activity enzyme, and then manufacturing a microorganism preparation using the microorganism and providing a food product made using such microorganism preparation.
To this end, the present invention relates to a microorganism preparation comprising a microorganism preparation, which comprises a microorganism preparation comprising a microorganism, a wheat germ, a mushroom powder, a mugwort powder, a lotus powder, a ganoderma powder, a silkworm, broccoli, sorghum powder, Powder at a temperature of 85 to 95 DEG C for 4 to 8 hours while rotating the mixture at a speed of 35 rpm / min to steam at 150 to 180 DEG C; Inoculating the microorganism at 70 DEG C after the gelatinization; Fermenting the fermented microorganism by repeating the process of increasing the activity and homogenizing the fermented microorganism while rotating at 25 to 30 ° C at a rate of 10 rpm / min after the inoculation; And drying the fermented product obtained through the fermentation process.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention [0001] The present invention relates to a food including a microorganism preparation,

The present invention relates to a food made using a microorganism preparation, an antioxidant activity, a liver function improving activity, and a hypertension inhibiting activity enzyme.

According to the National Statistical Office, liver disease accounts for about 10% of the total deaths of Koreans. In 2004, liver disease ranked 6th among the nationwide deaths and second in 40s.

In particular, most of the liver disease among Koreans is caused by the hepatitis B virus, which is estimated to reach 3 million people with hepatitis B infection, and the number of people infected with hepatitis C reaches 200,000.

If such a hepatitis lasts for more than 6 months, it is classified as chronic. If these symptoms exceed 5 years, 12-20% of patients develop cirrhosis, 20-30% of them become hepatic insufficiency, and 6-15% become liver cancer .

Recently, a variety of new drugs for the treatment of liver disease have been developed rapidly, but hepatic disorders due to these drugs have also been apt to occur. Especially, in the case of drug-induced hepatic disorders, from the rise of simple liver enzymes to the lethal hepatocyte necrosis , And liver cirrhosis.

Therefore, there is an urgent need to develop drugs or foods that have no side effects for improving liver function.

Up to now, much research has been concentrated on the development of medicines for the treatment of liver diseases, and in connection with this, Registration Patent Publication No. 10-0366398, Registration Patent No. 10-0444396, and Patent Document No. 10-2005-0115836 And the like.

However, there is still no satisfactory outcome for the development of foods that have the potential to improve liver disease, which still has no side effects.

In addition, the increase in the number of hypertensive patients due to accelerated aging and irregular eating habits due to the accumulation of fatigue substances in the body due to an increase in life stress is very worrisome.

How to safely protect from the increasing number of stressful diseases with the economic growth due to modernization. Most of them except drugs are dependent on individual will and balanced diet.

The reality of this reality is confirmed, and the need for standardized food with established mass production technology becomes more urgent.

DISCLOSURE Technical Problem The present invention has been conceived to solve the above-mentioned various problems of the prior art. It is an object of the present invention to isolate and identify microorganisms having antioxidative activity, liver function improving activity and hypertension inhibitory activity enzyme and then using a microorganism preparation And to provide food products made by the above methods.

In order to attain the above object, the food according to the present invention is a food product comprising at least one selected from the group consisting of rice gruel, wheat embryo, mushroom powder, mugwort powder, lotus root powder, ganoderma powder, silkworm powder, broccoli, sorghum powder, leek powder, 80% by weight of a functional ingredient consisting of powder, ground powder, and 20% by weight of drinking water, and aging at 85 to 95 캜 for 4 to 8 hours while rotating at a speed of 35 rpm / min; An inoculation step of inoculating the microorganism preparation at 70 < 0 > C after the liquefaction step; Fermenting the fermenting microorganism by increasing the activity and homogenizing the fermenting microorganism at a rate of 10 rpm / min at 25 to 30 ° C. for 2 hours, A fermentation completion step of repeating the fermentation step for 21 to 28 days to complete fermentation; A drying step of drying the fermentation product obtained through the fermentation completion step at 50 to 60 DEG C for 8 to 10 hours; The microorganism preparation is prepared by mixing Lactobacillus (Lactobacillus sp.) Isolated from the group of the complex microorganism BM-S-1-A (Deposit No. KCTC 12387BP) 0.001-10 wt.% Of a complex strain microorganism consisting of any one or more microorganisms selected from the group consisting of Lactobacillus , Acetobacter, Ethanoligen , Bayeronella and Veillonellaceae_uc. 0.5 to 10% by weight of rice bran, 0.5 to 10% by weight of saccharides and the balance of purified water to prepare a mixture; The mixture is aerated at 5 to 10 cm3 / min for 1.5 hours at a temperature of 20 to 25 DEG C for 6 hours and then quenched for 4.5 hours to be repeated four times a day for 10 days. one is the complex microbial strain by taking a BM-S-1A complex strain (KCTC 12387BP) 1g was suspended in 0.9% Nacl 9ml then, the steps to create a diluted suspension was diluted to 10 ⁰ to ^10-7; 100 μl of the dilution suspension was plated on a PCA (Plate Count Agar) medium and cultured at 30 ° C; Selecting the strains having different colony types from the cultured strains, subculturing the strains in TSA (Trypticase Soy Agar) medium at least three times, and separating into single colonies; Followed by liquid culture of a single colony.

