KR100497017B1 - Highly induced molecule II - Google Patents

Abstract

The present invention relates to apoptosis inducing molecule II (AIM-II), a novel molecule of the TNF-ligand family. Specifically, it relates to an isolated nucleic acid molecule encoding human AIM II protein. The present invention also encompasses vectors, host cells, and recombinant methods of making the same associated with AIM II polypeptides. The invention also relates to a screening method for identifying agonists and antagonists of AIM II activity. Moreover, the present invention relates to therapeutic methods for treating lymphadenopathy, autoimmune diseases, graft-versus-host disease, and inhibiting tumor formation such as tumor cell growth.

Description

Death Induction Molecule II

The present invention relates to new members of the TNF-ligand family. More specifically, the present invention relates to an isolated nucleic acid molecule encoding human Apoptosis Inducing Molecule II (AIM II). AIM II polypeptides are also provided by vectors, host cells and recombinant methods of producing them. The present invention relates to a screening method for identifying agonists and antagonists of AIM II activity. The present invention also relates to a therapeutic method for treating lymphadenopathy, autoimmune disease, graft-versus-host disease, and inhibiting proliferative abnormalities such as tumor cell growth.

Human tumor necrosis factor α (TNF- α ) and β (TNF- β or lymphotoxin) are members involved in various classes of polypeptide mediators including interferons, interleukins and growth factors collectively called cytokines [Beutler, B and Cerami, A., Annu, Ret ,. Immunol., 7: 625-655 (1989).

Tumor necrosis factors (TNF- α and TNF- β ) were first discovered as a result of antitumor activity. It is now known as a polymorphogenic cytokine that can exhibit many biological activities, including the death of some transformed cell lines, mediating cell activation and cell proliferation, and is known to play an important role in immune regulation and inflammation.

Members of the TNF-ligand superfamily known to date include TNF- α , TNF- β (lymphotoxin- α ), LT- β , OX40L, Fas ligand, CD30L, CD27L, CD40L and 4-IBBL. Ligands belonging to the TNF ligand superfamily are acidic TNF-like molecules with sequence homology of about 20% (range from 12% to 36%) of the extracellular domain, and are membrane bound forms of the trimeric / multiplex complex in a biologically active form. Mainly exists. So far, only TNF, LT α and Fas ligands have been identified as soluble forms with the TNF ligand phase [for a general overview, Gruss, H. and Dower, SK ,, Blood, 85 (12): 3378-3404 (1995).

These proteins are also involved in the regulation of cell proliferation, activation and differentiation, including regulation of cell death or cell survival by apoptosis or cytotoxicity [Armitage, R. J., Curr. Opin. Immunol. 6: 407 (1994) and Smith, C. A., Cell 75: 959 (1994).

The development of mammals depends on cell proliferation and differentiation as well as programmed cell death that occurs through apoptosis [Walker et al, Methods Achiev, Exp. Pathol, 13: 18 (1988)], apoptosis plays a major role in the destruction of immune thymic cells that recognize autoantigens. Impairment of this normal elimination process can result in autoimmune diseases (Gammon et al., Immunology Today 12: 193 (1991)).

Itoh et al. [Cell 66: 233 (1991) describe Fas / CD95, a cell surface antigen that mediates apoptosis and is involved in clonal deletion of T-cells. Fas is expressed in active T-cells, B-cells, and neutrophils, in addition to ovaries, thymus, liver, heart and lung of mature mice [Watanabe-Fukunaga et al., J. Immunolo, 148: 1274 ( 1992). Experiments in which monoclonal Abs against Fas were crosslinked to Fas were also confirmed to induce apoptosis [Yonehara et al., J. Exp, Med, 169. 1747 (1989): Trauth et al, Science 245: 301 ( 1989). It has also been shown that binding of monoclonal Abs to Fas can stimulate T-cells under certain conditions [Alderson et al., J. Exp. Med. 178: 2231 (1993).

Fas antigens are cell surface proteins with a relative molecular weight of 45 Kd. Fas genes in both humans and mice are described by Watanabe-Fukunaga et al. [J. Immunol. 148: 1274 (1992) and Ito et al. (Cell 66: 233 (1991)). The proteins encoded by these genes are structurally related to the neural growth factor / tumor necrosis factor receptor superfamily (including two affinity neuronal growth factor receptors and LT _β receptors CD40, CD27, CD30 and OX40). It is a dura protein with homology.

Recently, a Fas ligand has been disclosed (Suda et al., Cell 75: II69 (1993)), whose amino acid sequence indicates that the Fas ligand is a type II transmembrane protein belonging to the TNF family. Fas ligand is expressed in splenocytes and thymus cells. The molecular weight of the purified Fas ligand was 40 kd.

Fas / Fas ligand interactions have been demonstrated to be required for apoptosis after T-cell activation [Ju et al., Nature 373: 444 (1995): Brunner et al., Nature 373: 441 (1995)]. When activated, both proteins are induced on the cell surface. The interaction of the ligand with the receptor then kills the cell. This supports the regulatory role for apoptosis induced by Fas / Fas ligand interactions in the course of normal immune responses.

Polypeptides of the invention have been identified as new members of the TNF ligand phase based on structural and biological similarity.

Clearly, factors are needed to regulate the activation and differentiation of normal and abnormal cells. Therefore, there is a need to identify and characterize these factors that regulate cell activation and differentiation in steady state and disease states. Specifically, it is necessary to isolate and characterize another Fas ligand that controls apoptosis in the treatment of autoimmune diseases, graft versus host disease and lymphadenopathy.

1A-1C show the nucleotide sequence of AIM II (SEQ ID NO: 1) and the amino acid sequence deduced therefrom (SEQ ID NO: 2). The inferred molecular weight of the protein was about 26.4 kDa. The putative transmembrane domain in the AIM II protein is underlined.

2A to 2F show amino acid sequences of the AIM II protein of the present invention, human TNF- α (SEQ ID NO: 3), human TNF- β (SEQ ID NO: 4), human lymph toxin (SEQ ID NO: 5), and human Fas ligand ( The similarity regions between the amino acid sequences of SEQ ID NO: 6) are shown.

3A-3F show the results of analysis of the AIM II amino acid sequence, including alpha, beta, turn and helix regions; Hydrophilic and hydrophobic regions; Amphipathic region; Flexible region; Antigenicity index and surface probabilities are indicated. In the “antigenicity index—James-Wolf” graph, the amino acid residues described in FIGS. 1A-1C are about 13-20, 23-36, 69-79, 85-94, 167-178, 184-196 Nos. 221 through 233 correspond to the AIM II protein region, indicated by the high antigenic region.

details

The present invention provides an isolated nucleic acid molecule containing a polynucleotide encoding an AIM II polypeptide having the amino acid sequence shown in FIGS. 1A-1C (SEQ ID NO: 2) determined by sequencing the cloned cDNA. The AIM II protein of the present invention has sequence homology with human TNF- α (SEQ ID NO: 3), human TNF- β (SEQ ID NO: 4), human lymph toxin (SEQ ID NO: 5), and human Fas ligand (SEQ ID NO: 6). (FIGS. 2A-2F) The nucleotide sequences described in FIGS. 1A-1C (SEQ ID NO: 1) are dated August 22, 1996, at a US fungus culture collection facility in Rockfield, Parkville Drive 12301, 20852, Maryland, USA. The cDNA clone of accession number 97689 deposited with was obtained by sequencing. Deposited clones were included in the pBluescript SK (-) plasmid (available from Stratagene, La Jolla, Canada).

Nucleic acid molecule

Unless stated otherwise, all nucleotide sequences determined by sequencing DNA molecules herein are determined using an automated DNA sequencing device (eg, Model 373 available from Applied Biosystems, Inc.), and sequences herein. All amino acid sequences of the polypeptides encoded by the determined DNA molecules were predicted by translation of the determined DNA sequences as described above. Thus, as is known in the art for loaded DNA sequences determined by such automated sequencing, all nucleotide sequences determined herein may contain some errors. Automated nucleotide sequences are generally at least about 90%, more generally at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be determined more accurately through other approaches, including manual DNA sequencing methods known in the art. In addition, as is known in the art, insertion or deletion of one of the given nucleotide sequences as compared to the actual sequence shifts the backbone upon translation of the nucleotide sequence, starting with this insertion or deletion point and sequenced by the DNA molecule sequenced. The actual encoded amino acid sequence will be completely different from the putative amino acid sequence encoded by the given nucleotide sequence.

Nucleic acid molecules of the present invention encoding AIM II polypeptides utilize standard provided cloning and screening procedures, such as cloning of cDNA using mRNA as the starting material, using the information provided herein, such as the nucleotide sequences set forth in FIGS. 1A-1C. Can be obtained. As an example of the invention, the nucleic acid molecule (SEQ ID NO: 1) described in Figures 1A to 1C was found in a cDNA library derived from human macrophage ox LDL (HMCCB64). This gene has also been identified in cDNA libraries from activated T-cells (HT4CC72). The determined nucleotide sequence of the AIM II cDNA described in FIGS. 1A-1C (SEQ ID NO: 1) is the start codon at positions 49-51 of the nucleotide sequence (SEQ ID NO: 1) of FIGS. 1A-1C, FIGS. 1A-1C ( Extracellular domain containing about 60 to about 240 amino acid residues of SEQ ID NO: 2), transmembrane domain containing about 37 to about 59 amino acid residues of FIGS. 1A to 1C (SEQ ID NO: 2), FIGS. 1A to 1C An open reading frame encoding a protein of 240 amino acid residues having an intracellular domain containing about 1 to about 36 amino acid residues of (SEQ ID NO: 2), wherein the estimated molecular weight is about 26.4 kDa. 1A to 1C described in AIM II protein (SEQ ID NO: 2) has amino acid sequence of human Fas ligand same (Figs. 2A to 2F) and about 27% similar and about 51%, amino acid sequence of human TNF- α (Fig. 2A-2F) about 26% identical and about 47% similar.

As will be appreciated by those skilled in the art, due to the possibility of error in the sequencing described above, the putative AIM II polypeptide encoded by the deposited cDNA contains about 240 amino acids, but any of those in the range of 230 to 250 It may be an amino acid of. It will also be appreciated that the exact "address" of the extracellular, intracellular and transmembrane domains in the AIM II polypeptide will vary slightly depending on the criteria used. For example, the exact location of the AIM II extracellular domain (SEQ ID NO: 2) described in FIGS. 1A-1C may vary slightly depending on the criteria used to define the domain (eg, the address is “moving” about 1-5 residues). Can be).

As indicated, the nucleic acid molecules of the invention may be in the form of RNA, such as mRNA, or in the form of DNA, including cDNA and genomic DNA, obtained by cloning or synthesis. DNA may be double stranded or single stranded. Single-stranded DNA or RNA may be a coding strand, also known as a sense strand, or a non-coding strand, also known as an antisense strand.

By "isolated" nucleic acid molecule is meant DNA or RNA, which is a nucleic acid molecule isolated in its natural environment. For example, recombinant DNA molecules contained in a vector are considered to be isolated in the present invention. Other examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or (partly or nearly) purified DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of DNA molecules belonging to the present invention. Isolated nucleic acid molecules according to the present invention further include synthetically produced molecules.

Isolated nucleic acid molecules according to the present invention include DNA molecules containing an open reading frame (ORF) shown in FIGS. 1A-1C (SEQ ID NO: 1); A DNA molecule containing the coding sequence of the AIM II protein shown in FIGS. 1A-1C (SEQ ID NO: 2); And AIM II proteins, which contain sequences substantially different from those described above but still encode the AIM II protein due to the degeneracy of the genetic code. Of course, genetic code is known in the art. Thus, making such degenerate variants is common to those skilled in the art.

