WO2008069102A1

WO2008069102A1 - Prophylactic/therapeutic agent for inflammatory bowel disease

Info

Publication number: WO2008069102A1
Application number: PCT/JP2007/073086
Authority: WO
Inventors: Kazuhito Rokutan; Kenji Kusumoto; Hiromi Suzuki; Shigeru Fujiwara
Original assignee: Calpis Co., Ltd.
Priority date: 2006-12-06
Filing date: 2007-11-29
Publication date: 2008-06-12
Also published as: TW200836754A; JPWO2008069102A1; JP5199884B2

Abstract

Disclosed are: an agent for inhibiting the production of active oxygen from an intestinal epithelium cell; an agent for inhibiting the production of IL-8 from an intestinal epithelium cell; and a prophylactic and therapeutic agent for inflammatory bowel disease and/or irritable bowel syndrome, each of which comprises a fermentation product, a culture supernatant and/or a culture of a bacterium belonging to the genus Bacillus as an active ingredient. The bacterium belonging to the genus Bacillus is preferably Bacillus subtilis, more preferably Bacillus subtilis C-3102 (FERM BP-1096). The agent for inhibiting the production of active oxygen from an intestinal epithelium cell, the agent for inhibiting the production of IL-8 from an intestinal epithelium cell, and the prophylactic and therapeutic agent for inflammatory bowel disease and/or irritable bowel syndrome can be administered through an oral route and are useful for the treatment and prevention of diseases including ulcerative colitis, Crohn's disease and irritable bowel syndrome.

Description

Specification

Inflammatory bowel disease preventive and therapeutic agent

Technical field

[0001] The present invention relates to a novel prophylactic and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome, in particular, suppression of intestinal epithelial cell-derived reactive oxygen production and intestinal epithelial cell-derived IL by TNF-a stimulation of intestinal epithelial cells. -8 production inhibitor is provided. The prophylactic and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome of the present invention can be given by the oral route, such as inflammatory bowel diseases such as ulcerative colitis and Crohn's disease in the human digestive tract! /, Which prevents irritable bowel syndrome, which is related to inflammation, and improves symptoms such as bloody stool, melena, abdominal pain, weight loss, and loss of appetite associated with these diseases, and Various symptoms such as constipation, diarrhea, gas and abdominal pain associated with the disease can be prevented, treated or ameliorated. Background art

[0002] Typical diseases of inflammatory bowel disease (IBD) include ulcerative colitis (UC) and Crohn's disease (CD). The number of cases is also increasing. These diseases are mainly caused by inflammation and ulcers in the intestinal tract, which are mostly affected by young people in their 10s and 20s. Symptoms have been reported such as growth retardation, straight bowel, iron deficiency, anemia, exhaustion, malaise, fever and weight loss in schoolchildhood. Moreover, it is known that the transition to colon cancer occurs frequently. The etiology is unknown at present, and it is an intractable disease that repeats relapse and remission. Based on clinical findings and analysis using knockout mouse models, tissue damage in these diseases resulted in the breakdown of mucosal immune tolerance and activation of immunocompetent cells against antigens present in various intestinal lumens, including enteric bacteria. It has been suggested to be triggered. In addition, overproduction of inflammatory site force-in derived from macrophages has been observed. On the other hand, no clinically established effective treatment is currently available, and nutritional therapy, sulfa drugs, steroids, use of 5-ASA derivatives, pharmacotherapy, immunosuppressants, etc. Has been studied.

[0003] On the other hand, the prevalence of irritable bowel syndrome (IBS) is 10-15% of the general population, Estimated 1-2%. In major civilized countries, irritable bowel syndrome has a significant impact on medical expenses. In addition, there is a significant economic loss due to a decline in quality of life (QOL) due to irritable bowel syndrome. In addition to psychological control, therapies are treated according to symptoms such as anticholinergic agents, laxatives, intestinal agents, mucosal palsy agents, autonomic nerve regulators, anxiolytics, antidepressants, hypnotics, antipsychotics, etc. There are gradual drug therapies. Side effects of these drugs are a problem.

[0004] Molecular biological techniques have also been applied to the treatment of inflammatory bowel disease, and anti-site force-in therapy has been applied to cut off inflammation. Although these therapies are effective, caution is required for side effects!