delete

delete

delete

delete

As described above, the food of the present invention has antioxidant activity, GST activity, ACE inhibitory activity and inhibition of blood glucose elevation.

Hereinafter, preferred embodiments of a food including the microorganism preparation according to the present invention and a method for producing the same will be described.

First, it is suggested that the microorganism preparation contained in the food according to the present invention is prepared from a microorganism obtained by isolating from the group of BM-S-1A complex strain (KCTC 12387BP).

Here, the BM-S-1A composite strain (KCTC 12387BP) has been deposited with the composite deposit number KCTC12387BP on March 20, 2013, using the microorganism resource center of the Korea Research Institute of Bioscience and Biotechnology as a depository institution.

Particularly, the microorganism isolated from the group of BM-S-1A complex strain (KCTC 12387BP) has antioxidant activity, GST activity, and ACE inhibitory activity As a microorganism, the separation process is as follows.

First, the diluted with taking the BM-S-1A complex strain (KCTC 12387BP) 1g was suspended in 0.9% Nacl 9ml, ⁰ to 10 ^10-7. Then, 100 占 퐇 of each dilution suspension is plated on a PCA (Plate Count Agar) medium and cultured at 30 占 폚. The cultured strains are selected for different colony types and cultured in TSA (Trypticase Soy Agar) And separated into a single colony. Subsequently, the isolated strain was cultured in a liquid medium, genomic DNA was purified and amplified using a primer of 16S RNA, and the amplified fragment was used as a template and the ITS1 primer (CTTGGTCATTTAGAGGAAGTAA) and the ITS4 primer (TCCTCCGCTTATTGATATGC ) To perform sequencing of the sequence.

In addition, the results of the above procedure were examined in the NCBI DB to identify the species. As a result, the primer set used to identify the bacterium with 16S RNA was named "Nucleic acid techniques in bacterial systematics (John Wiley and Sons, England) acid research (2000) 28 (1): 173-174. "

The five microorganisms isolated by the above-mentioned method were identified as ① lactobacillus , ② Lactobacillaceae_uc , ③ Acetobacter , ④ Ethanoligen , and ⑤ Veillonellaceae_uc , and more specifically, Lactobacillus, Lactobacillaceae_uc ) , Acetozobacter , Ethanoligenens , Bayonella and the undetermined species (Veillonellaceae_uc).

The physiological and biochemical characteristics of the above strains are shown in Table 1 below.

Physiological and biochemical characteristics of the strain  ①  ②  ③  ④  ⑤ Catalase reaction + + + + + Gram reaction + + + + + Cell morphology rod rod rod rod rod Spore formation + + + + + Growth 15 ℃ + + + + +      45 ° C + + + + + Party ability
L-arabinose
D-Cirrus
D-galactose
D-glucose
D-fructose
D-Mannos
D-mannitol
D-sorbitol
Methyl-D-glucopyranoside
N-acetylglucosamine
Amigalline
Arbutin
Escullin ferric citrate
Salincin
D-cellobiose
D-Maltose
D-lactose
D-melibiose
D-cross
D-trehalose
Inulin
D-Melitose
D-raffinose
Starch -
-
-
+
+
+
+
+
-
-
-
-
+
-
+
+
+
-
+
-
-
-
-
-
-


+
+
+
+
+
+
+
+
-
-
-
-
+
-
+
+
+
-
+
-
-
-
-
-
-


+
+
+
+
+
+
+
+
-
-
-
-
+
-
+
+
-
-
+
-
-
-
+
-
-

+
+
+
+
+
+
+
+
-
+
-
-
+
-
+
-
-
-
+
-
-
-
-
-
-



-
-
-
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+

Next, the Lactobacillus (Lactbacillus), Lactobacillus unidentified species (Lactobacillaceae_uc), acetonitrile bakteo (Acetozbacter), ethanol Lee Regensburg (Ethanoligenens) is separated from the group selected microorganism of the above-described BM-S-1A complex strain (KCTC 12387BP) , A method for producing a microorganism preparation using bayeronella and an undetermined species (Veillonellaceae_uc) will be described.

