CN111269989A

CN111269989A - Pig MID1 gene as mortality-related molecular marker and application thereof

Info

Publication number: CN111269989A
Application number: CN202010092404.3A
Authority: CN
Inventors: 朱猛进; 安美景; 赵书红; 李新云; 刘小磊; 张从林; 赵云翔; 赵志超; 管石胜; 李长春
Original assignee: Guangxi Yangxiang Co ltd; Huazhong Agricultural University
Current assignee: Guangxi Yangxiang Co ltd; Huazhong Agricultural University
Priority date: 2020-02-14
Filing date: 2020-02-14
Publication date: 2020-06-12
Anticipated expiration: 2040-02-14
Also published as: CN111269989B

Abstract

The invention provides an SNP marker related to piglet mortality, which is selected from the group consisting of SEQ ID NO: 1 is a base C or T at the 145 th nucleotide of the nucleotide sequence shown in the figure. The molecular marker can be used for accurately predicting the difference of mortality traits among pigs of different genotype groups, and a good pig variety with good sow reproductive capacity is accurately and efficiently bred, and has the outstanding advantages of simplicity, quickness, high sensitivity, good specificity and the like. In the pig breeding work, the molecular marker can be used as a reliable marker of the mortality character, and is convenient for early selection, thereby shortening the generation interval, improving the selection strength and improving the seed selection efficiency and accuracy.

Description

Pig MID1 gene as mortality-related molecular marker and application thereof

Technical Field

The present invention relates to SNP markers and their use. Specifically, the invention relates to a pig MID1 gene as a mortality-related molecular marker and application thereof. More specifically, the invention relates to SNP markers related to piglet mortality and application thereof.

Background

With the improvement of the living standard of residents in China, the demand of people on meat food is gradually increased. Under the promotion of people on the increase of meat demand, the breeding industry in China is rapidly increased. The Chinese food safety book published in 10 and 14 months in 2019 shows that the average occupied amount of Chinese pigs, cattle and mutton in 2018 is 46.8 kg, which is 16.6 kg more than 1996 and is increased by 55%. Among various meat products provided by the breeding industry in China, pork is the largest meat consumer product and accounts for about 63% of the meat consumed. According to the annual book data of 2012, the yield of the live pigs accounts for 18 percent of the total agricultural yield, the live pigs are agricultural products with the largest single yield in China, and the scale of the yield is equivalent to the sum of the yields of main crops such as rice, wheat, corn and the like. However, the meat consumption level of residents in China is still far lower than that of developed countries in Europe and America, and the pig raising production efficiency in China cannot completely meet the increasing requirements of residents in China on meat consumption.

The reproductive traits are important economic traits influencing the breeding benefit and directly restrict the fertility of sows and the income of farms. The genetic improvement of the breeding traits and the improvement of the breeding performance of the pigs are effective ways for improving the breeding benefits. The total litter size, the number of stillbirth, the number of weaned piglets, the weight of littermates, the sex ratio and the like of the sows are important indexes for measuring the reproductive performance of the sows and are influenced by a plurality of factors. The reproductive performance of the first fetus of the sow is usually poor, and the reproductive performance of the sow can be effectively improved by improving the reproductive capacity of the first fetus. The reproductive capacity of the sow is mainly embodied by the composition of the number born, including total number born, number born alive, weak number born, number born dead, number mummy and the like, wherein a mortality index constructed by the total number born, the number born dead and the number mummy is one of common indexes for measuring the reproductive performance of the sow, the mortality is equal to the total number born of the sow on the day of the first birth, divided by the total number born, and the total number dead is equal to the number dead and the number mummy. The breeding efficiency of the sow can be fundamentally improved by genetically improving the mortality character of the sow through breeding. The mortality character is a low heritability character, the conventional breeding means is slow to progress, the molecular marker of the pig mortality is excavated, and the improvement process of the pig mortality character can be accelerated through molecular assisted selection.

However, at present, SNP markers for piglet mortality are still under study.