[0005] The onset and relapse of inflammatory bowel disease may have a genetic predisposition and a synergistic effect with the influence of environmental factors such as diet and intestinal bacteria. It is thought to have a great influence. In recent years, the causal relationship between enterobacteria, particularly Bacteroides spp., And inflammatory bowel disease has been highlighted, and prebiotics that are effective in treating diseases and have no side effects have attracted attention. Correcting the balance of internal bacteria and controlling the mucosal defense mechanism are considered to be new therapeutic strategies. It has also been reported that lactic acid bacteria Lactobacillus gasseri have a protective effect against the pathology of ulcerative colitis (Japanese Patent Laid-Open No. 2003-95963).

[0006] The cause of these inflammatory bowel diseases is the ability to cause abnormalities in the immune system, such as abnormalities in the production of cytodynamic force associated with intestinal mucosal immune system regulation, and little has been elucidated. . However, in the active intestinal mucosa, tumor necrosis factor (TNF-a) produced by macrophages, interleukins IL-1, IL-6, IL-8, interferon _Ί and other inflammatory site forces in are produced in excess. It has been made clear. Inhibitors of inflammatory site force-in such as TNF-a and IL-8 have the effect of regulating the immune system. It is thought to improve symptoms.

[0007] For these reasons, elucidation of the onset mechanism of inflammatory bowel disease and development of a safe and effective prophylactic and therapeutic agent for inflammatory bowel disease are desired.

[0008] References cited in the present specification are as follows. Described in these documents All the contents to be referred to are hereby incorporated by reference. Any force ^S of these documents is not an admission that it is prior art with respect to this specification.

Patent Document 1: JP 2003-95963 A

Disclosure of the invention

Means for solving the problem

[0009] The present inventors have reported that Bacillus subtilis bacteria, particularly C-3102 cells and / or their fermentation products, inhibit intestinal epithelial cells! And the present invention was completed by finding that it has an IL-8 production inhibitory action.

[0010] The present invention relates to an inhibitor of production of active oxygen from intestinal epithelial cells and IL-8 from intestinal epithelial cells, comprising as an active ingredient a fermentation product, culture supernatant, or culture of a bacterium belonging to the genus Bacillus. A production inhibitor is provided. In another aspect, the present invention relates to a prophylactic and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome, comprising a fermentation product, culture supernatant, or culture of a bacterium belonging to the genus Bacillus as an active ingredient. I will provide a. Preferably, the bacterium belonging to the genus Bacillus is Bacillus subtilis, more preferably Bacillus subtilis C 3102 (FERM BP-1096). Also preferably, the inflammatory bowel disease is ulcerative colitis.

In the present specification, the “culture” refers to a mixture containing bacterial cells, a medium, and a fermentation product obtained by culturing a bacterium belonging to the genus Bacillus in an appropriate medium. “Fermentation product” refers to a portion of the culture other than the cells, and includes a preparation obtained by removing cells from the culture. In addition, “fermented products” include those obtained by extracting fermented product containing substances other than cells from the culture. In particular, a “fermentation product” when a liquid medium is used is referred to as “culture supernatant”. “Fermentation product” and “culture supernatant” can be obtained by means usually used in the technical field for removing cells from the culture, for example, filtration or centrifugation. It should be noted that fermentation products and culture supernatants do not mean that cells or fragments thereof do not exist at all when obtained by an operation such as centrifugation.

Brief Description of Drawings

[0012] FIG. 1 shows the effect of pretreatment with viable C-3102 on the enhancement of 0-production by stimulation with TNF-α in a human colon cancer-derived cell line. [FIG. 2] FIG. 2 shows the effect of pretreatment of C-3102 viable, dead, and culture supernatants on the enhancement of 0 ₂ — production by TNF-α stimulation in a human colon cancer-derived cell line.

FIG. 3 shows the effect of pretreatment of the C-3102 culture supernatant on the enhancement of 0-production by TNF-α stimulation in a human colon cancer-derived cell line.

[FIG. 4] FIG. 4 shows the effects of viable, dead, and culture supernatants of C-3102 on TNF-stimulated IL-8 mRNA expression in a human colon cancer-derived cell line.

FIG. 5 shows the results of examining the effect of C-3102 culture supernatant on TNF-α.

[FIG. 6] FIG. 6 shows changes in body weight of DSS-induced ulcerative colitis model rats fed with a diet supplemented with C-3102 strain soybean culture.

FIG. 7 shows the incidence of symptoms such as bloody stool and melena in DSS-induced ulcerative colitis model rats fed a diet supplemented with a C-3102 strain soybean culture.

FIG. 8 shows the expression rate of IL-8 in plasma of a DSS-induced ulcerative colitis model fed with a diet supplemented with a C-3102 strain soybean culture.

