CN114214431B

CN114214431B - Application of molecular marker in pig reproduction trait association analysis

Info

Publication number: CN114214431B
Application number: CN202111573189.XA
Authority: CN
Inventors: 李小平; 李道洁; 刘鑫; 王晓彤; 张地
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2021-12-21
Filing date: 2021-12-21
Publication date: 2023-04-25
Anticipated expiration: 2041-12-21
Also published as: CN114214431A

Abstract

The invention belongs to the field of animal molecular marker screening and application, and in particular relates to application of a molecular marker in pig reproduction trait association analysis. The molecular marker is cloned from an MTHFR gene, and the nucleotide sequence of a first molecular marker MTHFR-1 on the gene is shown as SEQ ID NO:1, there is a C/T allele mutation at 101 th base of the sequence, which causes polymorphism of the nucleotide of the sequence, the 1-embryo total number of children of CC and TC genotype individuals is optimal, and the 2-embryo number of live number of children of TC genotype individuals is optimal. The nucleotide sequence of the second molecular marker MTHFR-2 on the MTHFR gene is shown as SEQ ID NO:2, there is a G/C allelic mutation at 101 th base of the sequence, which causes polymorphism of the nucleotide of the sequence, and the 1-embryo total number of children and 2-embryo number of live children of CG genotype individuals are optimal.

Description

Application of molecular marker in pig reproduction trait association analysis

Technical Field

The invention belongs to the field of animal molecular marker screening and application, and particularly relates to application of a molecular marker in pig reproduction trait association analysis. The molecular markers are related to the characteristics of the total litter size and the litter size of pigs. The molecular marker is obtained by screening from MTHFR genes.

Background

The pig raising technology is a large pig raising country, and along with the continuous improvement of the consumption level, the demand of residents in China for pork is also continuously increased. Meanwhile, in pig raising production, the litter size of sows is closely related to economic benefits of breeders, and the litter size of sows is one of important indexes for measuring reproductive traits of a sow (Jiao Xiaopeng 2021). Therefore, the number of the farrowing sows is increased, the feeding quantity of the sows can be reduced, the production level is improved, and the method has important influence on the production and development of a pig farm. Genetic progress achieved by phenotypic selection is less due to the lower heritability of sow reproductive traits. The breeding efficiency can be remarkably improved through molecular marker assisted selection.

Methylene tetrahydrofolate reductase (methylenetetrahydrofolate reductase, MTHFR) plays an important role in the metabolic process of folic acid, which is important in the early gestation of sows, and can increase embryo survival and thus litter size by supplementing folic acid (Guay et al 2002). Many polymorphic sites of the MTHFR gene have been found in humans and may result in the deficiency of the corresponding enzyme. The polymorphism of MTHFR may affect DNA synthesis, inhibit methylation, and thus affect normal reproductive function (Guo et al 2016).

The competitive allele-specific PCR (Kompetitive Allele Specific PCR, KASP) technology is a flexible, economical and accurate SNP detection method, and is widely used in various fields. KASP firstly designs two corresponding specific forward primers aiming at different bases of SNP locus, each forward primer is provided with a specific sequence, and the sequence can be combined with fluorescent label. And simultaneously synthesizing universal reverse primers and performing PCR amplification. As the number of PCR cycles increases, the number of amplicons increases exponentially, and fluorescent probes anneal more to newly synthesized complementary strands, emitting fluorescence. Different SNP types can be reported by reading different fluorescent signals in the PCR product through an enzyme-labeled instrument. According to the invention, 2 SNP loci of the MTHFR gene are found through an iswire database, and are identified and genotyped in a domestic Dan-line white sow group (n=505) through a KASP technology. And further carrying out association analysis on the SNP loci and the pig reproduction traits by using SAS software, and the result shows that 2 SNP loci on the gene are obviously related to the total number of piglets and the number of live piglets.

Disclosure of Invention

The invention aims at finding the application of fragments of MTHFR genes as molecular markers in pig reproduction trait association analysis.

Specifically, the technical scheme of the invention is as follows:

the invention obtains the application of the mutation site of the MTHFR gene in the pig reproduction trait association analysis and detection. It is based on the result of DNA genotyping of the ear tissue sample of Dan-based white sow with recorded trait data of total litter size and litter size, in which there is a mutation of one allele (C/T) at base 71867916 on chromosome 06 of MTHFR gene and a mutation of one allele (G/C) at base 71869798 on chromosome 06, and these two polymorphic sites can affect total litter size and litter size.

