CN111269989B

CN111269989B - Pig MID1 gene as mortality-related molecular marker and application thereof

Info

Publication number: CN111269989B
Application number: CN202010092404.3A
Authority: CN
Inventors: 朱猛进; 安美景; 赵书红; 李新云; 刘小磊; 张从林; 赵云翔; 赵志超; 管石胜; 李长春
Original assignee: Guangxi Yangxiang Co ltd; Huazhong Agricultural University
Current assignee: Guangxi Yangxiang Co ltd; Huazhong Agricultural University
Priority date: 2020-02-14
Filing date: 2020-02-14
Publication date: 2023-06-23
Anticipated expiration: 2040-02-14
Also published as: CN111269989A

Abstract

The invention provides SNP markers related to piglet mortality, wherein the SNP markers are selected from SEQ ID NO:1, and the 145 th nucleotide of the nucleotide sequence shown in the formula 1 is a base C or T. The molecular marker can accurately predict the death rate character difference among pigs of different genotype groups, accurately and efficiently breeds excellent pig breeds with good sow reproductive capacity, and has the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like. In pig breeding work, the molecular marker can be used as a reliable marker of mortality characters, and early selection is facilitated, so that generation intervals are shortened, selection strength is improved, and seed selection efficiency and accuracy are improved.

Description

Pig MID1 gene as mortality-related molecular marker and application thereof

Technical Field

The present invention relates to SNP markers and uses thereof. In particular, the invention relates to a pig MID1 gene as a mortality-related molecular marker and application thereof. More specifically, the present invention relates to a piglet mortality-related SNP marker and an application thereof.

Background

Along with the improvement of the living standard of residents in China, the demands of people on meat foods are gradually increased. Under the promotion of the increase of meat demands of people, the Chinese farming industry is rapidly growing. The white paper of Chinese food safety published in 10 and 14 days 2019 shows that the average occupation of Chinese pigs, cattle and mutton in 2018 is 46.8 kg, which is increased by 16.6 kg and 55% compared with 1996. In the Chinese farming industry, the pork is the most da Zong meat consumer product, and accounts for about 63% of the consumed meat. According to annual-differentiation data in 2012, the yield of the live pigs accounts for 18% of the total agricultural yield, is the agricultural product with the largest single yield in China, and the yield scale is equal to the sum of the yields of main crops such as rice, wheat and corn. However, the current meat consumption level of residents in China is still far lower than that of developed European and American countries, and the pig raising production efficiency in China can not completely meet the increasing demands of the residents in China on meat consumption.

Reproductive traits are important economic traits affecting breeding benefits, and directly restrict fertility of sows and income of farms. The genetic improvement of the reproductive traits and the improvement of the reproductive performance of pigs are effective ways for improving the breeding benefits. The total number of piglets, the number of dead fetus, the number of weaned piglets, the weight of litter piglets, the sex ratio and the like are important indexes for measuring the reproductive performance of the sow and are influenced by a plurality of factors. The reproductive performance of the first fetus of the sow is usually poor, and improving the reproductive capacity of the first fetus can effectively improve the reproductive performance of the sow. The reproductive capacity of the sow is mainly embodied as the constitution of litter size, including total litter size, birth activity number, weak litter size, dead litter size, mummy size and the like, wherein the mortality index constructed by the total litter size, dead litter size and mummy size is one of the common indexes for measuring the reproductive performance of the sow, and the mortality rate is equal to the total dead litter size of the sow on the same day as the first birth time divided by the total birth litter size, wherein the total death size is equal to the dead litter size plus mummy individual size. The breeding efficiency of the sow can be fundamentally improved by improving the mortality character of the sow genetically through breeding. The mortality trait is a low genetic trait, the conventional breeding means progress slowly, molecular markers of pig mortality are mined, and the improvement process of the pig mortality trait can be accelerated through molecular auxiliary selection.

However, SNP markers for piglet mortality are currently under investigation.

Disclosure of Invention

The present invention aims to solve, at least to some extent, the technical problems existing in the prior art. Therefore, the invention provides an SNP marker related to the death rate of piglets, a primer group and a kit for detecting the SNP marker, application of the SNP marker, a method and a system for predicting the death rate of piglets and a pig breeding system. Therefore, the molecular marker can accurately predict the difference of mortality traits among pigs of different genotype groups, accurately and efficiently breeds excellent pig breeds with good sow reproductive capacity, and has the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like. In pig breeding work, the molecular marker can be used as a reliable marker of mortality characters, and early selection is facilitated, so that generation intervals are shortened, selection strength is improved, and seed selection efficiency and accuracy are improved.

