KR100898731B1 - DNA markers using leptin receptor gene and uses thereof - Google Patents

Abstract

The present invention relates to molecular markers using obesity-related genes and their use in animal quality control. More specifically, the present invention relates to a single gene within the transcriptional promoter region of a leptin receptor gene. Molecular markers of single nucleotide polymorphisms (SNPs) and their use in determining economic traits including pig fat, fat content and meat content. The molecular marker of the present invention is an important source technology in marker-assisted selection (MAS), which improves the method of selection of breeders based on the existing phenotype, and selects breeders and manages meat quality as well as discriminates parents. It can also be used effectively.

Obesity-related genes, transcriptional region of leptin receptor genes, single nucleotide polymorphisms (SNPs), marker assisted selection method (MAS), breeder selection method

Description

Molecular markers using leptin receptor gene and their use {DNA markers using leptin receptor gene and uses}

Figure 1 shows the analysis of the nucleotide sequence corresponding to the transcriptional promoter region of the leptin receptor gene (leptin receptor gene) used in the present invention.

Figure 2 shows the results of polymerase chain reaction-restriction enzyme fragment length polymorphism analysis (PCR-RFLP) using the restriction enzyme Bsa I using the molecular marker of the present invention.

The present invention relates to a molecular marker using an obesity-related gene and a use thereof for quality control of an animal, and more particularly, to a single base in a transcriptional promoter region of a leptin receptor gene. Molecular markers of single nucleotide polymorphism (hereinafter abbreviated as “SNPs”) and their use in determining economic traits, including back fat, fat content and meat content of pigs.

In Korea, the number of sows per year has gradually increased to 3,201 heads in 1997, 1,867 heads in 1999, 1,599 heads in 2000, and 1,414 heads in 2001, which wastes almost $ 2,474,000 in annual sow purchases. have. Therefore, there is an urgent need for the development of an assay technique that utilizes the genetic markers of the assay test U.S. pigs.

In addition, in recent years, semen income has surged to 2,964 in 2001, compared to 264 in 1997, and a plan to utilize domestic black cash is very important. Specifically, the total number of black pigs tested in Korea reaches 4,000 heads annually, and among them, black pigs (about 30 heads) having a selection index of 270 or more are recognized as super money. These black pigs are traded at three to four million won per head, maintaining prices about 10 times higher than those of ordinary pigs. They are auctioned to the public and used as breeders for artificial insemination.

In selecting these longitudinal axes, existing methods have used only selection formulas based on the phenotype. Recently, however, the selection or selection of variants using molecular markers is abbreviated as marker-assisted selection (“MAS”) not only for traits controlled by a single gene, but also for traits controlled by quantitative genetic loci. ) Can be effectively used through simulations. Therefore, the development of statistically significant molecular markers can be an essential source of technology for marker selection help (MAS).

Developed countries have already developed sowing genetic improvement programs and DNA markers for the search for good sows, and the practical use of molecular breeding methods for sows using DNA markers for meat quality, breeding traits, growth traits, genetic diseases and breed characteristics. The stage is reaching. Specifically, genes such as HAL, ESR, PRLR, KIT, RBP4, MCIR, MC4, RN, AFABP, HFABP and IGF2 are adopted by these sow companies and commercialized molecular markers. It is used to improve the breeding stock by analyzing the genotype. Current status of gene or molecular markers currently used in the pig industry is shown in Table 1.

Genetic and molecular markers used in the swine industry Genetic and molecular markers Related traits and fields of use Remarks Paternity - Non-exclusive use HAL Flesh Non-exclusive use ESR, PRLR, RBP4 Mountain embroidery Exclusive Use (PIC) KIT White hair Exclusive Use (PIC) MC1R Red / black hair Exclusive Use (PIC) MC4R Growth, obesity Exclusive Use (PIC) FUT1 Edema ( E. coli F18) Exclusive Use (PIC / ITH Switzerland) RN Flesh Non-exclusive use (Uppsala, INRA, Kiel) AFABP, HFABP Intramuscular fat Non Exclusive (IPG) PRKAG3 Flesh Exclusive (PIC) CAST year Exclusive (PIC) IGF2 Conductor composition Exclusive Use (Seghers)

  In this way, molecular markers can be used to evaluate heritability more accurately than 25-35% more than the selection effect by phenotypic evaluation. Therefore, it can be an important technique that can dramatically increase the amount of heredity improved.