First, 0.002 to 0.02 weight of any one or more microorganisms selected from the group consisting of Lactobacillus , Lactobacillaceaeuc , Acetozobacter , Ethanoligenens , Bayonella and Veillonellaceae_uc 5 to 10% by weight of rice bran, 3 to 5% by weight of saccharides and the remaining purified water. At this time, the total number of bacteria of the microorganism is 1 * 10 ⁵ to 1 * 10 ¹² cfu / g, and the remaining purified water is mixed in the range of 84.98 to 91.998%.

Of course, the content of each component for producing the microorganism preparation mentioned above is only one example, but it is not limited thereto. Preferably, the content of the microorganism is 0.001 to 10% by weight, 0.5 to 10% by weight, and the content of saccharides in the range of 0.5 to 10% by weight. At this time, purified water of the remainder may be mixed in a range of 70 to 98.999% depending on the amount of the microorganism, rice bran and saccharide mixed.

And, from the group of Lactobacillus , Lactobacillaceaeuc , Acetozbacter , Ethanoligenens , Bayeronella and Veillonellaceae_uc , Etaeta godi is one of the microorganisms The mixed mixture is aerated at 20 to 25 캜 for 6 hours at a rate of 5 to 10 cm < 2 > / min for 1.5 hours and stopped for 4.5 hours is repeated four times a day for 10 days.

Thus, a microorganism preparation containing microorganisms having an effect of suppressing the increase of blood glucose and an effect of improving liver function is prepared through the above-mentioned process.

Particularly, the above-described formulation of the microbial agent can be formulated into any one form selected from the group consisting of powders, circles, and granules.

Next, the present invention provides a food comprising a microorganism having an antioxidant activity, a liver function improving activity, and a hypertensive inhibitory activity enzyme.

The present invention suggests that such a food contains a microorganism preparation made using microorganisms having the antioxidant activity, liver function improving activity and hypertension inhibiting activity enzyme. To this end, the present invention relates to a food comprising a rice germ, a wheat germ, a mushroom powder, At least one component selected from the group consisting of starch powder, root powder, corn powder, silkworm powder, broccoli, sorghum powder, leek powder, ginger powder, peel powder, coarse powder and ginseng powder; A microorganism selected from the group consisting of Lactobacillus , Lactobacillaceae_uc , Acetozobacter , Ethanoligenens , Bayeronella and Veillonellaceae_uc , and a microorganism selected from the group consisting of rice bran, There is provided a food comprising a microbial agent comprising a saccharide and purified water.

Herein, any one or more components selected from the group consisting of rice bran, wheat germ, mushroom powder, mugwort powder, lotus root powder, wool powder, silkworm powder, broccoli, sorghum powder, leek powder, Is 80 to 99% by weight, and the remainder is the microbial formulation.

At this time, the microorganism preparation may be any one selected from the group of Lactobacillus , Lactobacillaceaeuc , Acetozobacter , Ethanoligenens , Bayeronella and Veillonellaceae_uc Microorganisms, rice bran, saccharides and purified water, and the production process thereof is as described in the above description.

It is also possible to use any one or more selected from the group consisting of the above rice bran, wheat germ, shiitake powder, mugwort powder, lotus root powder, ganoderma powder, silkworm powder, broccoli, sorghum powder, leek powder, The component is preferably used in the form of a powder.

Furthermore, microorganism preparations, which are one of the constituents of foods containing microorganisms having antioxidative activity, liver function improving activity and hypertension inhibitory activity enzymes, can be selected from the group consisting of Lactobacillus , Lactobacillaceaeuc , Acetobacter , , ethanol Lee Regensburg (Ethanoligenens), a Fresnel ragwa unidentified species (Veillonellaceae_uc) group in which one or more microorganisms 0.002 ~ 0.02% by weight, rice bran, 5-10% by weight, sugars 3-5% by weight and the balance of purified water is selected from the bay Can be used.