In addition, SNP (single nucleotide polymorphism, SNP, i.e., single nucleotide polymorphism) is a type of molecular genetic marker proposed by the human genome research center scholarer of the american college of bureau of technology in 1996, and mainly refers to a DNA sequence polymorphism caused by variation of a single nucleotide at the genome level. SNPs exhibit polymorphisms that involve only single base variation, in terms of transitions, transversions, insertions, deletions, and the like.

In one aspect of the invention, the invention provides a SNP marker associated with mortality of piglets. According to an embodiment of the invention, the SNP marker is selected from the group consisting of SEQ ID NOs: 1, and the 145 th nucleotide of the nucleotide sequence shown in the formula 1 is a base T or C.

In the genome of pigs, MID1 (E3 ubiquitin ligase intermediate 1) is located in the X sex chromosome. At the cellular level, MID1 binds to microtubules as a ubiquitin E3 ligase, targeting protein phosphatase 2A (PP 2A) for ubiquitin-mediated regulation. It was found that PP2A levels were significantly down-regulated in a number of cancers, including colorectal and breast cancers. PP2A plays a number of roles in carcinogenesis including regulating apoptosis, proliferation, cell migration, cytoskeletal rearrangement and regulating the cell cycle. As a negative regulator of PP2Ac, MID1 acts through the MID1-PP2A complex. In the development of human embryos, MID1 is a gene essential for the healthy development of embryos. Research studies have shown that mutations in MID1 are associated with the Opitz G/BBB syndrome (XLOS). Opitz syndrome is a rare genetic disorder that affects the development of midline structural organs. Furthermore, MID1 is strongly upregulated in mouse Cytotoxic T Lymphocytes (CTLs), which have a significant impact on exocytosis of the dissolved particles and killing ability of CTLs.

The inventor finds that the MID1 gene plays an important role in the growth and development process of pigs, and the gene mutation possibly causes development defects and even death of pig embryos, and further, the inventor proves that one SNP variation on the MID1 gene is obviously related to the death rate of pigs through experiments, and the SNP marker is positioned on the nucleotide sequence of the MID1 gene of chromosome X of pigs, namely the sequence SEQ ID NO:1, the T > C single nucleotide mutation at the 145 th position also corresponds to the 7313289 th nucleotide on the X-th chromosome of the whole genome (Sscofa 11.1) of the pig, and the RS number is RS322441313 (synonym: WU_10_2_X_7708900). Therefore, the SNP markers can accurately predict the death rate character difference among pigs of different genotype groups, accurately and efficiently breeds excellent pig breeds with good sow reproductive capacity, and have the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like. In pig breeding work, the molecular marker can be used as a reliable marker of mortality characters, and early selection is facilitated, so that generation intervals are shortened, selection strength is improved, and seed selection efficiency and accuracy are improved.

GGGGTGGGAATCTAACCCATCCCTGCAAGTGACAATGGATTAGGACTTTGGACATTCAAGTTGGCCCCTAGCAGAATACATGTCATCCAAGATCAGATAAGTGTCCACAAGATACAAACAGAATGTGTGGCAATTAGTCATTCTR(T/C)TCATAGTTTTTCTCTACCATCTCATAGTAGATTCAGTCATTGGTTACCTGTAATTCCCAAAATGAGTATCTATTACGTGTATGCGTATTGTGTTCCCTATGAAAGAACGGGATTCTCAGAAGGTGTGGAGAATATGATATGCATCATTGATTCTA(SEQ ID NO：1)

According to an embodiment of the present invention, the above SNP marker related to mortality of piglets may further have the following additional technical features:

according to an embodiment of the invention, the sequence of SEQ ID NO:1, the mortality of piglets with base C at position 145 of the nucleotide sequence shown in SEQ ID NO:1, and the base at position 145 of the nucleotide sequence shown in the formula 1 is T. Therefore, the variety with excellent sow reproductive capacity is further accurately and efficiently bred, and early selection is facilitated, so that the generation interval is shortened, the selection strength is improved, and the seed selection efficiency and accuracy are improved.

In another aspect of the present invention, the present invention provides a primer set for detecting the aforementioned SNP markers. According to an embodiment of the present invention, the primer set includes: SEQ ID NO:2 and 3. Thus, SEQ ID NO:1, thereby effectively sequencing SNP loci of amplification products, determining genotypes thereof, so as to accurately predict piglet mortality traits and efficiently breeding breeds with excellent sow reproductive capacity.

5'-CCCATCCCTGCAAGTGACAA-3' (Forward primer, SEQ ID NO: 2)

5'-CAGCTGCAGAACTTCGCATT-3' (reverse primer, SEQ ID NO: 3)

The features and advantages described above for the SNP markers associated with mortality of piglets are equally applicable to the primer set for detecting SNP markers, and are not described here again.