In another aspect, the present invention provides an isolated nucleic acid molecule encoding an AIM II polypeptide having an amino acid sequence encoded by a cDNA clone contained in the plasmid of ATCC Accession No. 97689 deposited August 22, 1996. This nucleic acid molecule preferably encodes a polypeptide encoded by a deposited cDNA clone as described above. In addition, the present invention provides an isolated nucleic acid molecule having the nucleotide sequence shown in FIGS. 1A to 1C (SEQ ID NO: 1) or the nucleotide sequence of AIM II cDNA contained in a deposited clone as described above, or any of the above-described sequences. A nucleic acid molecule having a sequence complementary to is provided. Such isolated molecules, particularly isolated DNA molecules, are useful as gene mapping probes by in situ hybridization with chromosomes and AIM II gene expression detection probes by Northern blot analysis in human tissues.

The invention also relates to fragments of the isolated nucleic acid molecules described herein. A fragment of an isolated nucleic acid molecule having a nucleotide sequence of deposited cDNA or a nucleotide sequence described in FIGS. 1A-1C (SEQ ID NO: 1) is at least about 15 nt in length, useful as a diagnostic probe and primer as described herein. , More preferably about 20 nt or more, even more preferably about 30 nt or more, even more preferably about 40 nt or more. Of course, larger fragments of 50-1500 nt in length can also be usefully used in the present invention, such as deposited cDNAs or fragments corresponding to most but not all of the nucleotide sequences as described in Figures 1A-1C (SEQ ID NO: 1). do. For example, a fragment having a length of 20 nt or more means a fragment containing 20 or more contiguous bases derived from the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in Figs. 1A to 1C (SEQ ID NO: 1).

Preferred nucleic acid fragments of the invention include nucleic acid molecules encoding epitope bearing portions of AIM II proteins. Specifically, such nucleic acid fragments of the invention include polypeptides containing about 13 to about 20 amino acid residues of FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing about 23 to about 36 amino acid residues of FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing about 69 to about 79 amino acid residues of FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing about 85 to about 94 amino acid residues of FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing amino acid residues from about 167 to about 178 of FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing about 184 to about 196 amino acid residues of FIGS. 1A-1C (SEQ ID NO: 2); Nucleic acid molecules encoding polypeptides containing amino acid residues from about 221 to about 233 of FIGS. 1A-1C (SEQ ID NO: 2). We determined that the aforementioned polypeptide fragments are antigenic regions of the AIM II protein. In addition, the method for measuring the epitope bearing portion of this AIM II protein will be described in detail below.

AIM II polynucleotides can be used in accordance with the invention for a variety of uses, specifically those utilizing the chemical and biological properties of AIM-II. Among these uses are autoimmune diseases and abnormal cell proliferation. Another use relates to the diagnosis and treatment of diseases of cells, tissues and organisms.

The invention also relates to the use of AIM II polynucleotides, for example, to detect complementary polynucleotides as diagnostic reagents. Detection of mutant forms of AIM-II associated with dysfunction can add or elucidate the susceptibility or disease diagnosis to diseases resulting from underexpression, overexpression or changes in expression of AIM-II, such as, for example, autoimmune diseases. It can be used as a diagnostic tool. In addition, polynucleotides encoding AIM-II can be used as diagnostic markers for the expression of polypeptides of the invention as these genes are found in many tumor cell lines, including pancreatic tumors, testicular tumors, endometrial tumors and T-cell lymphomas. Can be.

In another aspect, the invention relates to an isolated nucleic acid molecule containing a polynucleotide that hybridizes to some of the polynucleotides present in the cDNA clone contained in the aforementioned nucleic acid molecule, such as ATCC Accession No. 97689, under stringent hybridization conditions. It is about. “Strict hybridization conditions” means 50% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × denhardt solution, 10% dextran sulfate and 20 g Incubate overnight at 42 ° C. in a solution containing / ml denatured, sheared salmon sperm DNA, and wash the filter with 0.1 × SSC at about 65 ° C.

A polynucleotide that hybridizes to “part of” a polynucleotide is at least about 15 nts (nt), more preferably at least about 20 nts, even more preferably at least about 30 nts, and most preferably, relative to a reference polynucleotide. Means polynucleotide (DNA or RNA) that hybridizes to about 30 to 70 nt. This polynucleotide is useful as diagnostic probes and primers as described above and is described in more detail below.

For example, some polynucleotides of "20 nt or more in length" are 20 or more contiguous nucleotides derived from the nucleotide sequence of a reference polynucleotide (e.g., deposited cDNA or nucleotide sequence shown in Figures 1A-1C (SEQ ID NO: 1)). Means.

Of course, polynucleotides that hybridize only to the complementary stretch of the poly A sequence (e.g., the 3 'terminal poly (A) track of the AIM II cDNA described in Figures 1A-1C (SEQ ID NO)) or Y (or U) residues are It is not included in the polynucleotides of the invention used to hybridize with some of the nucleic acids of the invention, since such polynucleotides contain poly (A) stretch or its complement (e.g. virtually all two-chain cDNA clones). This is because they hybridize to all nucleic acid molecules.

As noted above, nucleic acid molecules of the present invention encoding AIM II polypeptides include sequences themselves encoding the amino acid sequence of a polypeptide; Additional sequences such as the coding sequence of the polypeptide and, for example, a sequence encoding a leader or secretory sequence (eg, a preprotein, or a proprotein or preproprotein sequence); Regardless of the presence or absence of additional coding sequences as described above, the coding sequence of the polypeptide and other non-coding sequences such as introns and non-coding 5 'and 3' sequences such as transcription, splicing and polyadenylation signals are important in mRNA processing. Transcribed non-dock sequences that play a role (ie, ribosomal binding and stability of mRNA); It may include, but is not limited to, additional coding sequences that encode another amino acid, such as a sequence that provides additional functionality. Thus, a sequence encoding a polypeptide can be fused to a marker sequence, such as a sequence encoding a peptide that facilitates purification of the fused polypeptide. In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is a hexa-histidine peptide, such as a tag provided in a pQE vector (Qiagen, Inc.), among various commercial products. Gentz et al, Proc, Natl. Acad. Sci. USA 86: 821-824 (1989), such as nucleus-histidine, facilitates purification of the fusion protein. The “HA” tag is another useful peptide for purification, corresponding to an epotope from influenza hemagglutinin protein, as disclosed in Wilson et al., Cell 37: 767 (1984). As described below, other fusion proteins include AIM II with Fc fused at the N- or C-terminus.

In addition, the nucleic acid molecule according to the present invention further comprises encoding a full-length AIM-II polypeptide from which the N-terminal methionine is deleted.

The invention further comprises a portion of the AIM II protein. It relates to a variant of a nucleic acid molecule of the invention that encodes an analog or derivative. Variants can occur naturally like natural allelic variants. "Allele variant" means one of several forms of genes that occupy a predetermined position on the chromosome of an organism (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985)), Variants of non-naturally occurring can be made using mutation techniques known in the art.

Such variants include those produced through nucleotide substitutions, deletions or additions in which one or more nucleotides may be involved. This variant may be modified in cryptographic domains, non-cryptographic domains, or both. Modifications of coding regions can make conservative or non-conservative amino acid substitutions, deletions or additions. Particularly preferred among these are silent substitutions, additions and deletions that do not alter the activity and properties of the AIM II protein or portions thereof. In this respect, conservative substitutions are particularly preferred.

Another embodiment of the present invention provides an antibody comprising (a) a nucleotide sequence encoding an AIM II polypeptide having the complete amino acid sequence of FIGS. 1A-1C (SEQ ID NO: 2); (b) a nucleotide sequence encoding an AIM II polypeptide having a complete amino acid sequence encoded by a cDNA clone contained in ATCC Accession No. 97689; (c) a nucleotide sequence encoding an AIM II polypeptide extracellular domain, (d) a nucleotide sequence encoding an AIM II polypeptide transmembrane domain; (e) a nucleotide sequence encoding an AIM II polypeptide intracellular domain; (f) a nucleotide sequence encoding a soluble AIM II polypeptide having a transmembrane domain but having an extracellular domain and an intracellular domain; And (g) a sequence selected from the group consisting of nucleotide sequences complementary to any of the nucleotide sequences belonging to (a), (b), (c), (d), (e) or (f). 90% or more, more preferably 95%. 96%. An isolated nucleic acid molecule containing a polynucleotide having at least 97%, 98% or 99% identical nucleotide sequence.

A polynucleotide having a reference nucleotide sequence that encodes an AIM II polypeptide, such as at least 95% "identical" nucleotide sequence, refers to a nucleotide sequence of the reference nucleotide sequence that encodes an AIM II polypeptide, although the nucleotide sequence of this polynucleotide is identical to the reference sequence. It can mean up to 5 point mutations per 100. That is, to obtain a polynucleotide having a nucleotide sequence that is at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides of the reference sequence are substituted or deleted with another nucleotide, or up to 5% of the total nucleotides of the reference sequence The number of nucleotides can also be inserted in the reference sequence. Such mutation of the reference sequence occurs at the 5 'end or 3' end position of the reference nucleotide sequence, or is dispersed individually in the nucleotides of the reference sequence between the ends, or as one or more contiguous groups in the reference sequence. It may be distributed.

As a practical matter, any particular nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, the nucleotide sequence described in FIGS. 1A-1C or the nucleotide sequence of the deposited cDNA clone. Whether or not can be determined by conventional methods using known computer programs such as Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981) to find the largest homology segment between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is 95% identical to the reference sequence of the present invention, the percent identity is calculated for the full length reference nucleotide sequence and for the total number of nucleotides of the reference sequence. The parameter should be set so that up to 5% of homology gaps are allowed.

The present invention relates to the nucleic acid sequence described in FIGS. 1A to 1C or to the nucleic acid sequence of deposited cDNA, 90%, 95%, 96%, 97%, regardless of whether it encodes a polypeptide having AIM II activity. At least 98% or 99% identical nucleic acid molecules. This is because even if a particular nucleic acid molecule does not encode a polypeptide having AIM II activity, those skilled in the art know how to use the nucleic acid molecule, for example as a hybridization probe or polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of the invention that do not encode polypeptides having AIM II activity include, inter alia, (1) isolation of the AIM II gene or its Adventit variant from the cDNA library; (2) To a medium chromosome spread to provide accurate chromosomal location of the AIM II gene as described in Verma et al, Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988). In situ hybridization (eg, "FISH") for; And use in northern blot analysis to detect AIM II mRNA expression in specific tissues.

However, in fact AIM II having a sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence set forth in FIGS. 1A-1C (SEQ ID NO: 1) or the nucleic acid sequence of the deposited cDNA. Preferred are nucleic acid molecules encoding polypeptides having protein activity. A "polypeptide with AIM II activity" refers to a polypeptide which, when measured by a specific bioassay, exhibits similar but not necessarily identical activity to the AIM II protein of the present invention. AIM II protein cytotoxic activity can be measured using propidium iodide staining to demonstrate apoptosis as described, eg, in Zarres et al., Cell 70: 31-46 (1992). Alternatively, AIM II-induced deaths are described by Cavierli et al, J. Cell. Biol. II9: 493-501 (1992), can be measured using TUNEL staining.

Brief description of propidium iodide staining is as follows. Cells of tissues or cultures are fixed in formaldehyde, cut into frozen fragments, and stained with propidium iodide. Confocal fluorescence microscopy allows cell nuclei to be observed by propidium iodide. Cell death is observed through nuclear enrichment (chromosome community, contraction and / or nucleation).

Of course, due to the degeneracy of the genetic code, a sequence of at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence (SEQ ID NO: 1) or the deposited cDNA nucleic acid sequence shown in Figs. It will be apparent to one skilled in the art that multiple nucleic acid molecules having will encode polypeptides having "AIM II protein activity". Indeed, since the degenerate variants of these nucleotide sequences all encode the same polypeptide, one of ordinary skill in the art would be able to appreciate it without performing the comparative analysis described above. In addition, it is well understood by those skilled in the art that even the aforementioned nucleic acid molecules which are not degenerate variants also encode polypeptides with an appropriate number of AIM II protein activities. This is because those skilled in the art are fully aware of amino acid substitutions (eg, substitution of first aliphatic amino acids with second aliphatic amino acids) that have little or no significant effect on protein function.