Specifically, the applicant provides application of two SNP molecular markers of MTHFR gene in the correlation analysis and detection of total litter size and live litter size in pig breeding characters, wherein the pig breed is a Dan-series white pig, the pig breeding characters are total litter size and live litter size,

wherein:

the nucleotide sequence of the MTHFR-1 locus molecular marker is as follows:

GCCGGGACCGGGAGGCGGAAGGTGGGACACGGTAGCCTCACGCGAAGGGTCTCAGGGCGCAGGGTCACTGGCCTCGGGCTCCTTCTCGTTGTGGGGGGGCRTGTTGAGAAGCTCAAATGTGTCCTCCACCACCTGCCAGAGGCAGTTGTCCAGCGGAAACTCGTTGTCCACCAGGTTGACCAGGAAGTAGTTGTCGTGGAT

the 101-position base R in the sequence is C or T, wherein the total number of 1-child-producing number of TT genotype is obviously lower than that of CC genotype and TC genotype, and the number of 2-child-producing number of live-child-producing number is obviously lower than that of TC genotype;

the nucleotide sequence of the MTHFR-2 locus molecular marker is as follows:

GATTATCCACGAATGGCCTCTCGTGCCAGGCTGGGAGCTCTCAGAGGGCAGGGGCCTGGCTCTGTCTGCGTGTCTGTCTGGCACAATGCCTGGATTGGCGRGGCGCTCCGTGATTGCCGGATGGTGGCATAAATGTGGCGCCCTCGGACCCGGTGACCCAGGCTGGCCCCTACCTTCACATCCACGATGTGATAATTCACT

the 101-position base R in the sequence is G or C, and the total number of 1-birth and the number of 2-birth active of the CC genotype are obviously lower than that of the CG genotype.

The two sites of MTHFR-1 and MTHFR-2 are in linkage disequilibrium. The MTHFR-1 and MTHFR-2 genotype combinations are obviously related to the total litter size, and the TC-GG genotype is a favorable genotype of the reproductive traits of the Dan-series big white pig sow.

Meanwhile, the invention designs the application of the combination of two KASP genotyping primers, the pig breed is a Dan-series white pig, the pig reproductive trait is total litter size and litter size, and the nucleotide sequence of the KASP primer combination of the MTHFR-1 locus is shown as a sequence table SEQ ID NO: 3. SEQ ID NO:4 and SEQ ID NO:5, the nucleotide sequence of the KASP primer combination of the MTHFR-2 locus is shown as a sequence table SEQ ID NO: 6. SEQ ID NO:7 and SEQ ID NO: shown at 8.

The applicant provides the use of two mutation sites of MTHFR gene in the analysis and detection of the correlation of total litter size and litter size in pig reproduction traits, said use comprising the following steps:

genomic DNA was extracted from porcine (Dan-system white pig) ear tissue. Registering an iswire database to search SNP information of a pig MTHFR Gene (Gene ID: ENSSSCG 00000003428), screening SNP loci with higher minimum allele frequency, namely 71867916C/T allele mutation (or base substitution, the nucleotide sequence of which is shown in figure 1 and a sequence table SEQ ID NO: 1) on a No. 06 chromosome, designing a specific KASP primer for the SNP loci, wherein the DNA sequence of the primer is shown in the sequence table SEQ ID NO: 3. SEQ ID NO:4 and SEQ ID NO:5 is shown in the figure; the MTHFR-2 locus is the G/C allele mutation (or base substitution, the nucleotide sequence is shown in figure 2 and sequence table SEQ ID NO: 2) of 71869798 locus on chromosome 06, a specific KASP primer is designed for the SNP locus, and the sequence DNA sequence of the primer is shown in the sequence table SEQ ID NO: 6. SEQ ID NO:7 and SEQ ID NO: shown at 8. Amplifying the genome DNA of the Dan-system big white pig sow as a template, identifying the SNP loci, genotyping the SNP loci, and finally carrying out correlation analysis on the SNP loci and the reproductive traits of the Dan-system big white pig sow.

More detailed inventive arrangements are described in the detailed description.

Drawings

Fig. 1: the general technical flow diagram of the invention.

Fig. 2: is an MTHFR amplified sequence comprising an MTHFR-1 mutation site, wherein R is the mutation site, obtained from an iswire database.

Fig. 3: is an MTHFR amplified sequence comprising an MTHFR-2 mutation site, wherein R is the mutation site, obtained from an iswire database.

