JP2001500724A - T1 receptor-like ligand II - Google Patents

Abstract

  (57) [Summary] The present invention relates to a novel T1R-like ligand II protein. Specifically, an isolated nucleic acid molecule encoding a T1R-like ligand II protein is provided. Also provided are T1R-like ligand II polypeptides, recombinant vectors and host cells for expressing them.

Description

DETAILED DESCRIPTION OF THE INVENTION                         T1 receptor-like ligand II                                Background of the Invention Field of the invention   The present invention relates to a novel T1 receptor (T1R) -like ligand II protein. Details Specifically, an isolated nucleic acid molecule encoding a T1R-like ligand II protein is provided. It is. T1R-like ligand II polypeptides, recombinant vectors and expressing them Also provided are host cells. Related fields   Interleukin-1 (IL-1). Interleukin-1 (IL-1α and IL-1β) Are "multifunctional" cytokines that affect almost all cell types, and Often it works in concert with other cytokines or small mediator molecules. (Din arello, C.A., Blood 87: 2095-2147 (March 15, 1996). ) L-1 gene family Three members: IL-1α, IL-1β, and an IL-1 receptor antagonist (IL- 1Ra) exists. IL-1α and IL-1β are agonists, and IL-1Ra is a specific receptor. Scepter antagonist. IL-1α and β have no leader sequence Synthesized as a precursor. The molecular weight of each precursor is 31 kD. IL-1α or IL-1β Processing to the 17-kD “mature” form requires specific cellular proteases I do. In contrast, IL-1Ra evolves with a signal peptide and is extracellular. It is easily transported to and called secreted IL-1Ra (sIL-1Ra).   IL-1 receptor and ligand. Sufficient IL-1 pathway receptor and ligand (For a review, see Dinarello, C.A., FASE BJ. 8: 1314-1325 ( 1994); Sims, J.E., et al., Interleukin-1 signal transduction: Advances in Cell a nd Molecular Biology of Membranes and Organelles, Volume 3, JAI Press, Inc. Greenwich, CT (1994), pp. 197-222). Three ligands, IL-1α, IL-1β, and And IL-1 receptor antagonists (IL-1ra) comprise three types of IL-1 receptors: 80-kDa type I IL-1 receptor (IL-1R1) (Sims, J.E., et al., Science 241: 585-589 (1988) ), 68-kDa type II IL-1 receptor (IL-1RII) (McMahan, C.J., et al., EMBO J. 10: 2821-2). 832 (1991), and binds the soluble form of type II IL-1R (sIL-1RII) (Colotta, F. et al. Science 261: 472-475 (1993)).   Interaction between IL-1 ligand and receptor is IL-1 mediated to damage and infection Plays an essential role in stimulating and regulating host responses. Cells expressing IL-1RI and Cells treated with IL-1α or IL-1β respond in several specific ways, including: To: Stimulate nuclear localization of a related transcription factor, NF-κβ (for a review, see Thanos, D. & Maniatis, T .; Cell 80: 529-532 (1996)), epithelial growth factor Mitogen that phosphorylates the threonine 669 residue (Thr-669) of the child receptor (EGFR) Activation of protein kinases from the activated protein kinase superfamily (G uy, G.R. et al., J. Biol. Chem. 267: 1846-1852 (1992); Bird, T.A. et al., J. Biol. Chem. 268: 22861-22870 (1991); Bird, T.A. et al., J. Biol.chem. 269: 31836-31844 (1994)), and And transcriptional stimulation of the IL-8 gene (Mukaida, N. et al., J. Bol.chem. 265: 21128-21133 (1990)) .   IL-1RI-like family. Many proteins from diverse systems are found in IL-1RI cells Shows homology to intraplasmic domains. This expanded IL-1RI-like family is Includes proteins, Drosophila proteins, and plant (tobacco) proteins. (Gay, N.J. & Keith, F.J., Nature 351: 355-356 (1991); Hashimoto, C. et al., Cell 52: 2. 