Disclosure of Invention

The present invention aims to solve, at least to some extent, the technical problems of the prior art. Therefore, the invention provides an SNP marker related to the death rate of piglets, a primer group and a kit for detecting the SNP marker, application of the primer group and the kit, a method and a system for predicting the death rate of the piglets and a pig breeding system. Therefore, the molecular marker can be used for accurately predicting the difference of mortality traits among pigs of different genotype groups, accurately and efficiently breeding excellent pig breeds with good sow reproductive capacity, and has the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like. In the pig breeding work, the molecular marker can be used as a reliable marker of the mortality character, and is convenient for early selection, thereby shortening the generation interval, improving the selection strength and improving the seed selection efficiency and accuracy.

Among them, it should be noted that SNP (single nucleotide polymorphism) is a molecular genetic marker proposed by Lander, a scholarer of human genome research center of the american college of labor and technology, in 1996, and mainly refers to DNA sequence polymorphism caused by variation of a single nucleotide at the genome level. SNPs exhibit polymorphisms involving only single base variations, including transitions, transversions, insertions, and deletions.

In one aspect of the invention, the invention provides a SNP marker associated with piglet mortality. According to an embodiment of the invention, the SNP marker is selected from SEQ ID NOs: 1 is a base T or C at the 145 th nucleotide of the nucleotide sequence shown in the figure.

In the pig genome, MID1(E3 ubiquitin ligase intermediate 1) is located on chromosome 23 and sex chromosome X. At the cellular level, MID1 binds to microtubules and, as a ubiquitin E3 ligase, targets protein phosphatase 2A (PP2A) for ubiquitin-mediated regulation. Studies have found that PP2A levels are significantly down-regulated in a number of cancers, including colorectal and breast cancers. PP2A plays many roles in carcinogenesis, including regulating apoptosis, proliferation, cell migration, cytoskeletal rearrangement, and regulating the cell cycle. As a negative regulator of PP2Ac, MID1 functions through the MID1-PP2A complex. In the process of human embryonic development, MID1 is an essential gene for the healthy development of embryos. Studies have shown that mutations in MID1 are associated with Opitz G/BBB syndrome (XLOS). Opitz syndrome is a rare genetic disease that affects the development of midline structural organs. In addition, MID1 is strongly upregulated in mouse Cytotoxic T Lymphocytes (CTLs), which has a significant effect on exocytosis of the dissolved particles and killing capacity of the CTLs.

The inventor finds that the MID1 gene plays an important role in the growth and development process of pigs, the gene mutation can cause the development defect and even death of pig embryos, and furthermore, the inventor proves that a SNP variation on the MID1 gene is obviously related to the death rate of pigs through experiments, and the SNP marker is positioned on the nucleotide sequence of the pig chromosome 23 MID1 gene, namely the sequence SEQ ID NO: 1, the T > C single nucleotide mutation with the 145 th position as the marker position also corresponds to the 7313289 th nucleotide on the X chromosome of the whole genome (Sscofa 11.1) of a pig, and the RS number is RS322441313 (synonyms: WU _10_2_ X _ 7708900). Therefore, the SNP marker according to the embodiment of the invention can be used for accurately predicting the difference of mortality traits among pigs of different genotype groups, accurately and efficiently breeding excellent pig breeds with good sow reproductive capacity, and has the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like. In the pig breeding work, the molecular marker can be used as a reliable marker of the mortality character, and is convenient for early selection, thereby shortening the generation interval, improving the selection strength and improving the seed selection efficiency and accuracy.