In addition, information at the DNA level provides important information for selecting specific key variants for breeders as well as producers. Such DNA information can be utilized for selection of quantitative traits in a marker help selection method. This molecular marker enhances the accuracy of selection such as breeders, facilitates the selection of restricted traits in sex, and can be widely used for conductor traits such as meat. Indeed, several genes and markers are currently used in the swine industry.

 The present inventors found that mutations in the transcriptional region of the leptin receptor gene, one of the causes of obesity, affect the transcription of the leptin receptor gene and ultimately affect fat metabolism, such as obesity. A study was conducted on whether

Therefore, the present inventors have continued to develop a quality control method for breeders using molecular markers, and according to the above hypothesis, a variant is selected for the transcriptional regulatory region of leptin receptor genes in pigs and a single base associated with useful traits therefrom. The present invention has been successfully completed by discovering polymorphisms (SNPs) and developing them as various molecular markers required for swine marker help selection (MAS) technique.

 An object of the present invention is to provide molecular markers using obesity-related genes and uses for using them for selection methods of breeders.

In order to achieve the above object, the present invention provides a molecular marker for evaluating the expression traits of animals using obesity-related genes.

In addition, the present invention

(1) determine monobasic polymorphisms (SNPs) on specific loci of obesity related genes; And (2) analyzing the expression trait of the animal based on the analysis result; It provides a method of selecting a breeder using a molecular marker consisting of the process.

Hereinafter, the present invention will be described in detail.

The present invention provides a molecular marker for evaluating the expression traits of animals using obesity related genes.

The obesity-related gene is preferably a transcriptional region of the leptin receptor gene.

In addition, the molecular markers are preferably single nucleotide polymorphisms (SNPs), and the single nucleotide polymorphisms are -792, -303, -201, -618, -707 or -763 based on a transcription initiation base. It is preferable that it is at least one locus phase variation selected from among them, and it is more preferable that it is at least one locus phase variation selected from -792 or -303.
When the sequence described in FIG. 1 is converted to the position number of the attached SEQ ID NO. 3 based on the transcription start base, it is shown in Table 2 below.

In addition, the expression trait of the animal preferably includes the back fat, fat content and meat amount of the pig.

In addition, the present invention

(1) determine monobasic polymorphisms (SNPs) on specific loci of obesity related genes; And (2) analyzing the expression trait of the animal based on the analysis result; It provides a method of selecting a breeder using a molecular marker consisting of the process.

In the step (1), the obesity-related gene is preferably a transcriptional region of the leptin receptor gene, and the single nucleotide polymorphisms (SNPs) are -792, -303 based on the transcription start base. , At least one locus phase shift selected from -201, -618, -707 or -763, and more preferably at least one locus shift selected from -792 or -303.

In addition, the expression trait of the animal in the above (2) is preferably to include the back fat, fat content and the amount of meat of pigs, and can be widely applied to quality control of various meats.

In addition, the present invention (1) determines monobasic polymorphisms (SNPs) on specific loci of obesity related genes; And (2) identifying the subject based on the analysis result; It provides a method for judging an individual using a molecular marker that consists of processes.

In addition, the present invention (1) determines monobasic polymorphisms (SNPs) on specific loci of obesity related genes; And (2) discriminating paternity based on the results of the analysis; It provides a method for judging an individual using a molecular marker that consists of processes.

Molecular markers of the present invention can be widely used as an important source technology in marker-assisted selection (MAS), etc., which improves the method of selecting the longitudinal axis by the existing phenotype.

Hereinafter, the present invention will be described in more detail with reference to Examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example  One. Leptin  Isolation and Identification of Receptor Genes