For example, methods for making phenotypic silent amino acid substitutions are described in Bowie, J.U. et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247: 1306-1310 (1990), demonstrating that proteins exhibit surprising resistance to amino acid substitutions. It is.

Vector and Host Cells

The present invention relates to the production of a vector containing the isolated DNA molecule of the present invention, a host cell genetically engineered with the recombinant vector, and an AIM II polypeptide or fragment thereof by recombinant techniques.

Polynucleotides of the invention can be linked to a vector containing a marker for selection for propagation in a host. Generally, plasmid vectors are introduced in the form of precipitates, such as calcium phosphate precipitates, or complexes with charged lipids. If the vector is a virus, it can be packaged in vitro using appropriate packaging cell lines and then transduced into host cells.

The DNA insert should be operably linked to a suitable promoter such as the phage lambda PL promoter, E. colilac, tip and tac promoters, SV40 early and late promoters, promoters of retroviral LTRs, and the like. Those skilled in the art will also know other suitable promoters. In addition, the expression construct will further comprise a ribosome binding site for translation within the transcription initiation site, termination site and transcriptional region. The coding region of the mature transcript expressed by this construct preferably includes a translational site starting at the initiation and termination codon (UAA. UGA or UAG) appropriately located at the end of the polypeptide to be translated.

As mentioned above, the expression vector preferably contains at least one marker for selection. Such markers include dihydrofolate reductase or neomycin resistance genes for eukaryotic cell cultures, and tetracycline or ampicillin resistance genes for E. coli and other bacterial cultures. Representative examples of suitable hosts include bacterial cells such as E. coli Streptomrces and Salmonella typhimurium cells; Fungal cells such as yeast cells; Insect cells such as Drosophila S2 and Spodoptera Sf9 cells; Animal cells such as CHO, COS and Bowes melanoma cells; And plant cells, but not limited thereto. Suitable culture media and culture conditions for the aforementioned host cells are known in the art.

Preferred vectors for use in bacteria include pQE70, pQE60 and pQE-9 available from Qiagen; PBS vectors, phagescript vectors, bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A available from stratazine; And ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among the preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from stratazine; And pSVK3, pBPN, pMSG and PSVL available from Pharmacia. Those skilled in the art will fully know other suitable vectors.

Calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid mediated transfection, electroinjection, transduction, infection or other methods can be used to introduce the construct into host cells. have. Such methods are described in many standard experiments, such as Davies et al., Basic Methods In Molecular Biology (1986).

Polypeptides of the invention may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also other heterologous functional regions. For example, the addition of a region of other amino acids, specifically charged amino acids, to the N-terminus of a polypeptide can enhance stability and persistence in the host cell during purification or subsequent handling and storage. In addition, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final purification of the polypeptide. Methods of adding peptide moieties to polypeptides to induce secretion or excretion, increase stability and facilitate purification are conventional techniques in the art. Preferred fusion proteins contain heterologous regions derived from immunoglobulins that are useful for solubilizing proteins. For example, EP-A-0 464 533 (Canada Corresponding Patent 2045869) discloses a fusion protein that contains a variety of invariant parts of an immunoglobulin molecule along with another human protein or part thereof. In most cases, the Fc portion of the fusion protein is very good for use in therapy and diagnostics, and therefore provides improved pharmacodynamic properties (EP-A 0232 262). On the other hand, in some cases, the fusion protein is expressed in an advantageous manner as described above. It is preferred to delete the Fc moiety after detection and purification. This is the case where the Fc moiety has proven to be a hindrance in treatment and diagnosis, such as when the fusion protein must be used as an antigen for immunization. In drug discovery. Human proteins such as, for example, hIL5, have been used in fusion with the Fc moiety for the purpose of high throughput screening of antagonists of hIL-5 [D. Bennett et al, Journal of Molecular Recognition, Vol. 8: 52-58 (1995) and K. Johanson et al., The Journal of Biological Chemistry, Vol. 270, No. 16: 9459-9471 (1995).

AIM II proteins are prepared by ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin from recombinant cell culture. It can collect | recover and refine | purify by well-known methods including chromatography. More preferably, high performance liquid chromatography ("HPLC") is used for purification. Polypeptides of the present invention include products produced by recombinant techniques from prokaryotic or eukaryotic hosts, including natural purification products, products of chemical synthesis methods, and bacteria, yeast, higher plants, insects and mammalian cells and the like. Depending on the host used in the recombinant production method, the polypeptides of the present invention are glycosylated or aglycosylated. In addition, the polypeptides of the present invention contain initially modified methionine residues, which in some cases are through a host mediated process.

AIM II Polypeptides and Fragments

The invention also provides an isolated AIM II polypeptide having a amino acid sequence encoded by a deposited cDNA or an amino acid sequence described in FIGS. 1A-1C (SEQ ID NO: 2) or a peptide or polypeptide containing a portion of the polypeptide.

It will be appreciated that some amino acid sequences of AIM II polypeptides can be altered without significantly affecting the structure or function of the protein. Considering this difference in sequence, it can be seen that an important region for determining activity exists on the protein.

Accordingly, the present invention further encompasses variants of AIM II polypeptides that exhibit substantial AIM II polypeptide activity or comprise an AIM II protein region, such as a protein site described below. Such mutations include deletions, insertions, inversions, repeats and type substitutions. As noted above, guidance on amino acid changes that are expressively silent may be found in Bowie, J.U. et al., "Deciphering the Message in Protein Sequences. Tolerance to Amino acid Substitutions," Science 247: 1306-1310 (1990).

Thus, fragments, derivatives or analogs of the polypeptides described in FIGS. 1A-1C (SEQ ID NO: 2) or encoded by deposited cDNA are those in which (i) one or more of the amino acid residues is conservative or non-conservative Amino acid residues that are substituted with residues (preferably with conservative amino acid residues) and that are substituted or not encoded by the genetic code; (ii) at least one amino acid residue comprises a substituent; (iii) the mature polypeptide is fused with another compound, such as a compound that increases the half-life of the polypeptide (eg, polyethylene glycol); Or (iv) a mature polypeptide is fused to an additional amino acid such as an IgG Fc fusion region peptide or leader sequence or secretory sequence or a sequence used for purification of a mature polypeptide or proprotein sequence. Such fragments, derivatives and analogs are within the scope of a person skilled in the art from the description herein.

Particularly preferred is the case of substituting charged amino acids with other charged and neutral or negatively charged amino acids. Substitution with neutral or negatively charged amino acids results in a protein with reduced positive charge, which improves the properties of the AIM II protein. Aggregation prevention is also very necessary. Aggregation of proteins not only results in loss of activity, but also results in immunogenicity, which is a problem in preparing pharmaceutical compositions. Pinckard et al., Clin Exp. Immunol. 2: 331-340 (1967), Robbins et al., Diabetes 36: 838-845 (1987): Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems 10: 307-377 (1993).

Substitution of amino acids may also alter binding selectivity to cell surface receptors. Ossta et al., In Nature 361: 266-268 (1993), describe specific mutations that selectively bind TNF- α to only one of two known forms of TNF receptors. have. Thus, AIM II receptors of the invention include one or more amino acid substitutions, deletions or additions through natural mutations or human manipulation.

As shown below, the change is preferably a minor property change, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (Table 1).

TABLE 1

The amino acids present in the AIM II proteins of the invention essential for function can be identified by methods known in the art, such as site directed mutagenesis or alanine scanning mutagenesis [Cunningham and Wells, Science 244: 1081-1085 (1989)]. . Alanine scanning mutagenesis introduces one alanine mutation at every residue in the molecule. The resulting mutant molecules are tested for biological activity such as receptor binding or proliferative activity in vitro or in vivo. Sites important for ligand receptor binding can also be determined through structural analysis such as crystallography, nuclear magnetic resonance or photoaffinity labeling [Smith et al., J. Mol. Biol. 224: 899-904 (1992) and de Vos et al., Science 255: 306-312 (1992).

It is preferred that the polypeptides of the invention are provided in a separate form. "Isolated polypeptide" means a polypeptide that has been isolated in its natural environment. Thus, polypeptides produced and contained in recombinant host cells are considered "isolated" for the present invention. In addition, an “isolated polypeptide” may be a polypeptide that is partially or substantially purified from a recombinant host. For example, recombinantly produced AIM II polypeptide forms can be substantially purified by the one step method described in Smith and Johnson, Gene 67: 31-40 (1988).

Polypeptides of the present invention include polypeptides encoded by deposited cDNA, polypeptides as set forth in FIGS. 1A-1C (SEQ ID NO: 2), polypeptides as set forth in FIGS. Extracellular, transmembrane domains, intracellular domains, transmembrane domains are deleted but contain soluble polypeptides containing some or all of the extracellular and intracellular domains, as well as polypeptides encoded by deposited cDNAs, FIGS. 1A-1C. At least 80% identical to the described polypeptide (SEQ ID NO: 2), more preferably at least 90% or at least 95% identical, even more preferably at least 96%, at least 97%, at least 98% or at least 99% identical And a portion of a polypeptide containing at least 30 amino acids, more preferably at least 50 amino acids, of the polypeptide.

A polypeptide having a reference amino acid sequence of at least 95% and, for example, at least 95% of an AIM II polypeptide, except that the amino acid sequence of the polypeptide includes modifications of up to 5 amino acids for each 100 reference amino acids of the AIM II polypeptide. It means the same as the reference sequence. That is, to obtain a polypeptide having an amino acid sequence that is at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with other amino acids, or up to 5% of the total amino acid residues in the reference sequence may be obtained. It is meant to be inserted into the reference sequence. Such modification of the reference sequence occurs at the amino terminus or carboxy terminus position of the reference amino acid sequence, or is dispersed individually among the residues of the reference sequence between the ends, or as one or more contiguous groups within the reference sequence. It may be.

Indeed, any particular polypeptide is at least 90%, at least 95%, at least 96%, at least 97%, such as the amino acid sequence set forth in FIGS. 1A-1C (SEQ ID NO: 2) or the amino acid sequence encoded by the deposited cDNA clone, Use a known computer program such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711) to determine whether it is 98% or more or 99% or more identical. Can be determined in a conventional manner. When using the Bestfit program or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to the reference sequence of the present invention, the percent identity is calculated for the full length reference amino acid sequence and the total number of amino acid residues in the reference sequence is calculated. The parameter should be set to allow homology gaps of up to 5% for.

As used herein, "AIM II" polypeptides include truncated proteins that retain AIM II polypeptide activity, as well as membrane-bound proteins (containing cytoplasmic domains, transmembrane domains, and extracellular domains). In one embodiment, the soluble AIM II polypeptide comprises some or all of the extracellular domain of the AIM II protein, but the transmembrane region that makes the polypeptide present on the cell membrane is deleted. Soluble AIM II may also contain part of the transmembrane region or part of the cytoplasmic domain or other sequences as long as the protein can be secreted. The heterologous signal peptide may be fused to the N terminus of the soluble AIM II polypeptide such that the soluble AIM II polypeptide is secreted upon expression.

Polypeptides of the invention can be used as molecular weight markers in SDS-PAGE gels or molecular sieve gel filtration columns using methods known in the art.

In another aspect, the invention provides a peptide or polypeptide containing an epitope bearing portion of a polypeptide of the invention. The epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide described herein. By “immunogenic epitope” is meant a portion of a protein that induces an antibody response when the whole protein is an immunogen. Meanwhile, the region of the protein molecule to which the antibody can bind is defined as an "antigenic epitope." The number of immunogenic epitopes present in the protein is less than the number of antigenic epitopes. See, eg, Geysen et al., Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1983).