GGGGTGGGAATCTAACCCATCCCTGCAAGTGACAATGGATTAGGACTTTGGACATTCAAGTTGGCCCCTAGCAGAATACATGTCATCCAAGATCAGATAAGTGTCCACAAGATACAAACAGAATGTGTGGCAATTAGTCATTCTR(T/C)

TCATAGTTTTTCTCTACCATCTCATAGTAGATTCAGTCATTGGTTACCTGTAATTCCCAAAATGAGTATCTATTACGTGTATGCGTATTGTGTTCCCTATGAAAGAACGGGATTCTCAGAAGGTGTGGAGAATATGATATGCATCATTGATTCTA(SEQ ID NO：1)

According to the embodiment of the present invention, the above SNP markers related to piglet mortality can also have the following additional technical features:

according to an embodiment of the invention, the SEQ ID NO: 1, the mortality rate of piglets with the base C at the 145 th position of the nucleotide sequence shown in the SEQ ID NO: 1, wherein the 145 th base of the nucleotide sequence is T. Therefore, the breed with excellent reproductive capacity of the sow is further bred accurately and efficiently, and the early selection is convenient, so that the generation interval is shortened, the selection strength is improved, and the seed selection efficiency and accuracy are improved.

In another aspect of the present invention, the present invention provides a primer set for detecting the SNP markers described above. According to an embodiment of the invention, the primer set comprises: SEQ ID NO: 2 and 3. Thus, the primer set according to the embodiment of the present invention can specifically amplify SEQ ID NO: 1, so that the SNP locus of the amplification product can be effectively sequenced, the genotype of the amplification product can be determined, the death rate character of piglets can be accurately predicted, and the breed with excellent reproductive capacity of sows can be efficiently bred.

5'-CCCATCCCTGCAAGTGACAA-3' (Forward primer, SEQ ID NO: 2)

5'-CAGCTGCAGAACTTCGCATT-3' (reverse primer, SEQ ID NO: 3)

It should be noted that the features and advantages described above for the SNP marker associated with mortality of piglets are also applicable to the primer set for detecting the SNP marker, and are not described herein again.

In still another aspect of the present invention, the present invention provides a kit for detecting the SNP markers described above. According to an embodiment of the invention, the kit comprises: the primer set described above. Thus, with the kit according to an embodiment of the present invention, it is possible to specifically amplify SEQ ID NO: 1, so that the SNP locus of the amplification product can be effectively sequenced to determine the genotype, thereby being convenient for accurately predicting the correlation with the death rate of piglets and efficiently breeding the breed with excellent reproductive capacity of sows.

It should be noted that the features and advantages described above for the primer set for detecting SNP markers are also applicable to the kit for detecting SNP markers, and are not described herein again.

In still another aspect of the present invention, the present invention provides the use of the aforementioned SNP marker associated with mortality of piglets or the aforementioned primer set or the aforementioned kit for predicting mortality of piglets. Therefore, the method can predict the relationship with the death rate of the piglets and accurately and efficiently breed the breed with excellent reproductive capacity of the sows. In addition, the SNP marker of the invention is used for carrying out the pig molecular marker assisted breeding, and has the advantages of early screening, time saving, low cost and high accuracy.

It should be noted that the features and advantages described above for the SNP markers associated with piglet mortality, the primer sets for detecting SNP markers, and the kits are also applicable to this application and will not be described herein again.

In yet another aspect of the invention, a method of predicting piglet mortality is provided. According to an embodiment of the invention, the method comprises: and predicting the piglet mortality of the sow to be detected by detecting the SNP marker of the sow to be detected. As previously described, SEQ ID NO: 1, and nucleotide polymorphism is generated by allelic mutation of C or T at the 145 th base of the nucleotide sequence shown in the specification, the molecular marker can be used as a molecular marker for predicting piglet mortality, and the piglet mortality with the 145 th base of C is higher than that with the 145 th base of T.

Therefore, the method provided by the embodiment of the invention can be used for accurately predicting the difference of mortality traits among pigs of different genotype groups, accurately and efficiently breeding excellent pig breeds with good sow reproductive capacity, and has the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like. In the pig breeding work, the molecular marker can be used as a reliable marker of the mortality character, and is convenient for early selection, thereby shortening the generation interval, improving the selection strength and improving the seed selection efficiency and accuracy.