In order to amplify the transcriptional regulatory region of the leptin receptor gene, a pair of primers of SEQ ID NO: 1 and SEQ ID NO: 2 (former: TTCCAGAAACATAAGACACGCG; reverse: GACCAATTCTAAATTTCAACCAGAGG) were used. For PCR reaction, PCR reaction buffer (500 mM KCl, 100 mM Tris-Cl, pH 8.2), 15 mM MgCl ₂ , 0.1% Triton X-100) (TaKaRa Co, Japan) 2.5 μl, 2.5 mM dNTPs 2 μl, 1 μl of 10 pmole primer, 25-50 ng of genomic DNA, 1 U Taq DNA polymerase (CoreBio) were added and filled with sterile distilled water to a final volume of 25 μl. PCR amplification reaction was repeated 35 times 94 ℃ 30 seconds, 53 ℃ 30 seconds, 72 ℃ 1 minutes 10 seconds after the denaturation reaction 94 ℃ 5 minutes, and the final extension reaction was performed for 10 minutes at 72 ℃ after amplification. After the PCR was completed, 5 μl PCR product was electrophoresed on 1.2% agarose gel to confirm amplification. On the other hand, in order to determine whether the amplification product corresponds to the leptin receptor gene, after determining the nucleotide sequence of the gene was compared with the DNA sequence was confirmed that the desired leptin receptor gene.

Figure 1 shows the analysis of the nucleotide sequence corresponding to the transcriptional promoter region of the leptin receptor gene (leptin receptor gene) used in the present invention. The underlined portion is the region corresponding to exon 1, where the CTT sequence corresponds to C +1.

Example  2. Single base Polymorphic  Selection and Confirmation

In order to select single nucleotide polymorphisms (SNPs) in the transcription control region of the leptin receptor gene, the present invention provides amplification product purification kit (PCR purification kit; Purified using CoreBio PPHTS-30). Direct sequencing was then performed using the BigDye Terminator ver3.1 Cycle Sequencing Kit (Applied Biosystems) and the ABI 3730XL DNA sequencer (Applied Biosystems).

      The base sequence determined for each individual was searched for a single base polymorphism in the DNA base sequence through the multi-align using the SeqMan program. As shown in Table 3, 19 monobasic polymorphisms were detected. The frequency of the allele for the 19 SNP loci varied as shown in Table 3, and the frequency of the few alleles in the 7 loci was estimated to be about 1% and was skewed to one side.

Mononucleotide polymorphisms (SNPs) in the transcriptional regulatory region of the leptin receptor gene SNP position ^a Allele (1/2) ^b Allele frequency One 2 -91 A / C 0.55 0.45 -132 G / A 0.99 0.01 -201 G / A 0.99 0.01 -203 C / T 0.62 0.38 -230 A / T 0.99 0.01 -303 T / C 0.90 0.10 -324 A / C 0.91 0.09 -378 A / G 0.99 0.01 -468 C / T 0.90 0.10 -474 A / G 0.99 0.01 -549 G / A 0.99 0.01 -618 C / A 0.99 0.01 -681 C / T 0.91 0.09 -707 A / G 0.91 0.09 -717 C / A 0.79 0.21 -744 C / A 0.68 0.32 -763 C / T 0.78 0.22 -792 C / G 0.71 0.29 -864 G / C 0.62 0.38

Example 3 Analysis of Correlation of Monobasic Polymorphs with Expressed Traits

 In the present invention, as a result of analyzing the correlation between 19 single base polymorphisms and traits found in the transcriptional control region of the leptin receptor gene, as shown in Table 3, the locus significantly related to the meat removal rate is based on the transcription start base (+ 1), -1, -618, -707, and -763 were found to have high statistical significance at the 1% level, and -303 and -792 were identified at the 5% level. In addition, the locus with significant backfat thickness was -792 locus. In particular, the -792 locus was considered to be a useful locus as a marker that was significant in backfat thickness and meat removal rate. As shown in Table 4 and Table 5, the GG genotype was found to have a thicker back fat and a lower meat content than the CC genotype. Therefore, it would be advantageous not to select individuals with G alleles when selecting sows.

Statistics of economic traits according to genotype of SNP (-792) (Minimum square mean ± standard error)            Observation Economy Oil pen CC CG GG N = 315 N = 250 N = 57 Daily gain (g) 1116.36 ± 5.27 1121.34 ± 5.89 1123.11 ± 11.92 Feed efficiency 2.25 ± 0.01 2.24 ± 0.01 2.26 ± 0.02 Back fat thickness (cm) 1.30 ± 0.01 ^a 1.32 ± 0.01 ^ab 1.37 ± 0.02 ^b Meat percentage (%) 57.38 ± 0.16 ^a 57.12 ± 0.18 ^a 56.32 ± 0.35 ^b

^{a, b} (P <0.05)