69-279 (1988); Schneider, D.S. et al., Genes & Dev. 5: 797-807 (1991); Edon, E. et al., De. velopment 120: 885-899 (1994); Mitchan, J.L. et al., J. Biol. Chem 271: 5777-5782 (19 March 8, 1996)).   A member of the mammalian IL-1RI-like receptor family is the mouse protein MyD88 ( Lord, K.A. et al., Oncogene 5: 1095-1097 (1990)) and the human gene, rsc786 (Nomura , N. et al., DNA Res. 1: 27-35 (1994)). Another mouse receptor member, T1 / ST2 was previously identified as a novel primary response gene expressed in BAL / c-3T3 cells. (Klemenz, R et al., Proc. Natl. Acad. Sci. USA 86: 5708-5712 (1989); To minaga, S., FEBS Lett. 258: 301-304 (1989); Tominga, S. et al., FEBS Lett. 318-87 (199) 3)). Transmembrane protein mu1L-1R AcP (Greenfeder, S.A. et al., J.B. iol.Chem.270: 13757-13765 (1995)) has homology to both type I and type II IL-1R. I do. IL-1R AcP has recently been shown to enhance the affinity of IL-1RI for IL-1β And may be involved in mediating the IL-1 response.   T1 receptor. T1 / ST2 receptor as a member of the IL-1 receptor family -(Hereinafter "T1 receptor") (Bergers, G et al., EMBO J. 13: 1176 (1994)) Some species have various homologs. In rats, it is called Fit-l and That share 26% to 29% amino acid homology to mouse IL-1RI and II, respectively. It is a strogen-induced, c-fos-dependent transmembrane protein. In mice, Fit-1 The protein is called ST2 and in humans T1. Two IL-1 receptors and And the organization of the Fit-1 / ST2 / T1 gene indicate that they are from a common ancestor (Sim s, J.E. et al., Cytokine 7: 483 (1995)). Fit-1 exists in two forms: IL-1RI With a cytosolic domain similar to the cytosolic domains of Fit and Fit-1S (Fit-1M), which is secreted and consists of the extracellular domain of Fit-M.   In many methods, these two forms of the Fit-1 protein are membrane bound and And a form of soluble IL-1RI. IL-1sRI is a cell-bound form of proteolytic cleavage (Sims, J.E. et al., Cytokine 7: 483 (1995)). The other In the Fit-1 gene is under the control of two promoters. This is the membrane Generates two isoforms that encode either the receptor or the soluble form of the receptor I will. Two RNA transcripts provide alternative RNA splicing at the 3 'end of the gene Arising from IL-1β binds weakly to Fit-1 and does not transmit signals (Reik erstorger, A. et al., J. Biol. Chem. 270: 17645 (1995)) was fused to cytosol Fit-1. Chimeric receptor consisting of isolated extracellular mouse IL-1RI transmits IL-1 signal (R eikerstorger, A. et al., J. Biol. Chem. 270: 17645 (1995)). The cytosol part of Fit-1 Aligns with the GTPase-like sequence of IL-1RI (Hopp, T.P., Protein Sci. 4: 1851 (1995) )(See below).   IL-1 production in various disease states. Increased IL-1 production is associated with various viruses, Fungal, fungal, and parasitic infections; intravascular coagulation; high-dose IL-2 treatment; solid tumors; Disease; Alzheimer's disease; HIV-1 infection; autoimmune disorders; trauma (surgery); hemodialysis; Hematologic disease (myocardial infarction); Non-infectious hepatitis; Asthma; UV irradiation; Closed head injury; Pancreas Inflammation; periodontal disease; graft versus host disease; patients with graft rejection and after strenuous exercise Has been reported in healthy subjects. In patients with Alzheimer's disease Possible increase in IL-1β production and release of amyloid precursor protein There is an association with the role of IL-1 (Vasilakos, J.P. et al., FEBS Lett. 354: 289 (1994) ). However, in most conditions, IL-1 is the only site showing increased production Not IL-1 and therefore IL-1 findings as relevant to the pathogenesis of any particular disease Specificity is lacking. In various disease states, IL-1β, but not IL-1α, is circulating. Detected in the ring.   