Regarding the selection of peptides or polypeptides with antigenic epitopes (ie, containing regions of protein molecules to which an antibody can bind), relatively short synthetic peptides similar to some of the protein sequences are typically reactive with partially similar proteins. It is known in the art to be able to induce phosphorus antiserum [Sutcliffe, JG, Shinnick, TM, Green, N. ana Learner, RA (1983) Antibodies that react with predetermined sites on Proteins, Science 219: 660-666. ]. Peptides capable of inducing protein reactive sera are mainly presented in the primary sequence of a protein and can be specified by a simple set of chemical rules that are originally defined as immunodominant regions (ie, immunogenic epitopes) or amino terminus or carboxy of proteins. It is not limited only to the end.

Thus, antigenic epitope bearing peptides and polypeptides of the invention are useful for eliciting antibodies, including monoclonal antibodies that specifically bind to the polypeptides of the invention [Wilson et al. See Cell 37: 767-778 (1984), page 777].

The antigenic epitope bearing peptides and polypeptides of the invention are preferably at least 7, more preferably at least 9 and most preferably at least about 15 to about 30 of the amino acids contained in the amino acid sequence of the polypeptide of the invention. Sequences containing four amino acids.

Non-limiting examples of antigenic polypeptides or peptides that can be used to generate AIM II specific antibodies include polypeptides containing about 13 to about 20 amino acid residues described in FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing about 23 to about 36 amino acid residues set forth in FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing about 69 to about 79 amino acid residues set forth in FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing about 85 to about 94 amino acid residues set forth in FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing about 167 to about 178 amino acid residues described in FIGS. 1A-1C (SEQ ID NO: 2); A polypeptide containing about 184 to about 196 amino acid residues set forth in FIGS. 1A-1C (SEQ ID NO: 2); And polypeptides containing amino acid residues from about 221 to about 233 described in FIGS. 1A-1C (SEQ ID NO: 2). As mentioned above, the inventors found that the polypeptide fragment is the antigenic region of the AIM II protein.

Epitope bearing peptides and polypeptides of the invention can be produced by any conventional method. See, eg, Houghten, R.A. (1985) General method for the rapid solid-Phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids. Proc. Natl. Acad. Sci. USA 82: 5131-5135. Such “Simultaneous Multiple Peptide Synthesis (SMPS)” is described in detail in US Pat. No. 4,631,211 to Hutton et al. (1986).

The AIM II polypeptides of the present invention can be used to treat lymphoid disease that causes lymphadenopathy, and AIM II stimulates the deletion of T cell clones to mediate apoptosis, thereby treating autoimmune diseases and providing peripheral tolerance and cellular It can be used to stimulate toxic T cell mediated apoptosis. AIM II also includes systemic lupus erythematosus (SLE), immunoproliferative disease lymphadenopathy (IPL), angioimmune lymphadenopathy (AIL), immunoblastoma lymphadenosis (IBL), rheumatoid arthritis, diabetes and multiple sclerosis, allergies, and more. It can be used as a research tool to elucidate the biology of autoimmune diseases and to treat graft-versus-host disease.

The AIM II polypeptides of the invention can be used to inhibit proliferative abnormalities such as tumor cell growth. AIM II polypeptides play a major role in tumor destruction through cytotoxicity and apoptosis on specific cells. AIM II also has a proliferative effect on cells of endothelial cell origin and can be used to treat diseases that require growth promoting activity, such as restenosis. Thus, AIM II can be used to regulate blood production in endothelial cell development.

The present invention provides a method for identifying a molecule that binds to AIM II, such as a receptor molecule. Genes encoding proteins that bind to AIM II, such as receptor proteins, can be identified by a variety of methods known in the art, such as ligand panning and FACS classification. Such a method is disclosed in many textbooks such as, for example, Cogligan et al., Current Protocols in Immunology, 1 (2): Chapter 5 (1991).

For example, expression cloning may be used for this purpose. For this method, polyadenylation RNA is prepared from cells that are responsive to AIM II, a cDNA library is made from this RNA, the library is divided into pools, and the pool is used to cells that are not responsive to AIM II. Transfect each. The transfected cells are then exposed to labeled AIM II (AIM II can be labeled by a variety of methods known in the art, including standard methods that contain radioiodine or recognition sites for site specific protein kinases). After exposure, cells are fixed and the binding of AIM II is measured. This procedure is conveniently carried out on a glass slide.

Examine the pool of cDNAs that produce AIM II binding cells. Lower pools are made using the positive group and then transfected with host cells and selected as described above. Repeated sub-fouling and rescreening processes can isolate one or more single clones encoding putative binding molecules, such as receptor molecules.

Alternatively, the labeled ligand can be photoaffinity bound to a cell extract, such as a membrane or an extract of a membrane, prepared from cells expressing a molecule to which the ligand binds, such as a receptor molecule. The crosslinked material is separated via polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray film. The labeled complex containing the ligand-receptor is cleaved off and separated into peptide fragments, followed by protein microsequencing. Amino acid sequences obtained from microsequencing can be used to design native oligonucleotide probes or degenerate oligonucleotide probes to select cDNA libraries to identify genes encoding putative receptor molecules.

In addition, the polypeptides of the invention can be used to assess the AIM II binding capacity of AIM II binding molecules, such as receptor molecules, in cellular or acellular preparations.

Those skilled in the art will fully understand that the above-described AIM II polypeptides of the present invention and epitope bearing fragments thereof can be combined with a portion of the constant portion of an immunoglobulin (IgG) to produce chimeric polypeptides. This fusion protein facilitates purification and exhibits increased half-life in vivo. This has been found for chimeric proteins consisting of, for example, the first two domains of a human CD4 polypeptide and various domains present in the heavy or light chain constant regions of mammalian immunoglobulins [EPA 394,827; Traunecker et al., Nature 331: 84-86 (1988). In addition, fusion proteins having a disulfide-bound dimer structure by the IgG moiety were more effective in binding to and neutralizing other molecules than monomeric AIM II proteins or protein fragments alone [Fountoulakis et al., J Biochem 270: 3958-3964 (1995).

We have found that AIM II is expressed in the spleen, thymus and bone marrow tissue. In addition, in the case of various diseases such as sepsis shock, inflammation, brain malaria, HIV virus activation, graft host rejection, bone resorption, rheumatoid arthritis and cachexia, certain tissues (eg, spleen, thymus gland) from individuals with these diseases And AIM II gene expression levels in bone marrow tissue) or body fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid), which are AIM II expression levels present in tissues or body fluids collected from individuals without the aforementioned diseases. "We thought that it would be detected significantly higher or lower than the AIM II gene expression level. Accordingly, the present invention provides a method of analyzing the AIM II gene expression level present in a cell or body fluid of an individual, (b) comparing the AIM II gene expression level to a standard AIM II gene expression level, Compared with the increase or decrease of the analyzed AIM II gene expression level compared to determining the disease, provides a diagnostic method useful for diagnosing the disease.

AIM II Agonists and Antagonists

The present invention provides a method for screening compounds to identify compounds that enhance or block the action of AIM II on cells, including the interaction of AIM II with AIM II binding molecules such as receptor molecules. Agonists are compounds that increase the natural biological action of AIM II or act in a similar manner to AIM II, and antagonists are compounds that reduce or eliminate this action.

For example, cell compartments, such as membrane preparations, can be prepared from cells expressing molecules that bind to AIM II, such as signaling pathways or molecules of the regulatory pathway regulated by AIM II. This preparation is incubated with labeled AIM II in the presence or absence of a candidate molecule that is an AIM II agonist or antagonist. Decreased binding of the labeled ligands observes the ability of the candidate molecule to bind to the binding molecule or AIM II itself. Molecules that freely bind, ie molecules that do not induce the effects of AIM II when bound to AIM II binding molecules, are considered the best antagonists. Molecules with good binding properties and inducing effects identical or very similar to AIM II are considered to be good agonists.

Determination of AIM II-like effects of potential agonists and antagonists, for example, by interacting with a candidate molecule with a cell or a suitable cell preparation and then measuring the activity of the second messenger system, and determining the effect of AIM II or This is compared with the effect of molecules that induce the same effect. Second messenger systems usefully used in this regard include, but are not limited to, AMP guanylate cyclase, ion channel or phosphonoinositized hydrolysis second messenger systems.

Another example of an AIM II antagonist assay is a competitive assay that binds AIM II and a potential antagonist with a membrane bound AIM II receptor molecule or recombinant AIM II receptor molecule under suitable conditions of a competitive inhibition assay. AIM II can be labeled with radioactivity or the like to accurately measure the number of AIM II molecules bound to receptor molecules to assess the effects of potential antagonists.

Potential antagonists include small organic molecules, peptides, polypeptides, and antibodies that bind to and inhibit or extinguish the activity of the polypeptides of the invention. In addition, potential antagonists are small, such as prominent proteins or antibodies that block the action of AIM II by binding to the same site on a binding molecule, such as a receptor molecule, without inducing AIM II inducing activity. Organic molecules, peptides or polypeptides.

Other potential antagonists include antisense molecules. Antisense techniques can be used to regulate gene expression via antisense DNA or RNA or through triple helix formation. Antisense techniques are described, for example, in Okano, J. Neurochem. 56: 560 (1991): Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is described, for example, in Lee et al., Nucleic Acids Research 6: 3073 (1979): Cooney et al, Science 241: 456 (1988); And Dervan et al, Science 251: 1360 (1991). These methods are based on the binding of polynucleotides to complementary DNA or RNA. For example, the 5 'coding of a polynucleotide encoding a mature polypeptide of the present invention allows the design of antisense RNA oligonucleotides of about 10 to 40 base pairs in length. It makes DNA oligonucleotides complementary to the gene regions involved in transcription, thereby blocking the transcription and production of AIM II. Antisense RNA oligonucleotides hybridize to mRNA in vivo, preventing mRNA molecules from being translated into AIM II polypeptides. In addition, the above-described oligonucleotides can be delivered to cells to express antisense RNA or DNA in vivo, thereby inhibiting the production of AIM II.

Antagonists can be used in the compositions with pharmaceutically acceptable carriers as described below.

Antagonists can be used to treat cachexia, a lipid removal defect resulting from systemic deficiency of lipoprotein lipase, which is believed to be inhibited by, for example, AIM II. In addition, AIM II antagonists can be used to treat cerebral malaria in which AIM II plays a pathogenic role and to inhibit AIM II induced production of inflammatory cytokines such as IL1 in synovial cells to treat rheumatoid arthritis. When treating arthritis, AIM II antagonists are preferably injected intraarticularly.

In addition, AIM II antagonists can be used to prevent graft host rejection by blocking stimulation of the immune system during transplantation.

AIM II antagonists can be used to inhibit bone resorption and thus treat and / or prevent osteoporosis.

Antagonists can be used as anti-inflammatory agents and for the treatment of shock resistance. These dangerous diseases result from overreaction to bacteria and other types of infections.

Cancer prognosis

Certain tissues in cancerous mammals are said to have significantly lower levels of expression of mRNA and AIM II protein coding for AIM II protein compared to the corresponding "standard" mammals, ie, all mammals that are not cancerous. In addition, the level of AIM II protein present in certain body fluids (eg, serum, plasma, urine and spinal fluid) from mammals with cancer is also comparable to the levels in serum from mammals of the same type with no cancer. It is said to be reduced. Accordingly, the present invention provides a diagnostic method useful for tumor diagnosis, which method comprises the steps of analyzing the expression level of an AIM II protein coding gene present in mammalian cells or body fluids, and the expression level of the gene and standard AIM II gene expression. Comparing the levels to identify specific tumors through reduced gene expression levels compared to standard levels.

When tumor diagnosis has already been made by conventional methods, the present invention is useful as a prognostic indicator, i.e., patients with increased AIM II gene expression levels have better clinical results than patients with less gene expression levels. Can be represented.