Significance test results for mean and standard deviation and restriction enzymes of SNPs and traits in the transcriptional regulatory region of leptin receptor gene Mold quality castle Mean ± Standard Deviation Probability -91 -132 -201 -203 -230 -303 -324 -378 -468 -474 Back fat (cM) Number 54.83 ± 4.34 0.56 (363) 0.91 (363) 0.57 (342) 0.77 (342) 0.45 (338) 0.60 (338) 0.45 (337) 0.81 (336) 0.43 (335) 0.22 (329) Feed efficiency Number 2.25 ± 0.14 0.33 (363) 0.99 (363) 0.78 (342) 0.61 (342) 0.76 (338) 0.81 (338) 0.09 (337) 0.47 (336) 0.96 (335) 0.97 (329) Daily gain (g) Number 1119.18 ± 86.99 0.33 (363) 0.85 (363) 0.54 (342) 0.25 (342) 0.40 (338) 0.90 (338) 0.07 (337) 0.94 (336) 0.65 (335) 0.63 (329) Meat percentage (%) Number 57.16 ± 2.60 0.66 (363) 0.15 (363) 0.31 (342) 0.01 ^** (342) 0.18 (338) 0.02 ^* (338) 0.92 (337) 0.26 (336) 0.08 (335) 0.89 (329)

Significance test results for mean and standard deviation and restriction enzymes of SNPs and traits in the transcriptional regulatory region of leptin receptor gene Mold quality castle Mean ± Standard Deviation Probability -549 -618 -681 -707 -717 -744 -763 -792 -864 Back fat (cM) Number 54.83 ± 4.34 0.66 (331) 0.23 (333) 0.47 (333) 0.28 (327) 0.98 (321) 0.29 (271) 0.82 (525) 0.02 ^* (544) 0.92 (544) Feed efficiency Number 2.25 ± 0.14 0.96 (331) 0.98 (333) 0.79 (333) 0.72 (327) 0.84 (321) 0.51 (271) 0.42 (525) 0.47 (544) 0.34 (544) Daily gain (g) Number 1119.18 ± 8 6.99 0.98 (331) 0.61 (333) 0.96 (333) 0.98 (327) 0.36 (321) 0.99 (271) 0.25 (525) 0.76 (544) 0.13 (544) Meat percentage (%) Number 57.16 ± 2.60 0.25 (331) 0.92 (333) 0.01 ^** (333) 0.01 ^** (327) 0.07 (321) 0.90 (271) 0.00 ^** (525) 0.02 ^* (544) 0.49 (544)

() Is the number of observations

Example  4. Single base Polymorphic  (-792 SNP Polymerase chain reaction-restriction fragment length Polymorphic analysis  ( PCR - RFLP )

The present invention is a restriction enzyme that can be used for RFLP analysis of amplified 1203 bp PCR amplification products Bsa I , Bsm AI , Ban II and Bsp 1286I and the like were selected. On the other hand, when cut with restriction enzyme Bsa I , two bands were formed at size 1,203 bp single band, type BB at 834 bp and 360 bp, and type AB at three bands at sizes 1,203 bp, 843 bp and 360 bp. It was confirmed to appear (see Figure 2).

Figure 2 shows the results of polymerase chain reaction-restriction enzyme fragment length polymorphism analysis (PCR-RFLP) using the restriction enzyme Bsa I using the molecular marker of the present invention. Lane 1 and lane 2 form AA; Lane 3 and lane 4 form AB; And lanes 5 and 6 represent type BB.

As such, the statistically significant molecular markers are essential techniques for marker assisted selection (MAS), and the SNPs associated with backfat thickness and meat removal rate identified in the above studies are available for selection of sows. Judging.