In yet another aspect of the present invention, the present invention provides a kit for detecting the aforementioned SNP markers. According to an embodiment of the invention, the kit comprises: the primer set described above. Thus, SEQ ID NO:1, thereby effectively sequencing SNP loci of amplified products and determining genotypes thereof, so as to accurately predict the characters related to the mortality of piglets and efficiently select and breed the variety with excellent reproductive capacity of sows.

It should be noted that the features and advantages described above for the primer set for detecting SNP markers are equally applicable to the kit for detecting SNP markers, and are not described here again.

In a further aspect of the invention, the invention provides the use of a SNP marker as described hereinbefore or a primer set as described hereinbefore or a kit as described hereinbefore for predicting mortality in piglets. Therefore, the characteristics related to the mortality of piglets can be predicted, and the variety with excellent reproductive capacity of the sow can be accurately and efficiently bred. In addition, the SNP marker is used for pig molecular marker assisted breeding, and has the advantages of early screening, time saving, low cost and high accuracy.

The features and advantages described above for the SNP markers associated with mortality of piglets, the primer set for detecting the SNP markers, and the kit are also applicable to this application, and will not be described here again.

In yet another aspect of the invention, the invention provides a method of predicting mortality in piglets. According to an embodiment of the invention, the method comprises: and (3) predicting the piglet mortality of the sow to be tested by detecting the SNP markers. As previously described, SEQ ID NO:1, wherein the R at 145 th base of the nucleotide sequence is C or T, and the nucleotide polymorphism is generated, the molecular marker can be used as a molecular marker for predicting the mortality of piglets, and the mortality of piglets with 145 th base being C is lower than that of piglets with 145 th base being T.

Therefore, the method provided by the embodiment of the invention can accurately predict the death rate character difference among pigs of different genotype groups, accurately and efficiently breeds excellent pig breeds with good sow reproductive capacity, and has the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like. In pig breeding work, the molecular marker can be used as a reliable marker of mortality characters, and early selection is facilitated, so that generation intervals are shortened, selection strength is improved, and seed selection efficiency and accuracy are improved.

According to an embodiment of the invention, the method comprises: extracting genome DNA of the sow to be tested; carrying out PCR amplification on the genome DNA of the pig to be detected by using the primer group so as to obtain a PCR amplification product; sequencing the PCR amplification product, and predicting the piglet mortality of the sow to be tested based on a sequencing result; wherein said SEQ ID NO:1, the mortality of piglets with base C at position 145 of the nucleotide sequence shown in SEQ ID NO:1, and the base at position 145 of the nucleotide sequence shown in the formula 1 is T.

The features and advantages described above for the SNP markers associated with the mortality of piglets, the primer set for detecting the SNP markers, and the kit are also applicable to the method for predicting mortality of piglets, and will not be described in detail herein.

In yet another aspect of the invention, the invention provides a system for predicting mortality of piglets. According to an embodiment of the invention, the system comprises: an amplification unit adapted to amplify genomic DNA of a sow to be tested using the primer set described above or the kit described above; a sequencing unit, connected to the amplification unit, adapted to sequence the amplified product obtained by the amplification, to determine the aforementioned SNP markers; the prediction unit is connected with the sequencing unit and is suitable for predicting the piglet mortality of the sow to be detected based on the SNP marker, wherein the sequence of the SEQ ID NO:1, the mortality of piglets with base C at position 145 of the nucleotide sequence shown in SEQ ID NO:1, and the base at position 145 of the nucleotide sequence shown in the formula 1 is T.

Therefore, the method can accurately predict the death rate character difference among pigs of different genotype groups, accurately and efficiently breeds excellent pig breeds with good sow reproductive capacity, and has the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like. In pig breeding work, the molecular marker can be used as a reliable marker of mortality characters, and early selection is facilitated, so that generation intervals are shortened, selection strength is improved, and seed selection efficiency and accuracy are improved.

The features and advantages described above for the SNP markers associated with the mortality of piglets, the primer set for detecting the SNP markers, and the kit are also applicable to the system for predicting mortality of piglets, and will not be described again here.

In yet another aspect of the invention, the invention provides a pig breeding system. According to an embodiment of the invention, the pig breeding system comprises: a candidate pig harvesting apparatus for providing a multi-head candidate sow; a trait prediction apparatus connected to the candidate pig acquisition apparatus, the trait prediction apparatus being the aforementioned system for predicting piglet mortality and being configured to predict piglet mortality of the sow to be tested; and the breeding device is connected with the character prediction device and is used for selecting and breeding candidate sows with low piglet mortality based on the prediction result of the character prediction device. Therefore, the pig breeding system can be used for breeding pig breeds with excellent sow reproductive capacity, and is convenient for early selection, so that the generation interval is shortened, the selection intensity is improved, and the seed selection efficiency and accuracy are improved.