"Analyzing the expression level of a gene encoding an AIM II protein" refers directly to the level of mRNA encoding an AIM II protein or the level of an AIM II protein (eg, the absolute level of a protein or mRNA) present in a first biological sample. Measure or estimate) or relative (eg, as compared to AIM II protein levels or mRNA levels present in the second biological sample) quantitatively or qualitatively.

Preferably, the AIM II protein level or mRNA level present in the first biological sample is measured or estimated and then compared to a standard AIM II protein level or mRNA level, where the standard level is in an individual who does not have cancer. It is the value measured using the obtained 2nd biological sample. As will be appreciated by those skilled in the art, once known standard AIM II protein levels or mRNA levels can be used repeatedly as a standard for comparison.

"Biological sample" means any biological sample obtained from an individual, cell line, tissue culture or other source containing AIM II protein or mRNA. Biological samples include mammalian body fluids (e.g. serum, plasma, urine, synovial fluid and spinal fluid) and ovaries, prostate, heart, placenta, pancreas, liver, spleen, lung, breast and navel tissue that contain secreted mature AIM II protein. This includes.

The present invention is useful for detecting cancer in mammals. In particular, the present invention is useful for diagnosing cancers of the mammal such as breast, ovary, prostate, bone, liver, lung, pancreas and spleen. Preferred mammals are monkeys, apes, cats, dogs, cattle, pigs, horses, rabbits and humans. Especially preferred are humans.

Total cell RNA is described by Chomczynski ana Sacchi, Anal. Biochem. 162. 156-159 (1987)] is used to isolate from biological samples using the one-stage guanidinium-thiocyanate-phenol-chloroform method. Next, an appropriate method is used to analyze the level of mRNA encoding the AIM II protein. This analytical method includes Northern Blot analysis (Harada et al., Cell 63: 303-312 (1990)), S1 nuclease mapping [Fujita et al., Cell 49: 357-367 (1987)], polymerase chain reaction (PCR), reverse transcription in combination with polymerase chain reaction (RT-PCR) (Makino et al., Technique 2: 295-301 (1990)) and reverse transcription in combination with ligase chain reaction (RT-LCH). Included.

AIM II protein level analysis present in biological samples can be performed using antibody based techniques. For example, AIM II protein expression in tissues can be studied using classical immunohistologic methods [Jalkanen, M., et al., J. Cell. Biol, 101'976-985 (1985); Jalkanen, M, et al., J, Cell. Biol. 105. 3087-3096 (1987)].

Other antibody-based methods useful for detecting expression of AIM II protein genes include immunoassays such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA).

Suitable labels are known in the art, for example enzyme labels such as glucose oxidase, iodine ( ¹²⁵ I, ¹²¹ I), carbon ( ¹⁴ C), sulfur ( ³⁵ S), tritium ( ³ H), indium ( ¹¹² In) and radioisotopes such as technetium ( ^99m 7C); And fluorescent labels such as fluorescein and rhodamine and biotin.

cure

AIM II polypeptides, specifically human AIM II polypeptides, can be used to treat hyperplasia, lymphadenopathy, autoimmune diseases, graft-versus-host disease. In addition, the AIM II polypeptides of the present invention can be used to inhibit proliferative abnormalities such as tumor cell growth. AIM II polypeptides play an important role in destroying tumors through cytotoxicity and killing of specific cells. In addition, AIM II has a proliferative effect on cells of endothelial cell origin and thus can be used to treat diseases requiring growth promoting activity, such as relapsing stenosis. Thus, AIM II can also be used to regulate blood production in endothelial cell development.

Dosing method

Diseases as described above can be treated by administering AIM II protein. Accordingly, the present invention also relates to pharmaceutical compositions containing an effective amount of an isolated AIM II polypeptide of the invention, specifically a mature form of AIM II, which is effective for increasing AIM II activity levels in a subject in need thereof. Provided are methods for treating an individual comprising administering to the individual.

As a general suggestion, the total pharmaceutical effective amount of AIM II polypeptide per parentally administered ranges from about 1 μg / kg / day to 10 mg / kg / day, depending on the weight of the patient, but as described above, Depends. More preferably, it is at least 0.01 mg / kg / day, most preferably about 0.01 to 1 mg / kg / day as a hormone for humans. For continuous administration, AIM II polypeptides are generally administered at a dosage of about 1 μg / kg / hr to about 50 μg / kg / hr, with 1-4 injections per day, such as using a minipump. Continuous subcutaneous injection. In addition, an intravenous bag solution can also be used.

Pharmaceutical compositions containing AIM II of the present invention can be administered orally, rectally, parenterally, intranasally, intravaginally, intraperitoneally, topically (powders, ointments, drops or transdermal patches), buccal or oral or nasal sprays. . "Pharmaceutically acceptable carrier" means a nontoxic solid, semisolid or liquid filler, diluent, encapsulating material or any form of adjuvant. As used herein, the term “parenteral” refers to a mode of administration that includes intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injections and infusions.

In addition to soluble AIM II polypeptides, AIM II polypeptides containing a transmembrane region can also be used when a detergent such as Triton X-100 is included in a buffer and properly dissolved.

Chromosome Analysis

Nucleic acid molecules of the invention are very important for chromosome identification. The sequence specifically targets and hybridizes to a specific position among individual human chromosomes. DNA mapping to chromosomes according to the present invention is an important first step in the correlation of sequences with genes associated with disease.

In this particular preferred embodiment, the genomic DNA of the AIM II protein gene is cloned using the cDNA disclosed herein. This can be done through various known techniques and libraries that are generally commercially available. Genomic DNA is then used for in situ chromosome mapping using known techniques for this purpose.

In some cases, PCR primers (preferably 15-25 bp) can be prepared from cDNA to map sequences to chromosomes. Computational analysis of the 3 ′ non-toxic region of the gene allows for the rapid selection of primers that span one or more exons present in genomic DNA without complicating the amplification process. These primers are then used for PCR selection of somatic hybrids containing individual human chromosomes.

Fluorescent in situ hybridization (“FISH”) of cDNA clones to mid-term chromosomal spreads can be used to provide accurate chromosomal location in one step. The technique can be carried out using probes derived from cDNA short as 50 bp or 60 bp. See Verma et al., Human Chromosomes: A Manual Of Basic Techniques, Pergamon Press, New York (1988) for this technique.

Once a sequence is mapped to the correct chromosomal location, the physical location of that sequence on the chromosome can be correlated with genetic map data. Such data are available, for example, online via the Jones Homekins University Welch Medical Library [V. Mckusick, Mendelian Inheritance In Man. The relationship between the disease and the genes mapped to the same chromosomal region is then confirmed through linkage analysis (cogeneity of physically contiguous genes).

Next, it is necessary to measure the difference in cDNA or genomic sequence between the diseased and the diseased individuals. Although not observed in normal individuals, if mutations are observed in some or all of the diseased individuals, the mutations are likely causative agents of the disease.

While the present invention has been described in general, the present invention will be more readily understood by reference to the following examples, which are intended to illustrate, but not to limit, the invention.

Summary of the Invention

The present invention encodes an AIM II polypeptide having an amino acid sequence set forth in FIGS. 1A-1C (SEQ ID NO: 2) or an amino acid sequence encoded by a cDNA clone deposited in a bacterial host as ATCC Accession No. 97689 dated August 22, 1996. An isolated nucleic acid molecule containing a polynucleotide is provided.

In addition, the present invention provides a recombinant vector containing the isolated nucleic acid molecule of the present invention, a host cell containing the recombinant vector, and a method for producing such a vector and a host cell, and using them for the production of an AIM II polypeptide or peptide through recombinant techniques. It is about how to.

The invention also provides an isolated AIM II polypeptide having an amino acid sequence encoded by a polynucleotide described herein.

The term "AIM II" polypeptide as used herein includes membrane-binding proteins (including cytoplasmic domains, transmembrane domains and extracellular domains) as well as truncated proteins that retain AIM II polypeptide activity. As a first embodiment, the soluble AIM II polypeptide comprises all or part of the extracellular domain of the AIM II protein, but the transmembrane region capable of retaining the polypeptide on the cell membrane is deleted. In addition, soluble AIM II may also include a portion of the transmembrane region or a portion or other sequence of the cytoplasmic domain as long as it can secrete soluble AIM II protein. The heterologous signal peptide may be fused to the N-terminus of the soluble AIM II polypeptide such that the soluble AIM II polypeptide is secreted upon expression.

The present invention also provides AIM II polypeptides, specifically human AIM-II polyfeltide, which can be used to treat lymphadenopathy, autoimmune disease, graft-versus-host disease, stimulate peripheral tolerance, It can be used to disrupt converted cell lines and mediate cell activation and cell proliferation, and is functionally linked as a primary mediator of immune regulation and inflammatory responses.

The present invention also provides compositions comprising AIM II polynucleotides or AIM II polypeptides for administration to in vitro cells, ex vivo cells and in vivo cells or multicellular organisms. In a particularly preferred embodiment of this aspect of the invention, the composition of the invention contains an AIM II polynucleotide capable of expressing an AIM II polypeptide in a host organism for treating a disease. In this regard, particular preference is given to expression in human patients to treat dysfunction associated with aberrant endogenous activity of AIM II.

The present invention also provides a screening method for identifying a compound capable of enhancing or inhibiting a cellular response response induced by AIM II, which comprises contacting a cell expressing AIM II with a candidate compound, Analyzing and comparing the cell response response with the standard cell response response. In the above method, the standard cell response response is analyzed by contact reaction without addition of the candidate compound, and the cell response response increased than the standard cell response response indicates that the compound is a working substance, and is reduced by the standard cell response response. The cell response response indicates that the compound is an antagonist.

In another aspect, the present invention provides a method for screening AIM II agonists and antagonists. Antagonists can be used to prevent septic shock, inflammation, cerebral malaria, HIV virus activation, graft-host rejection, bone resorption, rheumatoid arthritis and cachexia (consumable or malnourished).

Another aspect of the invention is a method of treating an individual comprising administering to a subject in need of an increased amount of AIM II activity in the body a composition containing a therapeutically effective amount of an isolated AIM II polypeptide of the invention or an agonist thereof. It is about.

Another aspect of the invention relates to a method of treating an individual comprising administering to the individual in need thereof a composition containing a therapeutically effective amount of an AIM II antagonist.

Example 1: E. Expression and Purification of AIM II in Coli

Expression of AIM II with A N-terminal HA Tag

The DNA sequence encoding the AIM II protein present in the deposited cDNA clone was amplified using PCR oligonucleotide primers specific for the amino terminal sequence of the AIM II protein and the 3 'vector sequence of the gene. Additional nucleotides containing restriction sites to facilitate cloning were added to each of the 5 'and 3' sequences.

A 22 kDa AIM II protein fragment (N-terminal and transmembrane regions deleted) was expressed using the following primers.

5 'oligonucleotide primer: 5' GCGGGATCCGGAGAGATGGTCACC 3 '(SEQ ID NO: 7). A sequence encoding 244 to 258 nucleotides of the AIM II protein coding sequence set forth in FIGS. 1A-1C (SEQ ID NO: 1), wherein the underlined sites are BamHI restriction sites.

3 'Primer: 5'CGCAAGCTTCCTTCACACCATGAAAGC 3' (SEQ ID NO: 8) Sequence containing the underlined HindIII restriction site followed by 756-783 nucleotides described in Figures 1A-1C

Total AIM II protein can be expressed using the following primers.