[FIG. 9] FIG. 9 shows the change in body weight of DSS-induced ulcerative colitis model rats fed with a diet supplemented with C-3102 strain soybean culture.

[FIG. 10-1] FIG. 10-1 shows the incidence of symptoms such as bloody stool and melena in DSS-induced ulcerative colitis model rats fed a diet supplemented with C-3102 strain soybean culture.

[Fig. 10-2] Fig. 10-2 shows the incidence of symptoms such as bloody stool and melena in DSS-induced ulcerative colitis model rats fed a diet supplemented with C-3102 strain soybean culture.

BEST MODE FOR CARRYING OUT THE INVENTION

[0013] Bacillus spp. (Including Bacillus subtilis) are old and are deeply involved in human diet, and there is much information on their functionality, but they are effective in preventing and treating inflammatory bowel disease That hasn't been reported yet!

[0014] In the present invention, as shown in the following examples, it is demonstrated that a culture of bacteria belonging to the genus Bacillus exhibits a prophylactic effect for treating ulcerative colitis in a DSS (Dextran Sulfate sodium) model. It was done. In addition, transient inflammation of the large intestine is known to lead to the development of symptoms of irritable bowel syndrome by altering the sensory function of the organ, and a study in rats that evaluates the response of autonomic nerves by colorectal dilatation. TNBS (T rinitrobenzene Sulfonic Acid) has been used (Adam B, et al., 2006, Pain 123 (1-2): 179-86). This reagent, as well as DSS, is used in the ulcerative colitis test system! (Charles O. Elson, et al., 1995, Gastroenterology 109: 1344-1367) and the Bacillus according to the present invention. Bacterial cultures belonging to the genus are considered to have a therapeutic / preventive effect on irritable bowel syndrome.

That is, in the present invention, it was revealed that Bacillus subtilis C-3102 has a preventive or therapeutic effect on inflammatory bowel disease and irritable bowel syndrome. In addition, it was found that the culture supernatant of C-3 102 exhibits an inhibitory action on reactive oxygen and IL-8 production caused by TNF-a stimulation on human colonic epithelial cells. As shown in the examples below, in human colon epithelial cells pretreated with the culture supernatant fraction of Bacillus subtilis C-3102 strain, IL-8 mRNA expression by TNF-α stimulation was suppressed, Anti-inflammatory effect was observed. In addition, when the culture supernatant was reacted with TNF-a in advance at 37 ° C, suppression of 0- production and IL-8 mRNA expression by TNF_a stimulation were suppressed. This suggests that factors secreted extracellularly by C-3102 are involved in neutralizing the action of TNF-α, an inflammatory site force-in.

[0016] The preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome of the present invention comprises a bacterial culture belonging to the genus Bacillus, preferably a culture of Bacillus subtilis as an active ingredient. It is characterized by including. The bacteriological properties of Bacillus subtilis are described in, for example, Virgie's' Manual 'Ob' Batterology 1 Vol. 11 (1986), and specifically have the following characteristics.

(1) Gram Yo Jusei

(2) Oval spore formation

(3) Neisseria gonorrhoeae

(4) Mobility: Yes

(5) Aerobic

(6) Catalase: positive

(7) Growth at 50 ° C: +

(8) Growth at pH 5.7: + (9) Use of citrate: +

(10) Presence or absence of acid generation from sugars: arabinose, glucose, xylose, mannitol: +

(11) VP reaction: +

(12) Starch hydrolysis: +

(13) Reducibility of nitrate: +

(14) Generation of indole:

(15) Gelatin hydrolysis: +

(16) Casein hydrolysis: +

(17) Film formation in liquid medium: +

(18) Milk coagulation:

(19) Milk peptone: +

[0017] Examples of Bacillus subtilis used in the preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome of the present invention include, for example, Bacillus subtilis C-3102 strain (Biotechnology Industrial Technology Research Institute deposit number FERM BP). — 1096, deposit date 25 December 1985).