In addition, the food containing the microorganism having the antioxidative activity, the liver function improving activity and the hypertension inhibitory enzyme can be formulated into any one form selected from the group of powder, circle, and granular have.

Next, a description will be given of a method for producing the above-mentioned foods (antioxidant activity, liver function improving activity, food containing microorganisms having hypertension inhibiting activity enzymes).

First of all, the food manufacturing method of the present invention is a method of producing food of the present invention, wherein the food of the present invention is prepared from a rice germ, a wheat germ, a shiitake powder, a mugwort powder, a lotus powder, a kelp, a silkworm, a brook, , And 1 to 40% by weight of the above-mentioned microorganism preparation are mixed in an incubator and heated directly by steam to give a mixture of a luxurious Wherein the microorganism is selected from the group consisting of Lactobacillus , Lactobacillaceaeuc , Acetozbacter , Ethanoligenens , Bayeronella and Veillonellaceae_uc , and rice bran 1 to 20% by weight of a microorganism preparation containing saccharides and purified water, wherein the microorganism preparation is inoculated so that the water content of the mixture is 40 to 50% by weight, A fermentation step of fermenting at 25 to 30 ° C for 21 to 28 days after the inoculation step, a drying step of hot air drying at 50 to 60 ° C for 8 to 10 hours after the fermentation, And a pulverizing step of pulverizing the mixture. Thus, a food containing microorganisms having an antioxidative activity, a liver function improving activity and a hypertensive inhibitory activity enzyme is produced.

At this time, during the heating step, the incubator is rotated at a speed of 35 rpm / min, and the steam temperature is 150 to 180 ° C.

At the same time, the inoculation step is carried out at 70 ° C, and the fermentation step is repeated at a speed of 10 rpm / min while the activity of the fermenting microorganism is increased and homogenized.

Foods containing microorganisms having antioxidative activity, liver function improving activity and antihypertensive activity were not detected in the food such as Escherichia coli and Staphylococcus aureus, and the contents of beta-glucan (4.4 g / 100 g) and glutamic acid (2.00g / 100g) of aspartic acid and 2.00g / 100g of glutamic acid and antioxidant activity, ACE inhibitory activity and GST activity High activity was detected.

On the other hand, the microorganism having the antioxidant activity, the liver function improving activity, the hypertension inhibiting enzyme, the microorganism preparation containing the microorganism, the method for producing the microorganism preparation containing the microorganism, the food containing the microorganism, In order to achieve the object of the present invention, the present invention has been accomplished by various conditions under which the microorganism having antioxidant activity, liver function improving activity, hypertension inhibiting enzyme, It is preferable to provide a microorganism preparation containing the microorganism, a method for producing the microorganism preparation containing the microorganism, a food including the microorganism, and a method for producing the food including the microorganism.

In the context of the present invention mentioned above, the saccharide may be at least one selected from the group consisting of molasses, sugar (including white sugar, yellow sugar, brown sugar), trehalose, glucose, fructose, dextrin, oligosaccharide and honey.

Hereinafter, the preparation of the microorganism preparation of the present invention and the production method of the fermented food using the microorganism preparation will be described in more detail with reference to the respective examples and test examples. However, these are for the purpose of illustrating the present invention in more detail, and the scope of the present invention is not limited thereto.

≪ Example 1-1 > Preparation of microorganism preparation

0.01 kg of microorganisms of Lactobacillus genus, Lactobacillaceae genus, Acetobacter genus, Ethanoligenens genus, Veillonellaceae_uc genus, 5 kg of rice bran, 2 kg of molasses and 3 kg of trehalose were mixed with drinking water to be weighed to a total weight of 100 kg, Aeration of 10 cm3 / min of air for 1 ~ 5 hours and stopping for 4 ~ 5 hours was repeated 4 times a day for 10 days to prepare microorganism preparation.

The microbial preparation prepared above had a total number of bacteria of 1.1 * 10 ⁷ cfu / g.

 <Example 2-1> Preparation of fermented food

80 wt.% Of a functional ingredient consisting of rice bran, wheat germ, shiitake mugwort powder, mugwort powder, lotus powder, wool, silkworm, broccoli, sorghum powder, leek powder, ginger powder, ginger powder, coarse powder, ginseng powder, 20% by weight of drinking water was put into a rotary neck incubator and mixed so that the water activity became 28%.