According to an embodiment of the invention, the sequence of SEQ ID NO:1 is an indication of low mortality in piglets, the base at position 145 of the nucleotide sequence indicated as C. Therefore, the pig breeds with excellent sow reproductive capacity can be bred, and early selection is facilitated, so that the generation interval is shortened, the selection strength is improved, and the seed selection efficiency and accuracy are improved.

It should be noted that the features and advantages described above for the system for predicting mortality of piglets are equally applicable to the pig breeding system, and are not described here again.

Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.

Drawings

The foregoing and/or additional aspects and advantages of the invention will become apparent and may be better understood from the following description of embodiments taken in conjunction with the accompanying drawings in which:

FIG. 1 shows a technical flow chart for screening for mortality associated with piglets in accordance with one embodiment of the invention;

FIG. 2 is a schematic diagram showing the results of quality control of a chip used in accordance with one embodiment of the present invention;

FIG. 3 shows a plot of mortality breeding values calculated using a hybrid linear model according to one embodiment of the present invention;

FIG. 4 shows a schematic representation of the results of genome-wide association analysis of mortality breeding values according to one embodiment of the present invention.

Detailed Description

The scheme of the present invention will be explained below with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The examples are not to be construed as limiting the specific techniques or conditions described in the literature in this field or as per the specifications of the product. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Example 1

In this example, referring to fig. 1, molecular markers associated with mortality of piglets were screened by the following method.

1. Pig data collection

(1) Phenotypic data collection

The pigs used in the present invention to record phenotypic data were 6073 healthy sows from the company Yangxiang, guangxi, breeds including Dabai, changbai and Duroc. The pedigree information used in this study was pedigree information containing 6073 sows, and involved 35313 individuals. The time span of the data is from 2014 to 2018, including the date of delivery of each sow, and the total birth individuals, total death individuals, dead births, and mummification of each sow on the day of first delivery. Wherein the total dead number is equal to the dead number plus mummy. The mortality trait studied in the present invention is the percentage of total dead individuals to total birth individuals.

(2) Gene data collection

The porcine ear tissue was used to extract DNA, and all samples were stored in a-20℃refrigerator before this time. DNA was extracted using the kit provided by tengen according to the protocol given by the manufacturer. By this method, a DNA sample of 1331 sow was extracted altogether. Genotype was constructed using Illumina PorcineSNP50 Bead Chip, involving 50,697 SNPs all matched to Sus scrofa genome 11.1 whole genome. Referring to FIG. 2, the data is populated with bell. The genotypes are controlled by plink, the reject rate (Call, rate) is less than 90%, the reject minimum allele frequency (Minor allele frequency, MAF) is less than 1%, and 47,241 SNP are used for the associated analysis of mortality traits.

2. Mortality genetic parameter estimation

Genetic parameters of mortality were estimated unbiased based on pedigree data (ABLUP) using hiblu with pedigree information, and the breed, birth season, of pigs was used as a fixed effect EBV (Estimates breeding value).

The linear model used was: y=xβ+zu+e

y is the observed value, and mortality, β is the fixed effector vector, including population mean, variety, and birth season. Wherein u subject to u-N (0,G) is a breeding value, where

For additive genetic variance, a is a genealogy-based additive genetic variance matrix. />

For residual variance, β and u are the design matrices for X and Z, respectively, see fig. 3.

3. Genome-wide association analysis and verification of mortality EBV and SNP

1) Correlation analysis

The correlation analysis was performed on EBV and all quality controlled SNPs using a mixed linear model (MLM, mixed Linear Model).

The hybrid linear model used was: y=xa+ku+e

y is the EBV of mortality, a is the fixed effect of SNP genes, u is the random effect, e is the residual error, X, K is the design matrix corresponding to a and u.

TABLE 1 correlation analysis results of MID1 Gene and mortality Breeding values

SNP	Chromosome number	Position of	P-value
				rs322441313	X	7313289	4.08e-06

Wherein, amplify SEQ ID NO:1, and the amplification system and PCR conditions are as follows.

(1) The primer sequences of the pig MID1 gene are as follows:

forward primer: 5'-CCCATCCCTGCAAGTGACAA-3'

Reverse primer: 5'-CAGCTGCAGAACTTCGCATT-3'

(2) Amplification system

The upstream and downstream primers (10. Mu.l) were each 0.2ul, taq enzyme 0.05ul, DNA template 1ul,10 XTaq PCR Buffer 1ul, dNTP Mix (10 mM) 0.2ul,RNase free water were supplemented to a total volume of 10ul.