[0018] Bacillus subtilis can be obtained, for example, by the method described in JP-A-63-209580. The medium can be cultured using a liquid medium or a solid medium containing a carbon source, a nitrogen source, an inorganic substance and the like that are usually used for microbial culture. As the carbon source, any carbon source that can be assimilated by Bacillus subtilis should be used, for example, glucose, fructose, sucrose, starch, molasses, etc., and as the nitrogen source, for example, peptone, casein hydrolyzate, meat The ability to list extracts, ammonium sulfate, etc. Furthermore, if necessary, salts such as phosphoric acid, potassium, magnesium, calcium, sodium, iron and manganese, vitamins, amino acids, surfactants and the like can be added. In addition to these synthetic media, culture may be performed using natural product-derived substances such as soybean oil cake. As culture conditions, aerobic conditions are preferred. For example, aeration and agitation liquid culture with a jar mentor, shelf-type solid culture, and automatic fermenter culture temperature is 20-50 ° C. In particular, the culture time of 30 to 45 ° C. is preferably 12 hours to 7 days, and the initial pH of culture is pH 5 to 9, particularly preferably pH 6 to 8. [0019] The culture thus obtained may be used as it is, or the culture may be concentrated and used. Alternatively, the fermentation cells or the culture supernatant may be prepared by separating the cells from the culture by filtration, centrifugation, extraction or the like. Furthermore, excipients or the like may be added to these cultures, fermentation products, or culture supernatants, and used as preparations such as dry powders, granules, and tablets. In a particularly preferred embodiment, Bacillus subtilis is cultivated and cultivated using a natural product-derived substance suitable for edible use such as soybean oil cake, boiled soybean, boiled soybeans, cooked rice, barley rice, wheat bran, boiled corn, and other cereals. It is added to food as it is without separating the cells from the food.

[0020] The preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome of the present invention is used in foods and drinks as food additives that may be administered in the form of liquids, powders, granules, tablets and the like. May be taken in combination. Examples of the food and drink include beverages, confectionery tablets, pastes, breads, processed fish products, and dairy products. The preventive and therapeutic agents for inflammatory bowel disease and / or irritable bowel syndrome of the present invention can be added to these various food materials to provide health drinks, health foods or functional foods.

[0021] The contents of all patents and references explicitly cited herein are hereby incorporated by reference as part of the present specification. In addition, the contents described in the specification and drawings of Japanese Patent Application No. 2006-329596, which is the application on which the priority of the present application is based, are cited herein as part of this specification.

Example

[0022] Hereinafter, the present invention will be described in more detail with reference to examples. The present invention is not limited to these examples.

[0023] Example 1. Verification of the effect of Bacillus subtilis C-3102 strain on human colonic epithelial cells

In the following Examples, Bacillus subtilis C 3102 strain (Deposit number FERM BP-1096, Deposit date: December 25, 1985) was used as an example of bacteria belonging to the genus Bacillus. The Bacillus subtilis C-3102 soy culture has the effects of improving the gut microbiota, increasing body weight, protecting against infection, strengthening eggshell, improving meat quality, improving stool odor, etc. (Exclusion 4-24022). In addition, the health effects of this strain are known to include bowel regulation and reduction of intestinal spoilage products. (Journal of Enterobacteriaceae Society Vol. 18, No. 2, 93-99 (2004)).

[0024] Bacillus subtilis C 3102 is characterized in that a fragment of about 700 bps is amplified when PCR reaction is carried out using PCR primers of the following sequence 1 and sequence 2. In other Bacillus subtilis, amplification does not occur with this PCR primer. The approximately 700 bps fragment grown in Bacillus subtilis C-3102 has the characteristic of not having homology with the amylase sequence and is clearly distinguished from other Bacillus subtilis. No. 1) No. 2)

[0025] Furthermore, Bacillus subtilis C-3102 strain has the following properties:

(1) No plasmid DNA.

(2) The digestion pattern when genomic DNA was prepared, digested with restriction enzyme Not or Sfil and separated by agarose electrophoresis is shown in Fig. 1.

(3) Produces B.cerous antibacterial substances.

(4) Not resistant to ampicillin, chloramphenicol, ciprofloxacin, erythromycin, gentamicin, kanamycin, linezolid, quinupristin / dalfopristin, rifampine, streptomycin, tetracycline, trimethoprim, vancomycin! /, (V, minimum deviation is 0.03-4 ag / ml).

[0026] The viable, dead, and culture supernatant fractions of Bacillus subtilis strain C-3102 were effective in inhibiting the inflammation of colonic epithelial cells induced by TNF-a, and the induction of reactive oxygen and site force-in. Was used as an index.

[0027] Material Method

(A) Cell

The cell used was a T84 cell line derived from human colon cancer. Culture is performed using DMEM / HAM-F12 (l: 1) mixed medium (DF) supplemented with 5% fetal calf serum (FCS), 100 g / ml streptomycin, and 100 U / ml penicillin. T84 cells were seeded in 24-well culture plates or 35 mm culture dishes and cultured for 2 days at 37 ° C in a 5% CO 2 atmosphere. Later cells were used.