Steam was added to the functional ingredient in which the raw material was mixed, and the raw material was gelled at 85 to 95 ° C for 4 hours. The mixture was naturally cooled to 70 ° C to inoculate the microorganism preparation prepared in Example 1-1 Next, the fermented food was fermented at 25 to 30 ° C at room temperature for 20 days to 28 days, and then dried at 60 ° C for 8 hours by hot air. Then, a powdery fermented food of 100mesh or less was prepared using a food pulverizer, And the number of bacteria was 3.7 * 10 ⁷ cfu / g.

The functional ingredient contained 43.2 wt% of rice bran, 5.92 wt% of wheat germ, 11.24 wt% of mushroom powder, 12.8 wt% of mugwort powder, 2.96 wt% of root powder, 2.52 wt% of sardine powder, 2.52 wt% of silkworm powder, 2.0 wt% By weight of carnauba powder, 2.12% by weight of sorghum powder, 0.4% by weight of leek powder, 0.8% by weight of ginger powder, 4.24% by weight of oak flour, 0.8% by weight of crude powder, 4.24% by weight of ginseng powder and 4.24% Powder pulverized into 100mesh was used as a functional ingredient.

<Example 2-2> Preparation of fermented food

Example 2-1, except that the microbial agent prepared in Example 1-1 was used, will be described in detail.

 The functional ingredient having been subjected to the raw material mixing step of Example 2-1 was steamed through a central shaft of a rotary neck incubator at a steam pressure of 1.2 atm and a steam water content of 20 wt% And the culture was rotated at a rate of 35 rpm / min for 4 hours at 85 to 95 ° C., and the microorganism preparation prepared in Example 1-1 was inoculated at 70 ° C., The inoculation process is continued until the temperature is warmed to room temperature.

When the temperature inside the rotary neck incubator drops to 25 ~ 30 ℃, the rotation of the incubator is stopped and the fermentation proceeds. After 96 hours from the start of fermentation (when the incubator is stopped), the rotatory neck incubator is rotated at a rate of 10 rpm / min for 2 hours to homogenize the fermentation state inside the incubator and increase the activity of the fermenting microorganism in the incubator. The fermentation is completed by repeating the operation for one to 28 days.

When the fermentation process is completed, the incubator is rotated at a rate of 35 rpm / min, and the dried hot air 60 is introduced through the axis of the incubator to dry the fermented product until the moisture concentration reaches 8%. Dried at 60 ° C for 8 hours, and then transferred to a food pulverizer to prepare a powdery fermented food having a particle size of 100mesh or less, wherein the total fermented food was 3.3 * 10 ⁷ cfu / g.

Example 3 Analysis and Characterization of Microorganisms in Fermented Foods

The number of general bacteria, Escherichia coli, yeast, and Staphylococcus aureus in the fermented food prepared in Example 2-1 was examined, and the results are shown in Table 2 below.

As shown in [Table 2], the number of general bacteria was 3.7 * 10 ⁴ cfu / g. Escherichia coli, Staphylococcus aureus and yeast were not detected.

 Measuring the number of bacteria in fermented food Analysis test items result Way General bacterial count 3.3 * 10 ⁵ / g Standard agar plate culture method Coliform group Voice / 2.22 g BGLB method Yeast count Voice / 0.1g Potato dextrose (10%)
Agar plate culture method Staphylococcus aureus Voice / 0.01 g Flat plate horse culture method

<Example 4>

In order to investigate the characteristics of microorganisms present in the fermented food prepared in Example 2-1, artificial gastric juice, artificial intestinal fluid and microbes according to heat treatment were measured and the results are shown in Table 3 below.

As shown in [Table 3], there was no inhibition of growth of the fermenter by artificial gastric juice (pH 1.4) and artificial intestinal fluid (pH 6.8).

On the other hand, in the case of heat treatment at 95 ° C for 10 minutes, the bacterial count was similar to that of the untreated group even after 24 hours of heat treatment, and 3.5 * 10 ⁹ bacteria were detected at the storage time of 72 hours, The fermentation microorganisms of food are considered to have excellent thermal stability.

These results suggest that the microorganisms present in the fermented food can function as probiotics capable of surviving to the esophagus, stomach, small intestine, and large intestine.