5 'Oligonucleotide Primer: encodes 22 nucleotides of the AIM II protein coding sequence set forth in 5' GACCGGATCCATGGAGGAGAGTGTCGTACGGC 3 '(SEQ ID NO: 9), Figures 1A-1C (SEQ ID NO: 1), and contains an underlined BamHI restriction site order

3 'primer: 5'CGCAAGCTTCCTTCACACCATGAAAGC 3' (SEQ ID NO: 10). A sequence containing 756-783 nucleotides described in Figures 1A-1C following the underlined HindIII restriction site

The restriction site is conveniently used for restriction enzyme sites present in the bacterial expression vector pQE9, which is useful for bacterial expression in this example (Qiagen, Inc., 91311, Chasworth Eaton Avenue 9259, CA). ). pQE9 encodes an ampicillin antibiotic resistance gene ("Amp ^r ") and includes a bacterial replication origin ("ori"), an IPTG inducible promoter, a ribosomal binding site ("RBS"), a 6-His tag and a restriction enzyme site. .

Both amplified AIM II DNA and vector pQE9 are digested with BamHI and HinaIII, and then the digested DNA is ligated together. Insertion of the AIM II protein DNA into the restriction digested pQE9 vector results in the initiation AUG appropriately positioned to operably bind the AIM II protein coding region downstream of the vector's IPTG inducible promoter and to decode the AIM II protein. Place it in-frame with.

B. Expression of AIM II with C-terminal HA Tag

In this example, the bacterial expression vector pQE60 was used for bacterial expression (Qiagen, Inc., 9159, Chatsworth Eaton Avenue, California, USA). pQE60 encodes an ampicillin antibiotic resistance gene ("Amp ^r "), and is the origin of bacterial replication ("ori"), IPTG inducible promoter, ribosomal binding site ("RBS"), nickel-nitrilo-tri-acetic acid (" Ni-NTA ") six codons encoding histidine residues that allow for affinity purification using an affinity resin (Qiagen, commercially available, described above), and a suitable single restriction enzyme cleavage site. . These components are arranged such that an inserted DNA fragment encoding a polypeptide expresses a polypeptide covalently linked to six His residues (ie, "6 X His tags") at the carboxyl terminus of the polypeptide.

DNA sequences encoding target sites of the AIM II protein are amplified from deposited cDNA clones using PCR oligonucleotide primers. The primers anneal to the 3 'side sequence of the cDNA coding sequence in the deposited construct with the amino terminal sequence of the target site of the AIM II protein. Additional nucleotides are added to each of the 5 'and 3' sequences containing restriction sites that facilitate cloning into the pQE60 vector.

For protein cloning, the 5 'primer is a sequence 5'GACCC CCATGG AG GAG GAG AGT GTC containing an underlined NcoI restriction site followed by a nucleotide complementary to the amino terminal coding sequence of the AIM II sequence described in Figures 1A-1C. Use with GTA CGG C 3 ′ (SEQ ID NO: 17). It will be appreciated by those skilled in the art that the starting point of the 5 'primer in the protein coding sequence can be modified (hanger or shorter) to amplify the DNA fragment encoding any desired site in the entire protein. 3 'primer is underlined BamHI restriction site and the following FIGS. 1A-3 coding sequence immediately before the stop codon of the DNA sequence shown in AIM II 1C' sequence containing a complementary nucleotide at the terminal 5'GACC GGATCC CAC CAT GAA AGC CCC GAA GTA AG 3 ′ (SEQ ID NO: 18), wherein the coding sequence is aligned with the restriction site to maintain the reading frame and sequence of the six His codons present in the pQE60 vector.

The amplified AIM II DNA fragment and the vector pQE60 are digested with BamHI and NcoI, and the digested DNA is then ligated together. AIM II DNA is inserted into the restriction digested pQE60 vector to place the AIM II protein coding region downstream of the IPTG inducible promoter and in frame with the starting AUG and six histidine codons.

Competent E. coli cells are transformed according to standard methods using ligation mixtures derived from expression constructs with HA tags made in A or B described above. This method is described in Sambrook et al, Molecular Cloning: a Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989). The examples exemplified herein are carried out using E. coli strain M15 / rep4 containing multiple copies of plasmid pREP4 which expresses a lac refresher and confers kanamycin resistance ("Kan ^r "). The strain, one of a number of strains suitable for expressing AIM II protein, is available from Qiagen.

Transformants are selected by their ability to grow on LB plates containing ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the presence of the cloned DNA is confirmed by restriction analysis.

Clones containing the desired constructs are grown overnight (“O / N”) in liquid culture in LB medium supplemented with ampicillin (100 μg / ml) and kanamycin (25 μg / ml).

The O / N culture is used to inoculate the bulk culture at a dilution of about 1: 100 to 1: 250. The cells are grown so that the optical density at 600 nm (“OD600”) is between 0.4 and 0.6. Isopropyl- β -D-thiozalactopperanoside ("IPTG") is then added at a final concentration of 1 mM to inactivate the lacI repressor to induce transcription from the lac repressor sensitive promoter. The cells are further incubated for 3-4 hours. Cells are then harvested by centrifugation using standard methods and then destroyed. Inclusion bodies are purified from disrupted cells by conventional harvesting techniques, and proteins are solubilized from the inclusion bodies into 8M urea. An 8M urea solution containing solubilized protein is passed through a PD-10 column in 2X phosphate buffered saline ("PBS") to remove urea and exchange buffers to refold the protein. The protein is then further purified by additional chromatography steps to remove endotoxins. Then, sterile filtration. Sterile filtered protein preparations are stored in 2X PBS at a concentration of 95 μ / ml.

C. Expression and Purification of AIM II Without HA Tag

In this example, the bacterial expression vector pQE60 was used for the expression of bacteria (Qiagen, Inc., 9159, Chasworth Eaton Avenue 9259, CA). pQE60 encodes an ampicillin antibiotic resistance gene ("Amp ^r "), and is the origin of bacterial replication ("ori"), IPTG inducible promoter, ribosomal binding site ("RBS"), nickel-nitrilo-tri-acetic acid (" Ni-NTA ") six codons encoding histidine residues that allow for affinity purification using an affinity resin (Qiagen, Inc., described above), and a suitable single restriction enzyme cleavage site. These components are arranged such that an inserted DNA fragment encoding a polypeptide expresses a polypeptide covalently linked to six His residues (ie, "6X His tags") at the carboxyl terminus of the polypeptide. In this example, however, the polypeptide coding sequence is inserted such that the translation of six His codons is blocked, resulting in a polypeptide that does not contain a 6X His tag.

The DNA sequence encoding the target site of the AIM II protein, from which the hydrophobic leader sequence was deleted, is a PCR oligonucleotide primer that anneals to the 3 'side sequence of the cDNA coding sequence in the deposited structure with the amino terminal sequence of the target site of the AIM II protein. Amplify from deposited cDNA clones. Additional nucleotides containing restriction sites that facilitate cloning into the pQE60 vector are added to each of the 5 'and 3' sequences.

To clone the protein, the 5 'primer is a sequence 5' GACGC CCATGG AG GAG GAG AGT containing an underlined NcoI restriction site followed by a nucleotide complementary to the amino terminal coding sequence of the AIM II sequence described in Figures 1A-1C. GTC GTA CGG C 3 ′ (SEQ ID NO: 17) is used. It will be appreciated by those skilled in the art that the starting point of the 5 'primer in the protein coding sequence can be modified (longer or shorter) to amplify any desired site in the overall protein. The 3 'primer is a sequence 5' CGC AAGCTT CCTT CAC ACC ATG AAA GC 3 containing an underlined HindIII restriction site followed by a nucleotide complementary to the 3 'end of the noncoding sequence in the AIM II DNA sequence described in Figures 1A-1C. (SEQ ID NO: 19).

The amplified AIM II DNA fragment and the vector pQE60 are digested with NcoI and HindIII, and then the digested DNA is ligated together. The AIM II DNA is inserted into the restriction digested pQE60 vector to place the AIM II protein coding region to which the stop codon is bound downstream of the IPTG inducible promoter and in frame with the starting AUG. The bound stop codon blocks the translation of the six histidine codons downstream of the insertion point.

The ligation mixture is used to transform competent E. coli cells according to standard methods. This method is described in Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd Ed ,, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N, Y. (1989). The examples exemplified herein are carried out using E. coli strain M15 / rep4 containing multiple copies of plasmid pREP4 which expresses a lac refresher and confers kanamycin resistance ("Kan ^r "). The strain, one of a number of strains suitable for expressing AIM II protein, is available from Qiagen, Inc. (described above). Transformants are selected by their ability to grow on LB plates containing ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the presence of the cloned DNA is confirmed by restriction analysis, PCR and DNA sequencing.

Clones containing the desired constructs are grown overnight (“O / N”) in liquid culture in LB medium supplemented with ampicillin (100 μg / ml) and kanamycin (25 μg / ml). Inoculate the bulk culture at a dilution between about 1.25 and 1: 250. The cells are grown so that the optical density at 600 nm (“OD600”) is between 0.4 and 0.6. Isopropyl- β -D-thiogalactopyranoside ("IPTS") is then added at a final concentration of 1 mM to inactivate the lacI repressor to induce transcription from the lac repressor sensitive promoter. The cells are further incubated for 3-4 hours. The cells are then harvested by centrifugation.

The cells are then stirred for 3-4 hours at 4 ° C. in 6M guanidine-HCl (pH 8). Cell debris is removed by centrifugation and the supernatant containing AIM II is dialyzed against 50 mM Na-acetate buffer (pH 6) supplemented with 200 mM NaCl. Alternatively, the protein is successfully refolded if the protein is dialyzed against a solution containing a protease inhibitor and containing 500 mM NaCl, 20% glycerol, 25 mM Tris / HCl, pH 7.4. Reconstructed proteins can be purified by ion exchange, hydrophobic interactions and size exclusion chromatography. Alternatively, pure AIM II proteins can be obtained using affinity chromatography steps such as antibody columns. Purified protein is stored at 4 ° C. or frozen at −80 ° C.

Example 2: Cloning and Expression of AIM II Proteins in Baculovirus Expression Systems

The cDNA sequence encoding the full length AIM II protein present in the deposited clones is amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the gene.

The 5 'primer is the sequence 5'GCT CCA GGA TCC GCC ATC ATG GAG GAG AGT GTC GTA CGG C 3' containing the underlined BamHI restriction enzyme site followed by the 22 base sequences of the AIM II protein described in Figures 1A-1C. (SEQ ID NO: 11). Inserting it into the expression vector as shown below, the 5 'end of the amplification fragment encoding AIM II provides an effective signal peptide. See Kozak, M ,, J. Mol Biol. 196: 947-950 (1987), a signal effective for initiating translation in eukaryotic cells is appropriately located at the vector site in the construct.

The 3 'primer was sequence 5'GA CGC GGT ACC GTC CAA TGC ACC ACG CTC CTT CCT containing the underlined Asp 718 restriction site followed by nucleotides complementary to nucleotides 769-795 of AIM II described in FIGS. 1A-1C. TC 3 ′ (SEQ ID NO: 12).

Amplified fragments are separated from 1% agarose gels using a commercial kit (“Geneclean”, BIO 101 Inc., Lazolla, Calif.). The fragment is then digested with BamHI and Asp718 and again purified on 1% agarose gel. This fragment is referred to herein as F2.

Vector pA2-GP is a standard method as described in Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Precedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987). Was used to express the AIM II protein. This expression vector contains a strong polyhedrin promoter of Autographa californica nuclear polyhedron virus (AcMNPV) followed by convenient restriction sites. The signal peptide of AcMNPV gp67 containing N-terminal methionine is located immediately upstream of the BamHI site. The polyadenylation site of Simian virus 40 (“SV40”) is used for effective polyadenylation. To facilitate selection of recombinant viruses, the beta-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter, followed by the polyadenylation signal of the polyhedrin gene. On both sides of this polyhedrin sequence, a live virus expressing a cloned polynucleotide with a viral sequence for cell mediated homologous recombination with wild-type viral DNA is produced.

As will be appreciated by those skilled in the art, pAc373, in place of pA2-GP, may be provided, if the construct provides suitably positioned signals such as in-frame AUG and signal peptides used for transcription, translation, trafficking, and the like, as needed. Other baculovirus vectors such as pVL941 and pAcIM1 can also be used. Such vectors are described in Luckow et al., Virology 170: 31-39.