According to an embodiment of the invention, the method comprises: extracting the genomic DNA of the sow to be detected; carrying out PCR amplification on the genome DNA of the pig to be detected by utilizing the primer group so as to obtain a PCR amplification product; sequencing the PCR amplification product, and predicting the piglet mortality of the sow to be detected based on the sequencing result; wherein, the SEQ ID NO: 1, the mortality rate of piglets with the base C at the 145 th position of the nucleotide sequence shown in the SEQ ID NO: 1, wherein the 145 th base of the nucleotide sequence is T.

It should be noted that the features and advantages described above for the SNP markers associated with piglet mortality, the primer sets for detecting the SNP markers, and the kit are also applicable to the method for predicting piglet mortality, and are not described herein again.

In yet another aspect of the invention, a system for predicting piglet mortality is provided. According to an embodiment of the invention, the system comprises: an amplification unit adapted to amplify the genomic DNA of the sow to be tested using the aforementioned primer set or the aforementioned kit; a sequencing unit, connected to the amplification unit, and adapted to sequence the amplified product obtained by the amplification and determine the SNP marker; and the prediction unit is connected with the sequencing unit and is suitable for predicting the piglet mortality of the sow to be tested based on the SNP marker, wherein the nucleotide sequence shown in SEQ ID NO: 1, the mortality rate of piglets with the base C at the 145 th position of the nucleotide sequence shown in the SEQ ID NO: 1, wherein the 145 th base of the nucleotide sequence is T.

Therefore, the method can accurately predict the difference of the mortality traits among pigs of different genotype groups, accurately and efficiently breed excellent pig breeds with good sow reproductive capacity, and has the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like. In the pig breeding work, the molecular marker can be used as a reliable marker of the mortality character, and is convenient for early selection, thereby shortening the generation interval, improving the selection strength and improving the seed selection efficiency and accuracy.

It should be noted that the features and advantages described above for the SNP markers associated with piglet mortality, the primer sets for detecting the SNP markers, and the kit are also applicable to the system for predicting piglet mortality, and are not described herein again.

In another aspect of the invention, the invention provides a pig breeding system. According to the embodiment of the invention, the pig breeding system comprises: a candidate pig acquisition device for providing a plurality of candidate sows; the character prediction device is connected with the candidate pig acquisition device, is the system for predicting the death rate of the piglets and is used for predicting the death rate of the piglets of the sows to be tested; and the breeding device is connected with the character prediction device and used for selecting and breeding candidate sows with low piglet mortality based on the prediction result of the character prediction device. Therefore, the pig breeding system provided by the embodiment of the invention can be used for breeding pig varieties with excellent sow reproductive capacity, and is convenient for early selection, so that the generation interval is shortened, the selection strength is improved, and the seed selection efficiency and accuracy are improved.

According to an embodiment of the invention, the SEQ ID NO: 1, T is an indicator of low mortality of piglets. Therefore, the pig breed with excellent sow reproductive capacity can be bred, and early selection is facilitated, so that the generation interval is shortened, the selection strength is improved, and the seed selection efficiency and accuracy are improved.

It should be noted that the features and advantages described above for the system for predicting piglet mortality are also applicable to the pig breeding system, and are not described herein again.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

fig. 1 shows a technical flow chart relating screening to piglet mortality according to one embodiment of the present invention;

FIG. 2 is a diagram showing the results of quality control of a chip used in accordance with an embodiment of the present invention;

FIG. 3 shows a graph of mortality breeding values calculated using a mixed linear model according to one embodiment of the present invention;

FIG. 4 shows a graphical representation of the results of a genome-wide association analysis of mortality breeding values according to one embodiment of the present invention.

Detailed Description

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

In this example, with reference to fig. 1, molecular markers associated with piglet mortality were screened by the following method.