[0028] (B) Preparation of C_3102 freeze-dried bacterial powder

Strain C-3102 was isolated and cultured in TS medium (Tripticase Soy Broth: BBL ^ t + 2% agar) at 37 ° C- 晚, and the resulting colonies were 5 ml of TS broth (medium excluding the above-mentioned medium agar). Inoculated and incubated at 37 ° C—spider culture was used as a Balta starter. 3 ml Baltastater was added to 300 ml TS broth, and the cells were collected by centrifugation (7000 rpm, 20 min) after 37 ° C-shaking culture. The collected pellet was washed with sterile water, and the pellet obtained by centrifugation again was frozen overnight and then lyophilized. The bacterial powder thus obtained was dissolved in (1) viable C_3102 (L): bacterial powder by adding serum-free DF and stirring for 15 minutes with a vortex mixer. (2) C_3102 dead bacteria (HK): After the live bacteria were treated at 100 ° C for 5 minutes, centrifuged at 1,000 X g for 15 minutes, DF was added to the pellet again, and the mixture was stirred and dissolved with a vortex mixer. (3) C_3102 culture supernatant (CM): The culture supernatant of bacteria cultured for 24 hours in serum-free DF was filtered through a 0.2 m filter. It was prepared by the above three methods.

[0029] (Processing conditions and conditions of C-3102

T84 cells cultured for 2 days in a 37 ° C, 5% CO 2 atmosphere were washed 5 times with PBS and replaced with serum-free DF. One hour later, C-3102 live bacteria (L) or dead bacteria (HK) were added to a concentration of 0-2 cfo per T84 cell. To the culture supernatant (CM), a supernatant obtained by culturing viable C-3102 for 24 hours was added in an amount corresponding to a concentration of 0 to 2 cfo ell.

[0030] (D) TNF-a processing conditions

Human recombinant TNF-α (R & D systems) was added at a concentration of 20 ng / ml to T84 cells cultured in a 24-well culture plate or 35 mm culture dish.

[0031] (E) Measurement of superoxide two-on (0-)

The cells were cultured in a 24-well culture plate, pretreated for 2 hours with viable bacteria (L), dead bacteria (HK) or culture supernatant (CM) of C-3102, and stimulated with TNF-α. After 24 hours, the cells were washed 5 times with HBSS, cytochrome c (lmg / ml) + PMA solution was added, and the cells were incubated at 37 ° C. in a 5% CO 2 atmosphere for 1 hour. The absorbance (550 nm) of the reaction solution was measured, and the remaining cells were washed 3 times with HBSS, and the protein was quantified using the modified Lowry method. The amount of 0— produced per well was calculated and expressed as nmol / mg-protein / h. [0032] (F) RT-PCR

Cells cultured in a 35 mm culture dish and treated with TNF-a were washed 3 times with PBS, and RNA was extracted using ISOGEN (Nibonbon Gene, Toyama). The obtained RNA (1 g) was reverse-transcribed using TA KARA RT-PCR kit (Takara, Tokyo). The obtained reverse transcription product was prepared as follows: sense primer 5, _TTGGCAGCCTTCCTGATTT CT-3, (SEQ ID NO: 3); antisense primer, 5, TTTCCTTGGGGTCCAGACAG A-3 '(SEQ ID NO: 4); PCR was performed using seraldehyde triphosphate dehydrogenase (GAPDH) sense primer, 5, TCATGACCACAGTCCATGCCATCACT-3, (SEQ ID NO: 5), and antisense primer 5- GCCTGCTTCACCACCTTCTTGATGT-3 '(SEQ ID NO: 6).

[0033]

(A) Effect of pretreatment of viable bacteria on enhancement of 0- production after stimulation with TNF-a

T84 cells cultured in a 24-well culture plate were pretreated with 0-2 cfo ell viable bacteria (L) for 2 hours, and then 20 ng / ml TNF-α was added. 0-production from T84 cells was not affected by pretreatment with virulent bacteria (L) enhanced by TNF-α stimulation. In 2cfo ell, cells were damaged, and it was considered that 0-production was enhanced as the number of cells decreased (Fig. 1). These results suggest that pretreatment with viable bacteria (L) does not affect the enhancement of 0-production by TNF-α stimulation.