This plasmid is digested with the restriction enzymes BamHI and Asp718 and then dephosphorylation using small intestine phosphatase according to procedures known in the art. DNA is then isolated from a 1% agarose gel using a commercial kit (“Geneclean”, BIO 101 Inc., Lazolla, Calif.). This vector DNA is referred to herein as "V".

Fragment F2 and dephosphorylated plasmid V2 are ligated with T4 DNA ligase. E. coli HB101 cells are transformed with the ligation mixture and plated in culture plates. Bacteria Bacteria containing plasmids with human AIM II genes were identified by digesting DNA from individual colonies with XbaI and then analyzing the degradation products by gel electrophoresis. The sequence of the cloned fragment was confirmed by DNA sequencing. This plasmid is referred to herein as PBac AIM II.

5 μg of the plasmid pBac AIM II was prepared using commercially available linearized baculovirus DNA according to the lipofection described in Felgner et al., Proc. Natl Acad. Sci, USA 84: 7413-7417 (1987). Co-transfection with 1.0 μg of “BaculoGold ™ baculovirus DNA”, Farmingen, San Diego, Calif.). 1 μg of BaculoGold ™ virus DNA and 5 μg of plasmid pBac AIM II are mixed in sterile wells of microtiter plates containing 50 μg of serum-free Grace medium (Life Technologies, Inc., Gettersburg, Md.). It was. Then, 10 μl of lipofectin and 90 μl of Grace's medium were added and mixed, followed by incubation for 15 minutes at room temperature. The transfection mixture was then added dropwise to Sf9 insect cells (ATCC CRL 1711) inoculated into a 35 mm tissue culture plate containing 1 ml of serum free medium. The plate was shaken back and forth to mix the newly added solution and then the plate was incubated at 27 ° C. for 5 hours. After 5 hours, the transfection solution was removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum was added. The plate was put back into the incubator and incubated at 27 ° C. for 4 days.

After 4 days, the supernatants were harvested and plaque assayed as described in Summers and Smith, supra. Agarose gels containing "Blue Gal" (Life Technologies, Inc.) can be used to easily identify and isolate gal expressing clones that produce blue plaques (details for this type of "plaque assay" Description is set forth in User Guide to Insect Cell Culture and Baculovirology, distributed by Life Technologies Inc., Gathersburg, pages 9-10).

Virus was serially diluted for 4 days and then added to the cells. After appropriate incubation, blue plaques were collected with an Eppendorf pipette tip. The agar containing the recombinant virus was then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. Agar was removed by instant centrifugation and supernatants containing recombinant barflovirus were used to infect Sf9 cells inoculated into 35 mm dishes. After 4 days, the supernatant of this culture dish was collected and stored at 4 ° C. Clones containing hESSBs I, II and III that have been properly inserted by DNA assays, including restriction maps and sequencing, are identified. This is referred to herein as V-AIM II.

Sf9 cells were grown in 10% heat inactivated FBS supplemented Grace medium. The cells were infected with recombinant baculovirus V-AIM II to a multiplicity of infection (“MOI”) of about 2 (about 1 to about 3). After 6 hours, the medium was removed and replaced with SF900 II medium (Life Technologies Inc., Gathersburg, USA) without methionine and cysteine. After 42 hours, 5 μCi of ³⁵ S-methionine and 5 μCi of ³⁵ S-cysteine (Amersham) were added. Cells were further incubated for 16 hours, then centrifuged, harvested and lysed, and the resulting labeled proteins were visualized by SDS-PAGE and autoradiography.

Example 3: Cloning and Expression in Mammalian Cells

Most vectors used for the transient expression of AIM II protein gene sequences in mammalian cells contain SV40 replication origin. Therefore, the vector can be replicated with a high copy number in cells expressing the T antigen required for viral DNA synthesis initiation (eg, COS cells). Other mammalian cell lines can also be used for this purpose.

Common mammalian expression vectors include promoter components that mediate the initiation of transcription of mRNA, protein coding sequences, and the signals required for polyadenylation of the transcriptional termination and transcript. Additional components include enhancers, Kozak sequences, and intervening sequences adjacent to the donor and acceptor sites of RNA splicing. High-efficiency transcription can be performed using the early and late promoters of SV40, retroviruses such as RSV, HTLVI, long terminal repeats (LTR) from HIVI, and early promoters of cytomegalovirus (CMV). However, cell signals may also be used (e.g., human actin promoters), expression vectors suitable for practicing the present invention include, for example, pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr ( ATCC 37146) and pBC12MI (ATCC 67109). Mammalian host cells that can be used include human Hela, 283, H9 and Jurkat cells, mouse NIH373 and C127 cells, Cos1, Cos7 and CV1, African green monkey cells, quail QC1-3 cells, mouse L cells and Chinese hamster ovary cells It includes.

Alternatively, genes can be expressed in stable cell lines containing genes integrated into the chromosome. Cotransfection with screening markers such as dhfr, gpt, neomycin, hygromycin can identify and isolate transfected cells.

By amplifying the transfected gene, a large amount of the coding protein can be expressed. Dihydrofolate reductase (DHFR) is a useful marker for developing cell lines that carry hundreds or thousands of copies of the gene of interest. Another useful selection marker is the enzyme glutamine synthase (CS) (Murphy et al, Biochem J. 227: 277-279 (1991): Bebbington et al, Bio / Technology 10: 169-175 (1992)). . Such markers are used to grow mammalian cells and select the cells with the highest resistance in the selection medium. Selected cell lines contain amplified gene (s) integrated in the chromosome. In addition, Chinese hamster ovary (CHO) cells are often used for protein production.

Expression vectors pC1 and pC4 are strong promoters of the Rous Sarcoma virus (LTR) [Cullen et al., Molecular and Cellular Biology, 438-447 (1985.3)] and fragments of the CMV-enhancer [Boshart et al. , Cell 41: 521-530 (1985). Multiple cloning sites having multiple cloning sites, such as restriction enzyme cleavage sites such as BamHI, XbaI and Asp718, are useful for cloning the gene of interest. The vector also includes the 3 'intron, polyadenylation and termination signal of the preproinsulin gene of the rat.

Example 3 (a): Cloning and Expression in COS Cells

The expression plasmid, PAIM II HA, is prepared by cloning the cDNA encoding AIM II in the expression vector pcDNAI / Amp (available from Invitrogen, Inc.).

The expression vector pcDNAI / amp includes (1) the origin of replication of E. coli that is effective for proliferation in E. coli and other prokaryotic cells, (2) ampicillin resistance genes for selecting plasmid containing prokaryotic cells; (3) origin of SV40 replication used for propagation in eukaryotic cells; (4) CMV promoters, polylinkers, SV40 introns and polyadenes arranged such that cDNAs are placed under the control of expression of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by restriction sites present in the polar linker. And a nilation signal.

The DNA fragment encoding the AIM II protein in the polylinker region of the vector and the HA tag fused in-frame at its 3 'end are cloned so that the recombinant protein is expressed by the CMV promoter. The HA tag corresponds to an epitope from influenza hemagglutinin protein described in Wilson et al., Cell 37: 767 (1984). Fusion of an HA tag to a target protein facilitates detection of recombinant proteins with antibodies that recognize HA epitopes.

The plasmid construction method is as follows: Amplify the cloned AIM II cDNA using primers containing convenient restriction sites, as described above, for the most part in the construction of expression vectors for AIM II expression in E. coli. To facilitate the detection, purification and characterization of expressed AIM II, one of the primers includes the hemagglutinin tag (“HA tag”) described above.

Suitable primers include the following as used in this example.

The 5 'primer containing the underlined BamHI site and AUG start codon has the following sequence.

5'G CTC GGA TCC GCC ATC ATG 3 '(SEQ ID NO: 13)

A 3 'primer containing an underlined XbaI site, a termination codon, 9 codons forming a hemagglutinin HA tag, and a 31 bp 3' coding sequence (3 'end) has the following sequence.

5'GAT GT T CTA GA A AGC GTA CTC TGG GAC GTC GTA TGG GTA CAC CAT CAA AGC CCC GAA GTA AGA CCG CGT AC 3 '(SEQ ID NO: 14)

PCR amplified DNA fragments and vector pcDNAI / Amp were digested with HindIII and XhoI and then ligated. The ligation mixture was used to transform E. coli strain SURE (available from Stratazine Cloning Systems, La Jolla North Torrey Pines Road 11099, 92037, California, USA), and the transformed cultures were cultured in ampicillin medium plates. Only ampicillin resistant colonies were cultured and grown. Plasmid DNA was isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of AIM II coding fragments.

To express recombinant AIM II, COS cells were described as described in Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, New York (1989). Transfection was performed via the same DEAE-DEXTRAN method. The cells were cultured under conditions suitable for expressing AIM II by the vector.

Expression of the AIM II HA fusion protein is described, eg, in Harlow et al., Antibodies: A Laboratory Manual, 2nd Ed .; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988)] was used to detect by radiolabeling and immunoprecipitation. For this purpose, two days after transfection, cells were labeled by incubation for 8 hours in a medium containing ³⁵ S-cysteine. The cells and medium were harvested and the cells were washed and the detergent-containing RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5, as described in Wilson et al., Cited above). % DOC, 50 mM TRIS, pH 7.5). Proteins were precipitated from cell lysates and culture media using HA-specific monoclonal antibodies. Precipitated protein was analyzed by SDS-PAGE gel and autoradiograph. Expression products of the expected size were observed in cell lysates, although not in the negative control.

Example 3 (b): Cloning and Expression in CHO Cells

Vector pC4 was used to express AIM II protein. Plasmid pC1 is a derivative of plasmid pSV2-dhfr (ATCC Accession No. 37146). These plasmids all contain the mouse DHFR gene under the control of the SV40 early promoter. Chinese hamster ovary cells or other cells lacking the dihydrofolate activity transfected with these plasmids can be selected by propagating the cells in a selection medium (alpha-MEM, Life Technologies, Inc.) supplemented with chemotherapy methotrexate. have. Methods for amplifying the DHFR gene in cells resistant to methotrexate (MTX) are known (eg Alt, F.W., Kellems, R, M., Bertino, J.R. and Schimke, R. T., 1978, J. Biol. Chem 253: 1357-1370, Hamlin, J.L. and Ma, C. 1990, Biochem et Biophys. Acta., 1097. 107-143, Page, M.J. and Sydenham, M. A. 1991, Biotechnology Vol, 9: 64-68], cells proliferating at elevated concentrations of MTX overproduce the target enzyme DHFR as a result of the amplification of the DHFR gene to form drug resistance. Binding of the second gene to this DHFR gene generally also co-amplifies and overexpresses it. At the level of the art, cell lines carrying more than 1000 copies of the gene can be formed. The removal of methotrexate then causes the cell line to contain an amplification gene integrated into the chromosome (s).

Plasmid pC4 is a strong promoter of the long-term repeat sequence (LTR) of Raus sarcoma virus (Cullen et al., Molecular and Cellular Biology, March 1985: 438-447) and human cytomegalovirus (CMV) to express the gene of interest. Fragments isolated from the enhancer of the primitive gene of Boshart et al., Cell 41: 521-530 (1985). Downstream of the promoter is the BamHI, XbaI and Asp718 restriction enzyme cleavage sites that integrate the gene. The plasmid comprises the polyadenylation site and the 3 'intron of the preproinsulin gene of the rat after this cloning site. Other high efficiency promoters such as human β -actin promoter, SV40 early or late promoter, or other retroviruses such as HIV and HTLVI may be used for expression. Clintech's Tet-Off and Tet-On gene expression systems and similar systems can be used to regulate AIM II expression in mammalian cells (Gossen, M., & Bujard, H. 1992, Proc. Natl). Acad. Sci. USA 89: 5547-5551), polydenylation of mRNA may also be used with human growth hormone or other signals derived from the globin gene. In addition, stable cell lines carrying the target gene integrated into the chromosome can be selected by cotransfection with a selection marker such as gpt, G418 or hygromycin. For example, it is preferable to use at least one sorting marker initially, such as G418 + methotrexate.