1. Pig data collection

(1) Phenotypic data collection

The pigs used in the present invention to record phenotypic data were 6073 healthy sows from Guangxi Yangxiang GmbH, the breeds include Dabai, Changbai and Duroc. The pedigree information used in this study was that including the 6073 sows, and the individual referred to was 35313. The time span of the data ranged from 2014 to 2018, including the date when each sow was delivered, and the total number of births, total number of deaths, number of stillbirths, and number of mummies on the day of the first delivery of each sow. Wherein the total number of dead individuals equals the number of dead births plus the number of mummy. The mortality trait studied in the present invention is the percentage of total dead individuals to total born individuals.

(2) Gene data collection

The porcine ear tissue was used to extract DNA, before which all samples were stored in a freezer at-20 ℃. DNA was extracted according to the protocol given by the manufacturer using the kit provided by TIANGEN. A1331 DNA sample of the sow was co-extracted by this method. The Illumina portanneSNP 50 Bead Chip is used for constructing the genotype, and 50,697 related SNPs are all matched to a Sus scrofa genome 11.1. Referring to fig. 2, data is padded with beagle. And (3) carrying out quality control on the genotype by using plink, wherein the rejection detection rate (Call, rate) is less than 90%, the Minimum Allele Frequency (MAF) is less than 1%, and 47,241 SNPs are used for association analysis of the mortality trait.

2. Mortality genetic parameter estimation

Optimal unbiased estimation (ABLUP) based on pedigree data is carried out on the genetic parameters of mortality by using hiblup and EBV (estimates broadcasting value) is obtained by taking the pig breed and the birth season as fixed effects.

The linear model used is y ═ X β + Zu + e

y is the observed value, and mortality, β is a fixed effect vector comprising population mean, breed and birth season, where u obeying u-N (0, G) is the breeding value, where u is the

For additive genetic variance, A is a pedigree-based additive genetic variance matrix.

For residual variance, β and u are the design matrices for X and Z, respectively, see FIG. 3.

3. Whole genome association analysis and verification of mortality EBV and SNP

1) Association analysis

EBV and all quality-controlled SNPs were analyzed for association using a Mixed Linear Model (MLM).

The mixed linear model used was: y-Xa + Ku + e

y is EBV of mortality, a is fixed effect of SNP gene, u is random effect, e is residual error, and X and K are design matrixes corresponding to a and u.

TABLE 1 correlation of MID1 Gene with mortality Breeding value

SNP	Chromosome number	Position of	P-value
				rs322441313
	23	7313289	4.08e-06

Wherein the amplification of SEQ ID NO: 1, the amplification system and the PCR conditions are as follows.

(1) The primer sequence of the pig MID1 gene is as follows:

a forward primer: 5'-CCCATCCCTGCAAGTGACAA-3'

Reverse primer: 5'-CAGCTGCAGAACTTCGCATT-3'

(2) Amplification system

0.2ul each of the upstream and downstream primers (10umol), 0.05ul of Taq enzyme, 1ul of DNA template, 10 XTaq PCR Buffer1ul, 0.2ul of dNTP Mix (10mM), and RNase free water to a total volume of 10 ul.

(3) PCR conditions

After pre-denaturation at 95 ℃ for 5min, 35 cycles of denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 20s, extension at 72 ℃ for 30s, and finally extension at 72 ℃ for 3 min.

2) Test for significant SNP

The order of the real phenotype data was randomized 10000 times, 10000 correlations were analyzed with the real genotype, and the P-value per rs322441313 was recorded. 10000P-values are sorted from low to high, and are marked with P₀The cut-off value for the first 2.5% P-value. P₀Greater than 4.08E-06 demonstrates that rs322441313 detected with real data is a significant site.

Meanwhile, T test was performed on different genotypes and mortality rates, since P <0.01 was very significant, as can be seen from table 2, the difference between different genotypes and mortality rates was significant.