Detailed Description

Description of sequence in sequence table:

sequence listing SEQ ID NO:1: the nucleotide sequence of the molecular marker MTHFR-1 screened by the invention has the sequence length of 201bp, and the 101bp base of the sequence has an allelic C/T mutation.

Sequence listing SEQ ID NO:2: the nucleotide sequence of the molecular marker MTHFR-2 screened by the invention has the sequence length of 201bp, and the 101bp base of the sequence has the mutation of an allele G/C.

Sequence listing SEQ ID NO:3 (specific sequence: GAA GGT GAC CAA GTT CAT GCT AGG ACA CAT TTG AGC TTC TCA ACA G)

) Sequence listing SEQ ID NO:4 (specific sequence: GAA GGT CGG AGT CAA CGG ATT GAG GAC ACA TTT GAG CTT CTC AAC AA)

): is a forward primer sequence for genotyping the MTHFR-1 locus C/T mutation (i.e. the base substitution of 101 position of the cloned SEQ ID NO:1 sequence of the present invention) on the pig MTHFR gene.

Sequence listing SEQ ID NO:5 (specific sequence: TGG CCT CGG GCT CCT TCT CGT T)

): is a reverse primer sequence for genotyping the MTHFR-1 locus C/T mutation (i.e. the base substitution of 101 position of the cloned SEQ ID NO:1 sequence of the present invention) on the pig MTHFR gene.

Sequence listing SEQ ID NO:6 (specific sequence: GAA GGT GAC CAA GTT CAT GCT GGC AAT CAC GGA GCG CCC), sequence listing SEQ ID NO:7 (specific sequence: GAAGGT CGG AGT CAA CGG ATT GGC AAT CAC GGA GCG CCG): is a forward primer sequence for genotyping the MTHFR-2 locus G/C mutation (i.e. the base substitution of 101 position of the cloned SEQ ID NO:2 sequence of the present invention) on the pig MTHFR gene.

Sequence listing SEQ ID NO:8 (specific sequence: GTC TGT CTG GCA CAA TGC CTG GAT): is a reverse primer sequence for genotyping the MTHFR-2 locus G/C mutation (i.e. the base substitution of 101 position of the cloned SEQ ID NO:2 sequence of the present invention) on the pig MTHFR gene.

Example 1: acquisition of SNPs of pig MTHFR gene and establishment of polymorphism detection method

Logging in an iswire website, searching SNP loci of the MTHFR genes of pigs, and finally screening two SNP loci of the MTHFR genes: MTHFR-1 and MTHFR-2, which are located at positions 71867916 and 71869798, respectively, on the swine 6 chromosome. Downloading the SNP locus and the sequences of 100bp before and after the SNP locus, and designing corresponding KASP primers. Wherein: the DNA sequence of the forward primer 1 for amplifying the MTHFR-1 locus is shown as SEQ ID NO:3, i.e., MTHFR-1-F1: GAA GGT GAC CAA GTT CAT GCT AGG ACA CAT TTG AGC TTC TCA ACA G, the forward primer 2DNA sequence is shown in SEQ ID NO:4, i.e., MTHFR-1-F2: GAA GGT CGG AGT CAA CGG ATT GAG GAC ACA TTT GAG CTT CTC AAC AA, the DNA sequence of the reverse primer is shown in SEQ ID NO:5, i.e., MTHFR-1-R: TGG CCT CGG GCT CCT TCT CGT T. Amplifying to obtain a target fragment with 201bp length (the sequence of the fragment is shown as SEQ ID NO:1 (see figure 1), the DNA sequence of a forward primer 1 of an MTHFR-2 locus is shown as SEQ ID NO:6, namely MTHFR-2-F1: GAA GGT GAC CAA GTT CAT GCT GGC AAT CAC GGA GCG CCC, the DNA sequence of a forward primer 2 is shown as SEQ ID NO:7, namely MTHFR-2-F2: GAA GGT CGG AGT CAA CGG ATT GGC AAT CAC GGA GCG CCG, the DNA sequence of a reverse primer is shown as SEQ ID NO:8, namely MTHFR-2-R: GTC TGT CTG GCA CAA TGC CTG GAT. Amplifying to obtain a target fragment with 201bp length (the nucleotide sequence of the fragment is shown as SEQ ID NO:2 (see figure 2).