Plasmid pC4 is digested with restriction enzymes BamHI and Asp718 and then dephosphorylated using bovine intestinal phosphatase according to procedures known in the art. The vector is then separated from the 1% agarose gel.

DNA sequences encoding the complete AIM II protein, including the leader sequence, are amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of this gene. The 5 'primer is an effective signal for initiating detoxification in eukaryotic cells as described in the underlined BamHI restriction enzyme site followed by Kozak, M., J. Mol. Biol, 196: 947-950 (1987). And SEQ ID NO: 5'GCT CCA GGA TCC GCC ATC ATG GAG GAG AGT GTC GTA CGG C3 '(SEQ ID NO: 15) comprising 22 bases of the AIM II coding sequence set forth in FIGS. 1A-1C (SEQ ID NO: 1). . The 3 'primer is a sequence 5'GA CGC GGT ACC GTC CAA comprising an underlined Asp 718 restriction site followed by nucleotides complementary to nucleotides 769-795 of the AIM II gene described in Figures 1A-1C (SEQ ID NO: 1). TGC ACC ACG CTC CTT CCT TC 3 '(SEQ ID NO: 16).

This amplified fragment is digested with endonuclease BamHI and Asp 718 and then purified again on 1% agarose gel. The isolated fragments and dephosphorylated vector are then ligated with T4 DNA ligase. E. coli HB101 or XL-1 blue cells are transformed and subsequently identified bacteria containing fragments inserted into plasmid pC4, such as via restriction enzyme analysis.

Chinese hamster ovary cells lacking the active DHFR gene are used for transfection. 5 μg of the expression plasmid pC4 is cotransfected with 0.5 μg of plasmid pSV2-neo using lipofectin (Felgner et al, supra). The plasmid pSV2neo includes a neo gene derived from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418, which is a dominant marker. The resulting cells are seeded in alpha-MEM medium supplemented with G418 1 mg / ml. After 2 days, cells are treated with trypsin and seeded in hybridoma cloning plates (Greiner, Germany) with alpha-MEM supplemented with methotrexate 10, 25 or 50 ng / ml and G418 1 mg / ml. After about 10-14 days, the monoclonals are trypsinized and then inoculated into 6-well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). Clones that grow at the highest concentration of methotrexate were transferred to new 6-well plates containing higher concentrations of methotrexate (1 μM, 2 μM, 5 μM, 10 mM, 20 mM). The same procedure was repeated until clones growing at concentrations between 100 and 200 μM were obtained. Expression of the desired gene product was analyzed, for example, via SDS-PAGE and Western blot or reversed phase HPLC analysis.

Example 4: Tissue Distribution of AIM II Protein Expression

Northern blot analysis is performed using the method described in Sambrook et al., Cited above, to investigate AIM II gene expression in human tissue. The cDNA probe containing the full nucleotide sequence of the AIM II protein (SEQ ID NO: 1) is labeled at ³² P using the rediprime ™ DNA labeling system (Amersham Life Science) according to the manufacturer's instructions. After labeling, the probe is purified using a CHROMA SPIN-100 ™ column (Clontech Laboratories, Inc.) according to the manufacturer's protocol PT1200-1. Next, various human tissues are examined for AIM II mRNA using purified labeled probes.

Multiple tissue northern (MTN) blots containing various human tissues (H) or human immune system tissues (IM) were obtained from Clontech and labeled using ExpressHyb ™ hybridization solution (Clontech) according to manufacturer's protocol PT1190-1. Probe with the probe. After hybridization and washing, the blot is exposed to the film at -70 ° C overnight and then the film is developed according to standard methods.

It is apparent that the present invention may be practiced differently from the examples specifically described in the foregoing detailed description and examples.

In addition, various modifications and variations of the present invention are possible in light of the above teachings, which are also within the scope of the following claims.

All documents cited herein (patents, patent applications, magazines, experiments, books or other documents, etc.) are hereby incorporated by reference in their entirety.

Claims (36)

(a) a nucleotide sequence encoding an AIM II polypeptide having the entire amino acid sequence of FIGS. 1A-1C (SEQ ID NO: 2); (b) a nucleotide sequence encoding an AIM II polypeptide having amino acids 1-36 of the sequence of FIGS. 1A-1C (SEQ ID NO: 2); (c) a nucleotide sequence encoding a soluble AIM II polypeptide having amino acids 1-36 and 60-240 in the sequences of FIGS. 1A-1C (SEQ ID NO: 2); And (d) a nucleotide sequence complementary to any of the nucleotide sequences of (a) to (c) above An isolated nucleic acid molecule consisting of a polynucleotide having a sequence selected from the group consisting of. (a) a nucleotide sequence encoding an AIM II polypeptide having amino acids 60-240 of the sequence of FIGS. 1A-1C (SEQ ID NO: 2); (b) a nucleotide sequence encoding an AIM II polypeptide having amino acids 37-59 of the sequence of FIGS. 1A-1C (SEQ ID NO: 2); And (c) a nucleotide sequence complementary to any of the nucleotide sequences of (a) and (b) above An isolated nucleic acid molecule consisting of a polynucleotide having a sequence selected from the group consisting of. The isolated nucleic acid molecule of claim 1, wherein said polynucleotide encodes an AIM II polypeptide having the entire amino acid sequence of FIGS. 1A-1C (SEQ ID NO: 2). The isolated nucleic acid molecule of claim 2, wherein the polynucleotide encodes an AIM II polypeptide having amino acids 60-240 in the amino acid sequence of FIGS. 1A-1C (SEQ ID NO: 2). An isolated nucleic acid molecule consisting of a polynucleotide that is the complement of a polynucleotide having the same nucleotide sequence as the nucleotide sequence of claim 1 (a) to (d). An isolated nucleic acid molecule consisting of a polynucleotide that is the complement of a polynucleotide having the same nucleotide sequence as the nucleotide sequence of claim 2, (a) to (c), (j) a polypeptide consisting of amino acids 13-20 of FIGS. 1A-1C (SEQ ID NO: 2); And (ii) an isolated nucleic acid molecule encoding an epitope of an AIM II polypeptide selected from the group consisting of amino acids 23-36 of FIGS. 1A-1C (SEQ ID NO: 2). (i) the polypeptide consisting of amino acids 69-79 of FIGS. 1A-1C (SEQ ID NO: 2); (ii) a polypeptide consisting of amino acids 85-94 of FIGS. 1A-1C (SEQ ID NO: 2); (iii) a polypeptide consisting of amino acids 167-178 of FIGS. 1A-1C (SEQ ID NO: 2); (iv) a polypeptide consisting of amino acids 184-196 of FIGS. 1A-1C (SEQ ID NO: 2); And (v) an isolated nucleic acid molecule encoding an epitope of an AIM II polypeptide selected from the group consisting of the amino acids 221-233 of FIGS. 1A-1C (SEQ ID NO: 2). A method for producing a recombinant vector comprising inserting the isolated nucleic acid molecule of any one of claims 1, 3, 5 and 7 into a vector. A method for producing a recombinant vector comprising inserting the isolated nucleic acid molecule according to any one of claims 2, 4, 6 and 8 into a vector. A recombinant vector produced by the method of claim 9. A recombinant vector produced by the method of claim 10. A method for producing a recombinant host cell comprising introducing the recombinant vector according to claim 11 into a host cell. A method for producing a recombinant host cell, comprising introducing the recombinant vector according to claim 12 into a host cell. A recombinant host cell produced by the method of claim 13. A recombinant host cell produced by the method of claim 14. A recombinant method for producing an AIM II polypeptide comprising culturing the recombinant host cell according to claim 15 under conditions in which the AIM II polypeptide is expressed and recovering the polypeptide. A recombinant method for producing an AIM II polypeptide comprising culturing the recombinant host cell according to claim 16 under conditions in which the AIM II polypeptide is expressed and recovering the polypeptide. (a) the amino acid sequence of an AIM II polypeptide having the entire amino acid sequence of FIGS. 1A-1C (SEQ ID NO: 2); (b) amino acids 1-36 of the AIM II polypeptide having the amino acid sequence of FIGS. 1A-1C (SEQ ID NO: 2); And (c) amino acids 1-36 and 60-240 of the AIM II polypeptide having the amino acid sequence of FIGS. 1A-1C (SEQ ID NO: 2) An isolated AIM II polypeptide having a sequence selected from the group consisting of: (a) amino acids 60-240 of the AIM II polypeptides of FIGS. 1A-1C (SEQ ID NO: 2); And (b) amino acids 37-59 of the AIM II polypeptide of FIGS. 1A-1C (SEQ ID NO: 2) An isolated AIM II polypeptide having a sequence selected from the group consisting of: An isolated polypeptide of an epitope of an AIM II protein, wherein the epitope comprises (i) a polypeptide consisting of amino acids 13-20 of FIGS. 1A-1C (SEQ ID NO: 2); And (ii) a polypeptide consisting of amino acids 23-36 of FIGS. 1A-1C (SEQ ID NO: 2). An isolated polypeptide of an epitope of AIM II protein, wherein the epitope comprises (i) a polypeptide consisting of amino acids 69-79 of FIGS. 1A-1C (SEQ ID NO: 2); (ii) a polypeptide consisting of amino acids 85-94 of FIGS. 1A-1C (SEQ ID NO: 2), (iii) a polypeptide consisting of amino acids 167-178 of FIGS. 1A-1C (SEQ ID NO: 2); (iv) a polypeptide consisting of amino acids 184-196 of FIGS. 1A-1C (SEQ ID NO: 2); And (v) a polypeptide consisting of amino acids 221-233 of FIGS. 1A-1C (SEQ ID NO: 2). An isolated antibody that specifically binds to the AIM II polypeptide of claim 19. An isolated antibody that specifically binds to the AIM II polypeptide of claim 21. An isolated antibody that specifically binds to the AIM II polypeptide of claim 20. An isolated antibody that specifically binds to the AIM II polypeptide of claim 22. A composition for stimulating T-cell killing comprising the nucleic acid molecule according to any one of claims 1, 3, 5 and 7 or the polypeptide according to claim 19 or 21. A composition for stimulating T-cell killing comprising the nucleic acid molecule according to any one of claims 2, 4, 6 and 8 or the polypeptide according to claim 20 or 22. A composition which stimulates proliferation of cells of endothelial origin comprising the nucleic acid molecule according to any one of claims 1, 3, 5 and 7 or the polypeptide according to claim 19 or 21. A composition which stimulates the proliferation of cells of endothelial origin comprising the nucleic acid molecule according to any one of claims 2, 4, 6 and 8 or the polypeptide according to claim 20 or 22. A composition for inhibiting tumor cell growth comprising the nucleic acid molecule according to any one of claims 1, 3, 5 and 7 or the polypeptide according to claim 19 or 21. A composition for inhibiting tumor cell growth comprising the nucleic acid molecule according to any one of claims 2, 4, 6 and 8 or the polypeptide according to claim 20 or 22. A composition for inhibiting T-cell apoptosis comprising the nucleic acid molecule according to any one of claims 1, 3, 5 and 7 or the antibody according to claim 23 or 24. A composition for inhibiting T-cell death comprising the nucleic acid molecule according to any one of claims 2, 4, 6 and 8 or the antibody according to claim 25 or 26. A composition for inhibiting inflammatory cytokine production in a synovial cell comprising the nucleic acid molecule according to any one of claims 1, 3, 5 and 7 or the antibody according to claim 23 or 24. A composition for inhibiting inflammatory cytokine production in a synovial cell comprising the nucleic acid molecule according to any one of claims 2, 4, 6 and 8 or the antibody according to claim 25 or 26.