TABLE 2 influence of the rs322441313 polymorphism and the different genotypes on the mortality at first birth day of pigs

As can be seen from Table 2, the mortality trait of the individual with the genotype CC is significantly lower than that of the individual TT on the first farrowing day of the pig, which indicates that the individual with the genotype CC can effectively reduce the mortality, so that C is an allele which is beneficial to sow breeding and reduces the mortality.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Guangxi Yangxiang GmbH, Huazhong university of agriculture

<120> pig MID1 gene as mortality-related molecular marker and application thereof

<130>PIDC3196639

<160>3

<170>PatentIn version 3.5

<210>1

<211>300

<212>DNA

<213>Artificial Sequence

<220>

<223>1

<220>

<221>misc_feature

<222>(145)..(145)

<223> r is t or c

<400>1

ggggtgggaa tctaacccat ccctgcaagt gacaatggat taggactttg gacattcaag 60

ttggccccta gcagaataca tgtcatccaa gatcagataa gtgtccacaa gatacaaaca 120

gaatgtgtgg caattagtca ttctrtcata gtttttctct accatctcat agtagattca 180

gtcattggtt acctgtaatt cccaaaatga gtatctatta cgtgtatgcg tattgtgttc 240

cctatgaaag aacgggattc tcagaaggtg tggagaatat gatatgcatc attgattcta 300

<210>2

<211>20

<212>DNA

<213>Artificial Sequence

<220>

<223>2

<400>2

cccatccctg caagtgacaa 20

<210>3

<211>20

<212>DNA

<213>Artificial Sequence

<220>

<223>3

<400>3

cagctgcaga acttcgcatt 20

Claims

1. An SNP marker associated with mortality of piglets, characterized in that the SNP marker is selected from the group consisting of SEQ ID NO: 1 is a base T or C at the 145 th nucleotide of the nucleotide sequence shown in the figure.

2. The SNP marker according to claim 1, wherein the nucleotide sequence of SEQ ID NO: 1, the mortality rate of piglets with the base C at the 145 th position of the nucleotide sequence shown in the SEQ ID NO: 1, wherein the 145 th base of the nucleotide sequence is T.

3. A primer set for detecting the SNP marker of claim 1 or 2, comprising: SEQ ID NO: 2 and 3.

4. A kit for detecting the SNP marker of claim 1 or 2, comprising: the primer set according to claim 3.

5. Use of the SNP marker related to mortality of piglets according to claim 1 or 2, or the primer set according to claim 3 or the kit according to claim 4 for predicting mortality of piglets.

6. A method of predicting piglet mortality, comprising: predicting the piglet mortality of the test sow by detecting the SNP marker of claim 1 or 2 on the test sow.

7. The method of claim 6, comprising:

extracting the genomic DNA of the sow to be detected;

performing PCR amplification on the genomic DNA of the pig to be detected by using the primer group of claim 3 so as to obtain a PCR amplification product;

sequencing the PCR amplification product, and predicting the piglet mortality of the sow to be detected based on the sequencing result;

wherein, the SEQ ID NO: 1, the mortality rate of piglets with the base C at the 145 th position of the nucleotide sequence shown in the SEQ ID NO: 1, wherein the 145 th base of the nucleotide sequence is T.

8. A system for predicting piglet mortality, comprising:

an amplification unit adapted to amplify the genomic DNA of a sow to be tested using the primer set of claim 3 or the kit of claim 4;

a sequencing unit, connected to the amplification unit, and adapted to sequence the amplified product obtained by the amplification and determine the SNP marker of claim 1 or 2;

a prediction unit connected with the sequencing unit and used for predicting the piglet mortality of the sow to be tested based on the SNP marker,

9. A pig breeding system is characterized by comprising:

a candidate pig acquisition device for providing a plurality of candidate sows;

a trait prediction device connected to the candidate pig acquisition device, the trait prediction device being the system for predicting piglet mortality of claim 8 and being used to predict piglet mortality of the sow to be tested; and

and the breeding device is connected with the character prediction device and is used for selecting and breeding candidate sows with low piglet mortality based on the prediction result of the character prediction device.

10. The pig breeding system of claim 9, wherein the amino acid sequence of SEQ ID NO: 1, T is an indicator of low mortality of piglets.