The KASP technology is utilized to carry out typing on SNP loci, two corresponding forward primers are designed aiming at different bases of the SNP loci and provided with specific sequences, the specific sequences can be combined with fluorescent markers, and meanwhile, universal reverse primers are synthesized for PCR amplification. The first round of PCR can extend forward primer which is complementary with the template, and the forward primer which is not complementary with the template can not extend; in the second round of PCR, the specific sequence complementary to the forward primer is extended, and this completes the introduction of the universal tag sequence into the PCR product corresponding to the SNP. As the number of PCR cycles increases, the number of amplicons grows exponentially, and fluorescent probes anneal more to newly synthesized complementary strands and fluoresce. Different SNP types can be reported by reading different fluorescent signals in the PCR product through an enzyme-labeled instrument.

Example 2: polymorphism distribution of molecular markers screened by the invention in Dan-series white pig group

A DNA sample of 505 white pigs of the first Dan line was genotyped using the primer sequences designed in example 1, with a small number of unsuccessful typing in 505 DNA samples. The gene frequency and genotype frequency of each SNP site were counted, and the results are shown in Table 1.

TABLE 1 genetic polymorphism of SNP locus of swine MTHFR gene

The results show that: there are 3 genotypes at both polymorphic sites. Wherein: for the MTHFR-1 locus, the C allele frequency is 0.66, so C is the dominant allele. For the MTHFR-2 locus, the G allele frequency was 0.64, so G was the dominant allele (see Table 1).

Example 3: application of molecular marker in pig reproduction trait association analysis

In order to determine whether two SNP loci on a pig MTHFR gene are related to pig reproductive traits, 505 Dan-system large white pigs of Guangxi certain farm and herding limited company are selected as test materials, polymorphism detection is carried out by adopting a KASP genotyping method established in the embodiment 1, and the correlation between different genotypes of the two SNP loci of the Dan-system large white pig MTHFR gene and the pig reproductive traits is analyzed. And performing association analysis by adopting SAS statistical software (SAS university edition) self-programming, and performing calculation by adopting a fixed linear model. The specific model is as follows:

Y＝μ+g+p+m+e

wherein Y is a character phenotype value (mainly comprising characters such as total birth number, effective number of living, 5-day-old number of living, and the like), mu is a population average of phenotype, g is genotype effect, p is child effect, m is season and year effect of mating (the season is divided into 4 levels according to the local seasons), and e is residual effect. In the analysis, the groups were divided into 3 groups of 1, 2 and 3 or more (warp) and the warp groups were analyzed without considering the effect of the parity, and the warp groups were added with the parity as a fixation effect. The specific analysis pattern for each population is as follows:

1 tire/2 tire: y=μ+g+m+e

And (3) tyre: y=μ+g+p+m+e

In analyzing the number of live births, the effective number of live births and the number of live births on 5 days, the total number of live births was added as a covariate for analysis.

Correlation analysis between different genotypes and reproductive traits was performed at the MTHFR-1 locus, and the statistical analysis results are summarized in Table 2.

TABLE 2 statistical analysis of MTHFR-1 locus genotype reproduction traits

Table 2 notes: letter differences represent differences in the same line of data, lower case letters represent differences significantly (P < 0.05), upper case letters represent differences extremely significantly (P < 0.01).

As can be seen from table 2, in dans white pigs, the total number of 1-born with TT genotype was significantly lower than that of CC and TC types (P < 0.05); the number of viable offspring in 2 fetuses of TT genotype was significantly lower than that of TC type (P < 0.01).

Correlation analysis between different genotypes and reproductive traits was performed at the MTHFR-2 locus, and the statistical analysis results are summarized in Table 3.

TABLE 3 statistical analysis of MTHFR-2 locus genotype reproduction traits

Table 3 notes: letter differences represent differences in the same line of data, lower case letters represent differences significantly (P < 0.05), upper case letters represent differences extremely significantly (P < 0.01).

As can be seen from table 3, in dans white pigs, both the total parity number 1 and the parity number 2 of the CC genotype were significantly lower than CG type (P < 0.05).

LD analysis was performed on the two SNP loci, and they were found to be in linkage disequilibrium. The association analysis of the different genotype combinations of the SNP locus with the total parity number of 1 child and the parity number of birth was carried out, and the statistical analysis results are summarized in Table 4.

Table 4 statistical analysis table of genotype combination propagation traits

Table 4 notes: letter differences represent differences in the same line of data, lower case letters indicate significant differences (P < 0.05).

As can be seen from Table 4, in Dan-series white pigs, the total number of 1-born of TT-CC genotype was significantly lower than that of TC-CG type (P < 0.05) and there was no significant difference from CC-GG type.