[0034] (B) Effect of pretreatment of viable, dead, and culture supernatants on enhancement of 0— production by TNF-a stimulation

Next, the same study was performed on dead bacteria (HK) and culture supernatant (CM). T84 cells cultured in a 24-well culture dish were pretreated for 2 hours with 0.5 liters of viable bacteria (L), dead bacteria (HK) and culture supernatant (CM), and then 20 ng / ml TNF-α was added. Added. 0— was enhanced by TNF-a stimulation (M) compared to no treatment (as compared to). As a result of examining the effects of 2 hours of pretreatment, the viable bacteria had no effect on the production of 0—. The killed bacteria (HK) were unable to measure 0- because the cells were severely damaged and the cells were peeled off, but the culture supernatant (CM) significantly suppressed the production of 0- by stimulation with TNF-a. Then! /, (Figure 2).

[0035] (C) Effect of pretreatment of culture supernatant on enhancement of 0— production by TNF-a stimulation The concentration at which the inhibitory effect by the culture supernatant (CM) was observed was examined below. 24-well T84 cells cultured in a Lucy dish were pretreated with 0.05-lcfoell culture supernatant (CM) for 2 hours, and then 20 ng / ml TNF-α was added. 0— was enhanced by TNF-α stimulation (Μ) compared to no treatment (N). A significant 0-production inhibitory effect was observed from the concentration of 0.05cib ell of culture supernatant (Fig. 3).

From the above results, it was suggested that the culture supernatant (CM) of C-3102 suppresses the production of 0- by TNF-α stimulation in T84 cells.

[0036] (D) Effects of viable, dead, and culture supernatants on IL-8 mRNA expression induced by TNF-stimulation

Furthermore, we examined the effects of pretreatment of viable, dead, and culture supernatants on the expression of IL-8 mRNA in inflammatory site force-in by TNF-stimulation! 20 ng / ml TNF-a was added to T84 cells cultured in a 35 mm culture dish, and IL-8 mRNA expression was analyzed over time using the RT-PCR method. When T84 cells were subjected to TNF-α stimulation, IL-8 mRNA was expressed from 1 hour and peaked at 3 hours. Add TNF- at a concentration of 20 ng / ml for 3 hours to cells pre-treated with live bacteria (L), dead bacteria (HK), and culture supernatant (CM) for 2 hours at a concentration of 0.5 cfo ell. Later IL-8 mRNA was analyzed. IL-8 mRNA expression was not observed in cells that had been pretreated for 2 hours with live bacteria (L) or culture supernatant (CM) alone, and IL-8 mRNA expression in dead bacteria (HK) It was observed. This was thought to be due to the absence of production of anti-inflammatory components in killed bacteria (HK). Furthermore, the same experiment was repeated, and those pretreated with culture supernatant (CM) suppressed IL-8 mRNA expression, strongly suggesting that the product has an anti-inflammatory effect. From the above results, it was clarified that the culture supernatant (CM) acts to suppress the expression of IL-8 mRNA by TNF-a stimulation.

[0037] (E) Inhibition of IL-8 mRNA expression by pretreatment of culture supernatant (CM)

Furthermore, the effect of pretreatment with this culture supernatant (CM) on the suppression of IL-8 mRNA expression was examined in detail. When T84 cells were pretreated with culture supernatant (CM) for 2 hours, the cells were washed, and TNF-a was added (CM-re), IL-8 mRNA expression was not suppressed. This suggested that the culture supernatant (CM) did not act on T84 cells. Moreover, T84 cells were pretreated for 2 hours with culture supernatant (CM) treated at 100 ° C for 5 minutes (b-CM), and TNF-a was added to analyze IL-8 mRNA expression. No inhibitory effect was seen. this This suggests that factors secreted in the culture supernatant (CM) may neutralize TNF-α activity (Fig. 4). These findings suggest that the mechanism by which culture supernatant (CM) suppresses IL-8 mRNA expression is different from existing anti-inflammatory factors such as SOD and peptides!

[0038] We examined whether the culture supernatant itself acts directly on TNF-a! /.

Was added in advance culture supernatant and TNF-a was mixed with 37 ° C for 2 h incubation also were reacted in the (CM + TNF- a) to T8 ⁴ cells, expression was analyzed IL-8 mRNA ( B). Expression of IL-8 mRNA was suppressed when the culture supernatant and TNF-a were mixed and incubated in advance. Similarly, DF and TNF-a incubated at 37 ° C for 2 hours (M + TNF-a) showed no inhibitory effect. Furthermore, IL-8 mRNA expression was not completely suppressed even when the culture supernatant and TNF-a were added simultaneously. These results suggest that some factor secreted in the culture supernatant of C-3102 acts on TNF-α to suppress the spread of inflammation! Five).