As described above, the present invention relates to molecular markers of single nucleotide polymorphisms (SNPs) in the transcriptional regulatory region of leptin receptor genes and their back fat, fat content and meat content. The present invention relates to uses for determining economic traits, and the like, wherein the molecular marker of the present invention is an important source in marker-assisted selection (MAS), etc., which improves the method of selection of breeders by existing phenotypes. The technology can be used not only to control meat quality but also to discriminate between paternity. In addition, it is possible to select breeders accurately and maximize the breeding capacity of breeders to cultivate excellent breeding pigs in Korea, and reduce the number of breeding pigs imported from foreign countries every year to prevent domestic spread of foreign infectious diseases and foreign currency outflow. May contribute to the reduction.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> DNA markers using leptin receptor gene and uses <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> leptin forward primer <400> 1 ttccagaaac ataagacacg cg 22 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> leptin reverse primer <400> 2 gaccaattct aaatttcaac cagagg 26 <210> 3 <211> 1202 <212> DNA <213> Sus sp. <400> 3 tccacccaga ttaattttca tgtagtgaac ggaatcccta atatgagata attaaaaaag 60 actggtacat caagtcttta gtgtttcatt acaaatctaa gcccaatatg ttaaaattat 120 attaccacta gaatttatga tacagtagaa caaataatct tattcataat atatttcagg 180 agttcccatc gtggtgcagc ggaaacaaat ccgactagga accatgaggt cgcgggttcc 240 atccctggcc tcactcagcg ggttaaggac ccggcgttgc cctgagctgt gatataggtt 300 gcagatgtgg ctcggatctg gcattgctgt ggctgtggtg taggccagca gctgtagctc 360 tgaggagasc cctagcctgg gaacctccat atgccaccag tgtggcccta aaaagccaaa 420 aaaaaaaaaa gctaaaaaaa atcttattga ttatatattt caaattgcgt aaaattcact 480 ggaaagtttc tctgaagtca tccctctcat ctgcatatat gaagtcatca gattttccct 540 tagattattg ataactcacc aatgggaatg ttacctcatt ggcaagtgaa cagggggttt 600 cggaaagcat gttggaaaat ttcctcctct ttatttgaaa tcagtaggca gtttcattac 660 ctataccata atcatttggc tttgtggatc atagtaaaga taaaggcttt aggaaacaag 720 agaagtttaa ggactgagga caaaaaataa agactgtaaa actaataatg ctaggtcagc 780 tgtacatatt tcgttaacct cgtgagtact tctgtttagg taaaaatcca gtctcaccct 840 gtgatgcctg tcctggtttg tcatgtcata aaggaacatt gacagttttt gactaagcca 900 tgtatgaaaa ataacttata ttttaactaa gtaaaatagc attgcatgaa atgaatctgc 960 aacttacatt gttaccttaa tgtgaaatgc tgatattgat ccagagtatt acagaggatt 1020 aacatttgaa gaattattaa ttgtagtctt tttccttata tattttccac agacagctta 1080 tatatatgtc aatttttttt ttatgtgtgt gtatttgttt tagatttact ctttttctgg 1140 tgtacttctc tgaagtaaga tgatttgtca aaaattctgt gtggttttgt tacattgggg 1200 ta 1202

Claims (10)

Position 1069 of SEQ ID NO: 3 changes from A to C, position 1028 from G to A, position 959 from G to A, position 957 from C to T, or position 930 is A To T or 857th position from T to C, 836th position from A to C, 782th position from A to G, or 692th position from C to T, or 686th position A From G to 611th from G to A, 542th from C to A, 479th from C to T, 453th from A to G, or 416th from C Is at least one gene sequence selected from the group consisting of A or 397 positions from C to T, 368 positions from C to G, or 296 positions from G to C Pig quality assessment molecular markers, characterized in that (molecular marker). Characteristic evaluation method of pigs using the molecular labeling factor of claim 1. The method of claim 2, Amplifying the gene for a transcriptional regulatory region of the leptin receptor gene; And Determining the base sequence of the amplified molecular labeling factor, to determine the presence of any one or more of the molecular labeling factor of claim 1 characterized in that the trait evaluation method of the pig individual. The method of claim 3, wherein Said method further comprises the step of analyzing the degradation product of said amplified gene by restriction enzymes. The method of claim 3, wherein The trait of the pig individual is a trait evaluation method of the pig individual, characterized in that any one of the trait selected from the group consisting of the back fat thickness, feed efficiency, daily weight gain and meat growth rate of the pig. 6. The method according to claim 5, wherein the position of SEQ ID NO: 368 of the molecular labeling factor is a molecular labeling factor changed from C to G. The method of claim 5, wherein the position of SEQ ID NO: 368 of the molecular labeling factor is a molecular labeling factor changed from C to G. 7. Selection method of pig breeders using the method of claim 6. Selection method of pig breeders using the method of claim 7. Molecular marker with 368th position changed from C to G for assessing swine growth and back fat thickness.

Images