Changes in viable counts by treatment conditions Test Items result week Test Methods Number of viable bacteria No treatment 2.91 * 10 ⁵ / g One Standard agar plate culture method Artificial gastric juice treatment 2.71 * 10 ⁵ / g 2 Standard agar plate culture method Artificial intestinal fluid treatment 3.35 * 10 ⁵ / g 3 Standard agar plate culture method After heat treatment; 0 hours 1.32 * 10 ⁵ / g 4 Standard agar plate culture method After heat treatment; 24 hours 1.20 * 10 ⁵ / g 4 Standard agar plate culture method After heat treatment; 48 hours 2.31 * 10 ⁸ / g 4 Standard agar plate culture method After heat treatment; 72 hours 5.45 * 10 ⁹ / g 4 Standard agar plate culture method

Note 1. The average viable cell count was measured according to the standard agar plate culture method according to the Food Hygiene Inspection Guideline

Note 2. The specimen was suspended in a 10-fold amount of artificial gastric juice (pH 1.4), treated at 37 ° C for 2.5 hours,

Note 3. The specimen was suspended in a 10-fold amount of artificial intestinal fluid (pH 6.8), treated at 37 ° C for 2.5 hours,

Note 4. The specimen was suspended in 10 times as much physiological saline, heated at 95 DEG C for 10 minutes, kept at 35 DEG C for 0, 24, 48 and 72 hours,

Artificial stomach fluid: To 0.1 g of sodium chloride was added 1.2 mL of 1 M hydrochloric acid, adjusted to 50 mL with ion-exchanged water, and adjusted to pH 1.4 at 37 占 폚.

Artificial intestinal fluid: 0.544 g of potassium dihydrogenphosphate was dissolved in ion-exchanged water, and then 5.9 mL of a 0.2 M aqueous sodium hydroxide solution was added, and the total volume was adjusted to 50 mL with ion exchange water and adjusted to pH 6.8 at 37 캜.

Physiological saline: 0.85 g of sodium chloride was dissolved in ion-exchanged water and the total volume was made 100 mL.

 &Lt; Example 5 > Component analysis and enzyme activity of fermented food

After the fermented food prepared in Example 2-1 was subjected to water analysis and lyophilized, the components thereof were analyzed and their activity and inhibitory effect were examined. The results are shown in Table 4 below.

Analysis of composition of food according to the present invention Contents of analysis Result Ergosterol 1.07 mg / 100 g β-glucan 2.4 g / 100 g Amino acids Arginine 1.13 g / 100 g Lysine 0.66 g / 100 g Histidine 0.58 g / 100 g Phenylalanine 0.89 g / 100 g Tyrosine 0.54 g / 100 g Leucine 1.37 g / 100 g Isoleucine 0.74 g / 100 g Methionine 0.3 g / 100 g Valine 0.98 g / 100 g Alanine 1.07 g / 100 g Glycine 0.99 g / 100 g Proline 0.92 g / 100 g Glutamic acid 2.83 g / 100 g Serine 0.89 g / 100 g Threonine 0.76 g / 100 g Aspartic acid 2.00 g / 100 g Tryptophan 0.25 g / 100 g Cystine 0.37 g / 100 g

As shown in Table 4, the content of beta-glucan was as high as 2.4 g / 100 g, the content of glutamic acid was 2.83 g / 100 g and the content of aspartic acid was 2.00 g / 100 g, respectively.

As shown in Table 5, the fermented foods prepared in Example 2-1 were found to have high activity in antioxidant activity, ACE inhibitory activity and GST activity. Therefore, it was found that the fermented food of the present invention had antioxidant activity, hypertension inhibitory activity, and liver function improving ability.

Various enzyme activities Item Antioxidant activity
(%) ACE inhibitory activity
(%) GST activity
(%) Measures 55.4 ± 1.9 72.1 ± 0.5 92.4 ± 2.4 density 1 mg 1 mg 100 μg

* Antioxidant activity: Antioxidant activity is determined by Blois using the reducing power of 1, 1-diphenyl-2-picrylhydrazyl (DPPH) and the like (Blois, MS Antioxidant determination by the use of stable free radicals. : 1199 (1958)). 800 L of a DPPH solution (12.5 mg of DPPH dissolved in 100 mL of EtOH) was added to 200 L of a sample, which was reacted for 10 minutes, and the absorbance at 525 nm was measured to compare the activity with that of the sample-free control.