[0039]

As an ulcerative colitis model animal, a rat fed with dextran sulfate sodium was used. Add 5Kg of tap water to 5Kg of soybean oil residue and sterilize at 121 ° C for 120 minutes, and take the culture solution of Bacillus subtilis C_310 (FERM BP-1096) that has been cultured in advance. What was cultured at 37 ° C for 40 hours was dried and pulverized to obtain a C-3102 strain soybean culture. This was mixed (about 1%) with CE-2 (Japan Claire) powdered feed (2.5 × 10 ⁸ cfo / g). 5-week-old male Sp rague Dawl _ey (IGS) rats (10 animals per group), was about to 1 week libitum feed. In the control group, soybean oil residue granulated product, which is the base of the fungus powder, was pulverized with a pulverizer and mixed with CE-2 powdered feed in the same amount as in the test group. Dextrane sodium sulfate (molecular weight 5000, sulfur content 15.0-20.0%, Wako Pure Chemical Industries, Ltd.) was administered as drinking water (3% w / v) during the control and test diets.

[0040] During the study period, body weight, fecal properties, and plasma IL-8 (CINC_1 IL-8: Panafarm Laboratories) were measured, and the animals were sacrificed and dissected the day after the last administration of the test meal. Spleen weight, colon length and cecal weight were measured. Fig. 6 shows changes in body weight, Fig. 7 shows stool properties, and Fig. 8 shows IL-8 in plasma. Table 1 shows the anatomical data. The star in Fig. 7 is 0.01 for the test food group compared to the number of days administered in the control group (bonferrous adjusted% 2 test). Shows significant difference. In FIG. 7, ☆ indicates a significant difference in the test food group with a p value of 0.05 (bon ferro two-adjusted 2 test) with respect to the number of days in the control group.

[table 1]

p 0. 01 '* p <0

[0042] There was no difference between the two groups in the amount of water consumed and the amount of food consumed. The strength and weight of the test food group were significantly higher than those in the control group, and there were significant differences on the final day. (p <0.05) (Figure 6). Regarding stool properties, blood stool strength was observed in the control group on day 3 of day, and in the test food group, a significant difference in stool properties was observed on days 4, 5, 6, 7, and 8. (Figure 7). The length of the colon is significantly longer in the test meal group (p 0.01). The weight of the cecum after washing per 100 g of rat body weight was also significantly light (P 0.05) (Table 1). In addition, a decrease in plasma IL-8 was observed in the test meal group (Fig. 8), suggesting the possibility of suppression of the inflammatory response. From these results, it was confirmed that C-3102 has an excellent protective effect against the pathogenesis of colitis induced by DSS.

[0043] m.

In Example 2, since the anti-inflammatory effect was observed in the C-3102 strain soybean culture, it was examined whether the effective component was present in the bacterial cells, the fermentation product, or the culture supernatant component. In addition, by heating the water extract obtained by mixing the C-31 02 soybean culture with water and centrifuging it, the components with protease activity are deactivated, which affects the anti-inflammatory effect. I investigated whether or not. The animals used and the test method are the same as in Example 2. There are 4 rats per group, and the test diet is CE-2 powder feed.

(1% of C-3102 strain soybean culture added <Fig. 9 03102, Fig. 10 03102>) (2) Mix the same amount of C-3102 strain soybean culture as above (1) with water and centrifuge it Separation gave a water extract that was lyophilized and added. t>,

(3) The same amount of the C-3102 strain soybean culture as above (1) was mixed with water and centrifuged to obtain a water extract. This water extract was heated at 100 ° C for 5 minutes, then lyophilized and added. Fig. 9 Protease-, Fig. 10 Heated extract ^ ^

(4) A C-3102 strain soybean culture was mixed with water in the same amount as (1) above, and centrifuged to obtain a water extract. Fig. 9 residue, Fig. 10 residue

(5) Figure 1 Cont, Fig. 10 Control>

Either feed was prepared and given. For the control group, the same control food used in Example 2 was given. Protease activity was measured using Protease Assay Kit (PIERCE). The change in body weight is shown in FIG. 9, and the change in fecal properties is shown in FIG. There was no significant difference between groups in the change in body weight. Mix the 1% added amount of C-3102 soybean culture with water and centrifuge to give a lyophilized water extract (above (2) with protease activity). The calorie heat treatment (above (3) · no protease activity) group had the same degree of inflammation as the control group (above (5)-Control). The active ingredient that indicated