(3) PCR conditions

After 5min of pre-denaturation at 95 ℃, the cycle is repeated for 35 times for 30s at 95 ℃, annealing for 20s at 60 ℃, extension for 30s at 72 ℃, and extension for 3min at 72 ℃.

2) Testing for significant SNPs

The order of the true phenotype data was randomly shuffled 10000 times, 10000 times correlation analysis was performed with the true genotype, and P-value for each rs322441313 was recorded. Ordering 10000P-value from low to high, and recording P ₀ Is the critical value of the first 2.5% P-value. P (P) ₀ Greater than 4.08E-06 demonstrates that rs322441313 detected with authentic data is a significant locus.

Meanwhile, T-tests were performed on different genotypes and mortality, since P <0.01 was very significant, as can be seen from table 2, the differences between the different genotypes and mortality were significant.

TABLE 2 influence of rs322441313 polymorphisms and different genotypes on mortality in first birthing of pigs

As can be seen from Table 2, for individuals with the genotype CC of mortality rate on the first birth day of pigs, the number of individuals is significantly lower than those with TT, indicating that individuals with the genotype CC can effectively reduce mortality rate, so that C is an allele which is beneficial to sow reproduction to reduce mortality rate.

In the description of the present specification, a description referring to terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, the different embodiments or examples described in this specification and the features of the different embodiments or examples may be combined and combined by those skilled in the art without contradiction.

While embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives and variations may be made to the above embodiments by one of ordinary skill in the art within the scope of the invention.

SEQUENCE LISTING

<110> Guangxi Yangxiang Co Ltd, university of agriculture in China

<120> pig MID1 gene as mortality related molecular marker and application thereof

<130> PIDC3196639

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 300

<212> DNA

<213> Artificial Sequence

<220>

<223> 1

<220>

<221> misc_feature

<222> (145)..(145)

<223> r is t or c

<400> 1

ggggtgggaa tctaacccat ccctgcaagt gacaatggat taggactttg gacattcaag 60

ttggccccta gcagaataca tgtcatccaa gatcagataa gtgtccacaa gatacaaaca 120

gaatgtgtgg caattagtca ttctrtcata gtttttctct accatctcat agtagattca 180

gtcattggtt acctgtaatt cccaaaatga gtatctatta cgtgtatgcg tattgtgttc 240

cctatgaaag aacgggattc tcagaaggtg tggagaatat gatatgcatc attgattcta 300

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> 2

<400> 2

cccatccctg caagtgacaa 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> 3

<400> 3

cagctgcaga acttcgcatt 20

Claims

1. Application of primers for detecting SNP related to piglet mortality in preparation of kit for predicting piglet mortality, wherein the SNP is SEQ ID NO:1, and the 145 th nucleotide of the nucleotide sequence shown in the formula 1 is a base T or C;

the SEQ ID NO:1, the mortality of piglets with base C at position 145 of the nucleotide sequence shown in SEQ ID NO:1, wherein the 145 th base of the nucleotide sequence shown in the formula 1 is the death rate of piglets with T;

the nucleotide sequence of the primer for detecting SNP is shown as SEQ ID NO:2 and 3.

2. A system for predicting mortality in piglets, comprising:

the amplification unit is suitable for amplifying the genome DNA of the sow to be detected by using a primer, and the nucleotide sequence of the primer is shown as SEQ ID NO:2 and 3;

the sequencing unit is connected with the amplification unit and is suitable for sequencing an amplification product obtained by amplification to determine SNP, and the SNP is SEQ ID NO:1, and the 145 th nucleotide of the nucleotide sequence shown in the formula 1 is a base T or C;

a prediction unit connected with the sequencing unit and suitable for predicting the piglet mortality of the sow to be tested based on the SNP,

wherein said SEQ ID NO:1, the mortality of piglets with base C at position 145 of the nucleotide sequence shown in SEQ ID NO:1, and the base at position 145 of the nucleotide sequence shown in the formula 1 is T.

3. A pig breeding system, comprising:

a candidate pig harvesting apparatus for providing a multi-head candidate sow;

a trait prediction apparatus connected to the candidate pig acquisition apparatus, the trait prediction apparatus being the system for predicting piglet mortality according to claim 2 and being for predicting piglet mortality of the sow under test; and

and the breeding device is connected with the character prediction device and is used for selecting and breeding candidate sows with low piglet mortality based on the prediction result of the character prediction device.