Main references:

[1] jiao Xiaopeng analysis of the cause of low sow farrowing rate and improvement of the practices [ J ]. Modern livestock technology, 2021 (03): 23-24;

[2]Guay F,Matte JJ,Girard CL,Palin MF,Giguère A,Laforest JP.Effect of folic acid and glycine supplementation on embryo development and folate metabolism during early pregnancy in pigs.J Anim Sci,2002,80(8):2134-43；

[3]Guo KM,Tian RH,Wang HL.Relationship of MTHFR gene polymorphisms with infertility.Zhonghua Nan Ke Xue,2016,22(2):171-4。

sequence listing

<110> university of agriculture in China

<120> application of molecular marker in pig reproduction trait association analysis

<141> 2021-12-21

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 201

<212> DNA

<213> pig (Sus scrofa)

<220>

<221> gene

<222> (1)..(201)

<220>

<221> mutation

<222> (101)..(101)

<400> 1

gccgggaccg ggaggcggaa ggtgggacac ggtagcctca cgcgaagggt ctcagggcgc 60

agggtcactg gcctcgggct ccttctcgtt gtgggggggc ttgttgagaa gctcaaatgt 120

gtcctccacc acctgccaga ggcagttgtc cagcggaaac tcgttgtcca ccaggttgac 180

caggaagtag ttgtcgtgga t 201

<210> 2

<211> 201

<212> DNA

<213> pig (Sus scrofa)

<220>

<221> gene

<222> (1)..(201)

<220>

<221> mutation

<222> (101)..(101)

<400> 2

gattatccac gaatggcctc tcgtgccagg ctgggagctc tcagagggca ggggcctggc 60

tctgtctgcg tgtctgtctg gcacaatgcc tggattggcg cggcgctccg tgattgccgg 120

atggtggcat aaatgtggcg ccctcggacc cggtgaccca ggctggcccc taccttcaca 180

tccacgatgt gataattcac t 201

<210> 3

<211> 46

<212> DNA

<213> pig (Sus scrofa)

<220>

<221> primer_bind

<222> (1)..(46)

<400> 3

gaaggtgacc aagttcatgc taggacacat ttgagcttct caacag 46

<210> 4

<211> 47

<212> DNA

<213> pig (Sus scrofa)

<220>

<221> primer_bind

<222> (1)..(47)

<400> 4

gaaggtcgga gtcaacggat tgaggacaca tttgagcttc tcaacaa 47

<210> 5

<211> 22

<212> DNA

<213> pig (Sus scrofa)

<220>

<221> protein_bind

<222> (1)..(22)

<400> 5

tggcctcggg ctccttctcg tt 22

<210> 6

<211> 39

<212> DNA

<213> pig (Sus scrofa)

<220>

<221> protein_bind

<222> (1)..(39)

<400> 6

gaaggtgacc aagttcatgc tggcaatcac ggagcgccc 39

<210> 7

<211> 39

<212> DNA

<213> pig (Sus scrofa)

<220>

<221> primer_bind

<222> (1)..(39)

<400> 7

gaaggtcgga gtcaacggat tggcaatcac ggagcgccg 39

<210> 8

<211> 24

<212> DNA

<213> pig (Sus scrofa)

<220>

<221> primer_bind

<222> (1)..(24)

<400> 8

gtctgtctgg cacaatgcct ggat 24

Claims

1. The application of the primer combination of two SNP molecular markers MTHFR-1 and MTHFR-2 in auxiliary selection of 1-embryo total litter size and 2-embryo birth litter size traits in pig reproduction traits is characterized in that the pig breed is a Dan-series white pig, and the nucleotide sequences of the primers of the molecular markers MTHFR-1 are respectively shown as SEQ ID NO: 3. SEQ ID NO:4 and SEQ ID NO:5 is shown in the figure; with SEQ ID NO: 3. SEQ ID NO:4 and SEQ ID NO:5, amplifying the genome of the Dan-series large white pig by using the primer to obtain an amplification product, and typing SNP loci by using a KASP technology, wherein the total number of 1 parity of TT genotype is obviously lower than that of CC genotype and TC genotype, and the number of 2 parity of birth live parity is obviously lower than that of TC genotype;

the nucleotide sequences of the primers of the molecular marker MTHFR-2 are respectively shown in SEQ ID NO: 6. SEQ ID NO:7 and SEQ ID NO: shown as 8; using SEQ ID NO: 6. SEQ ID NO:7 and SEQ ID NO:8, amplifying the genome of the Dan-system big white pig by using the primer to obtain an amplification product, and typing SNP loci by using a KASP technology, wherein the total number of parity 1 and the number of parity 2 of CC genotypes are obviously lower than CG type.