Yes

As shown in Examples 2 and 3 above, in the ulcerative colitis model test! /, By adding 1% C-3102 strain soybean culture to the feed, changes in body weight, bloody stool and As shown by the incidence of melena, the anti-inflammatory effect in colon tissue, and the decrease in plasma IL-8 concentration, it was found that colitis was suppressed. Furthermore, in Example 3, an anti-inflammatory action was confirmed in the aqueous extract of Bacillus subtilis C-3102 soybean culture, and this action was lost by heating the aqueous extract. These results suggest that the culture, fermentation products, and culture supernatant of the C-3102 strain have the effect of suppressing the inflammatory response of colonic epithelial cells induced by TNF-α stimulation. Based on the above results, highly effective inflammatory bowel disease and / or irritability that can be administered orally by using cells of Bacillus subtilis C-3102 or its culture, fermentation product, and culture supernatant. Prevention of bowel syndrome • It is possible to provide therapeutic agents.

Claims

The scope of the claims

[I] An inhibitor of active oxygen production from intestinal epithelial cells, comprising as an active ingredient a fermentation product of a bacterium belonging to the genus Bacillus.

[2] The active oxygen production inhibitor according to claim 1, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis.

[3] The active oxygen production inhibitor according to claim 1 or 2, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis C-3102 (FERM BP-1096).

[4] An inhibitor of IL 8 production from intestinal epithelial cells, comprising as an active ingredient a fermentation product of a bacterium belonging to the genus Bacillus.

[5] The IL 8 production inhibitor according to claim 4, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis.

6. The IL 8 production inhibitor according to claim 4 or 5, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis C-3102 (FERM BP-1096).

[7] A preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome, comprising a fermentation product of bacteria belonging to the genus Bacillus as an active ingredient.

[8] The preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome according to claim 7, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis.

[9] The preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome according to claim 7 or 8, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis C-3102 (FERM BP-1096).

10. The preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome according to any one of claims 7 to 9, wherein the inflammatory bowel disease is ulcerative colitis.

[I I] An inhibitor of production of active oxygen from intestinal epithelial cells, comprising as an active ingredient a culture supernatant of bacteria belonging to the genus Bacillus.

12. The active oxygen production inhibitor according to claim 1, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis.

13. The active oxygen production inhibitor according to claim 11 or 12, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis C-3102 (FERM BP-1096).

[14] An inhibitor of IL 8 production from intestinal epithelial cells, comprising as an active ingredient a culture supernatant of a bacterium belonging to the genus Bacillus.

15. The IL 8 production inhibitor according to claim 14, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis.

[16] The IL-8 production inhibitor according to claim 14 or 15, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis C-3102 (FERM BP-1096).

[17] A preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome, comprising a culture supernatant of bacteria belonging to the genus Bacillus as an active ingredient.

[18] The prophylactic and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome according to claim 17, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis.

[19] The prophylactic and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome according to claim 17 or 18, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis C-3102 (FERM BP-1096).

20. The preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome according to any one of claims 17 to 19, wherein the inflammatory bowel disease is ulcerative colitis.

[21] An inhibitor of production of active oxygen from intestinal epithelial cells, comprising a bacterial culture belonging to the genus Bacillus as an active ingredient.

[22] The active oxygen production inhibitor according to [21], wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis.

23. The active oxygen production inhibitor according to claim 21 or 22, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis C-3102 (FERM BP-1096).

[24] An inhibitor of IL 8 production from intestinal epithelial cells, comprising a bacterial culture belonging to the genus Bacillus as an active ingredient.

[25] The IL 8 production inhibitor according to claim 24, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis.

[26] The IL 8 production inhibitor according to claim 24 or 25, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis C-3102 (FERM BP-1096).

[27] Inflammatory bowel disease and / or hypersensitivity comprising a culture of bacteria belonging to the genus Bacillus as an active ingredient Prophylactic and therapeutic agent for sexual bowel syndrome.

[28] The prophylactic and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome according to claim 27, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis.

[29] The prophylactic and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome according to claim 27 or 28, wherein the bacterium belonging to the genus Bacillus is Bacillus subtilis C-3102 (FERM BP-1096).

[30] The preventive and therapeutic agent for inflammatory bowel disease and / or irritable bowel syndrome according to any one of claims 27 to 29, wherein the inflammatory bowel disease is ulcerative colitis.