ACE inhibitory activity: The hypertensive inhibitory activity was measured by the method of Cushman et al. (Cushman DW and Cheung HS Spectrophotomic assay and properties of the angiotensin-converting enzyme of rabbit lung. Biochemical Pharmacology, 20: 1637-1648 (1971) 50 μL of the extract obtained by treating the sample solution with the same amount of ethyl acetate was mixed with 150 μL of ACE solution (about 2.8 to 3 units) extracted from rabbit lung powder and 100 μL of a substrate solution (100 mM sodium borate buffer solution (2.5 mL, 300 mM NaCl and 25 mg Hip-His-Leu were dissolved), and the mixture was reacted at 37 ° C for 30 minutes. Then, the reaction was stopped with 1N HCl. The amount of hippuric acid liberated in this reaction solution was calculated by measuring the absorbance at 228 nm, and the inhibition rate was determined using a sample-free solution as a control.

GST activity: Liver function improving activity was measured by William H's method (Habig William H, Pabst MJ, Fleischner G, Gatmaitan Z, Arias IM, and Jakoby WB. The identity of glutathione S-transferase B with ligandin, a major binding protein of liver. Proc Natl Acad Sci USA 71: 38793882 (1974)) was partially modified and measured as follows. 10 μL of the sample, 15 μL (1.5 units) of the GST enzyme solution and 10 μL of glutathione (GSH) were added to 100 μL of 0.1 mM potassium phosphate buffer (pH 6.5) and preincubated at 25 ° C. for 5 minutes. 10 μL of 1-chloro 2,4-dinitrobenzene was added to the reaction mixture and reacted at 25 ° C. for 5 minutes. Then, 350 μL of 20% TCA was added to stop the reaction. The reaction mixture was vortexed, centrifuged at 8000 rpm for 5 minutes, supernatant was taken, and absorbance was measured at 314 nm to calculate GST activation activity as follows.

GST activation activity (%) = (B-S / C) * 100

C: A ₃₁₄ of Control (without sample)

S: A ₃₁₄ of Sample

B: A ₃₁₄ of reactants (products)

<Example 6> Effect of fermented food on liver damage of carbon tetrachloride-induced rats

In order to verify the liver function improvement effect of the fermented food prepared in Example 2-1, CCl ₄ was intraperitoneally injected into rats (Sprague Dawley male rats) to induce liver disease, and then fermented foods were consumed The effect on function was investigated.

Carbon tetrachloride (CCl ₄ ) is a typical substance that shows toxicity to hepatocytes because it decreases protein synthesis and glycogen level in liver, inhibits microsomal enzyme and necrotizes hepatocytes. Hepatopathy, liver cirrhosis, and the like, it has been widely used as an experiment to reveal the effect of the administered substance.

Rats were sacrificed at a ratio of 1: 1 with carbon tetrachloride and olive oil and injected with 0.1 mL per 100 g of body weight twice a day for 3 days to induce acute liver injury in rats.

The experimental animals and diets were housed in the central experimental animals and fed to AIN-93G diet for 1 week. Sixteen rats per group were randomly divided into three groups: the normal group (A), the carbon tetrachloride group (B), and the fermented food intake group (C) after the carbon tetrachloride injection Table 5). The temperature of the feeding room was 232, the humidity was 505%, the lighting period was adjusted every 12 hours, and the diet and drinking water were freely consumed by individuals in each group for 5 weeks.

Composition of feed (g / 100g diet) and Group A AIN-93G diet 99.6% by weight + fermented food 0.4% Group B AIN-93G diet 100% Group C AIN-93G diet 99.6% by weight + fermented food 0.4%

(1) Weight and liver weight of rats

The body weight and liver weight of the rats were measured during the experimental period as shown in [Table 6]. Body weight gain was the lowest in group B (4.80 g / day), but there was no significant difference between groups. To determine the effect of fermentation on the liver weight of carbon tetrachloride and carbon tetrachloride, the weight per 100 g of body weight was measured. The weight per 100 g of body weight was higher in the group B treated with carbon tetrachloride alone, C in fermented water. However, there was no significant difference. Jeon and Park (Jeon JR, Park JR, 2002. Effect of Eucommia ulmoides leaf water extract on hepatotoxicity of carbon tetrachloride-induced rats. J Korean Soc Food Sci Nutr 31: 124-130) Lee, (Jung, YS, Lee, JC, Lee, SM, Shim, SB, 1998. A study on hepatoprotective effect of PS-1 from Artemisia iwayomogi. J Appl Pharmacol 6: 119-129) and Kim et al. 2008, Effects of carbon tetrachloride on liver lipid metabolism and hepatotoxicity in rats treated with carbon tetrachloride. In a study of the Korean Society of Food Science and Nutrition Vol. 37, No. 5, pp.548-554, This result is consistent with the results of this experiment. This result suggests that the fermented product may affect the recovery of liver damage.

Weight and liver weight in rats Groups ¹⁾ Initial body weight (g) Final body weight (g) Change of
body weight
(g / day) Liver
(g / 100 g body weight) A 132.03 + - 2.59 348.29 ± 15.14 5.15 + 0.34 2.87 ± 0.06 B 132.22 + - 5.46 333.88 +/- 14.67 4.80 + - 0.42 3.04 ± 0.14 C 132.09 + - 6.54 340.56 ± 32.42 4.97 ± 0.88 2.97 ± 0.29

(2) Measurement of hepatic enzymatic activity in rat

AST (SGOT), ALT (SGPT), ALP (alkaline phosphatase) and LDH (lactate dehydrogenase) activities were measured after 5 weeks of feeding. As a result (Table 7), serum AST, ALT, ALP and LDH activities were significantly increased in the carbon tetrachloride-treated group (B) compared to the normal group (A). Hepatic toxic substances such as carbon tetrachloride induce necrosis of hepatocytes and destruction of liver tissues, and increase of blood leaching of AST, ALT, ALP and LDH is increased. In this embodiment, it is found that carbon tetrachloride is impaired in liver function.

In the C group fed with the fermented food prepared in Example 2-1, the levels of AST, ALT, ALP and LDH increased by carbon tetrachloride administration were significantly decreased, indicating that the fermented food had an effect of improving liver function.

Liver enzyme activity in rat Group ¹⁾ AST ^* ALT ^*** ALP ^* LDH ^** A 93 ± 12 ^b 51 ± 5 ^b 349 ± 21 ^b 288 ± 72 ^b B 131 ± 14 ^a 65 ± 15 ^a 489 ± 60 ^a 527 ± 82 ^a C 95 ± 5 ^b 51 ± 5 ^b 369 ± 46 ^b 355 ± 93 ^b

Although the preferred embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims. It will be understood that the present invention can be changed.

Korea Biotechnology Research Institute KCTC12387BP 20130320

Claims (5)

delete delete delete delete 80 wt.% Of a functional ingredient consisting of rice bran, wheat germ, shiitake mugwort powder, mugwort powder, lotus powder, wool, silkworm, broccoli, sorghum powder, leek powder, ginger powder, ginger powder, coarse powder, ginseng powder, 20% by weight of drinking water is mixed at a speed of 35 rpm / min while being aged at 85 to 95 ° C for 4 to 8 hours;
An inoculation step of inoculating the microorganism preparation at 70 DEG C after the above-mentioned smoothing step so that the moisture content of the mixture containing the microorganism agent is 40 to 50 wt%;
Fermenting the fermenting microorganism by increasing the activity and homogenizing the fermenting microorganism at a rate of 10 rpm / min at 25 to 30 ° C. for 2 hours,
A fermentation completion step of repeating the fermentation step for 21 to 28 days to complete fermentation;
A drying step of drying the fermentation product obtained through the fermentation completion step at 50 to 60 DEG C for 8 to 10 hours; And,
And a pulverizing step of pulverizing the powder into powder having a size of 100mesh or less after the drying step,
The microbial agent
Separated from the group of complex microbial BM-S-1-A (accession number: KCTC 12387BP) Lactobacillus (Lactbacillus), Lactobacillus with unidentified species (Lactobacillaceae_uc), acetonitrile bakteo (Acetozbacter), ethanol Lee Regensburg (Ethanoligenens), Bay Ner 0.001-10% by weight of a microorganism belonging to one or more microorganisms selected from the group consisting of Lactobacillus casei (Veillonellaceae_uc), 0.5-10% by weight of rice bran, 0.5-10% by weight of saccharides and the balance of purified water to prepare a mixture step;
The mixture is aerated at 5 to 10 cm3 / min for 1.5 hours at a temperature of 20 to 25 DEG C for 6 hours and then quenched for 4.5 hours to be repeated four times a day for 10 days. And,
The composite microbial strain by taking a BM-S-1A complex strain (KCTC 12387BP) 1g was suspended in 0.9% Nacl 9ml, steps to create a diluted suspension was diluted to 10 ⁰ to ^10-7;
100 μl of the dilution suspension was plated on a PCA (Plate Count Agar) medium and cultured at 30 ° C;
Selecting the strains having different colony types from the cultured strains, subculturing the strains in TSA (Trypticase Soy Agar) medium at least three times, and separating into single colonies; Followed by liquid culture of a single colony.