IL-1 in therapy. IL-1 has been found to exert many important biological activities However, it has also been found to be toxic at doses close to the therapeutic dose. (D inarello, C.A., Blood 87: 2095-2147 (March 15, 1996)). Generally, no IL-1 The acute toxicity of these isoforms was greater after intravenous injection compared to subcutaneous injection. subcutaneous Injections showed significant local pain, erythema, and swelling (Kitamura, T., & Takaku, F., Exp. Med. 7: 170 (1989); Laughlin, M.J., Ann. Hematol. 67: 267 (1993)). 100ng / kg or more Patients who received IL-1 intravenously at the following doses experienced significant hypotension. 4-32ng subcutaneously / kg IL-1β had the only onset of hypotension at the highest dose level. (Laughlin, M.J., Ann. Hematol. 67: 267 (1993)).   5 days week as opposed to IL-1-related bone marrow stimulation in patients with normal marrow reserve Patients with aplastic anemia treated with an amount (30-100 mg / kg) of IL-1α Had no increase in blood counts or myeloidity (Walsh, C.E., et al., Br. J. Hae matol 80: 106 (1992)). IL-1 restores the lowest point of neutropenia and thrombocytopenia To be administered to patients who have undergone various measures of chemotherapy.   Daily treatment of autologous bone marrow or stem cells with 40 ng / kg IL-1α from day 0 to day 13 is preferred. Produced earlier recovery of neutropenia (median, 12 days; P <0. 001) (Weisdorf, D. Bl ood 84: 2044 (1994). Fourteen days after treatment, bone marrow is filled with associated myeloid progenitor cells. Significantly enriched. Similar results were obtained with purged or unpurged bone marrow. Patients with AML who received 50 ng / kg / d IL-1β for 5 days starting at the time of transplantation (Nemunaitis, J .; Blood 83: 3473 (1994)). Low capacity IL-1 By injecting either α or IL-1β into humans, impressive febrile And the hypotension-inducing properties of the molecule are confirmed.   Recovery of disease using soluble IL-1 receptor. Administration of mouse IL-1sRI to mice Increases the survival of heterotopic hear allografts and Reduced cellular hyperplastic lymph node response (Fanslow, W. et al. C. Et al., Science 248: 739 (1 990)). Topical instillation of mouse IL-1sRI in a rat model of antigen-induced arthritis Reduced joint swelling and tissue destruction (Dower, S .; K. Et al., Therapeutic Immunol . 1: 113 (1994)). These data show the total IL-1sRI administered to normal contralateral joints. Indicates that the amount worked systemically. In an experimental model of autoimmune encephalitis, IL -1sRI reduced the severity of the disease (Jacobs, C. et al. A. J. Immunol. 146: 2983 (1991)).                                Summary of the Invention   The present invention relates to a human T1 receptor (T1R) having the amino acid sequence of FIG. 1 (SEQ ID NO: 2). Nucleic Acids Containing Polynucleotides Encoding Ligand-Ligand II Polypeptides Provide molecules. T1R-like ligand II is an N-terminal methionine, a 26 amino acid residue Sequence, extracellular mature domain of about 168 residues, transmembrane domain of about 23 residues and About 2 amino acids, including an intracellular domain of about 12 amino acid residues and a predicted molecular weight of about 26 kDa. Includes an open reading frame encoding a 29 amino acid residue polypeptide No. Figure 1 shows the predicted 168 amino acid sequence of the mature extracellular T1R-like ligand II protein. And SEQ ID NO: 2 (residues 27-194).   In another aspect, the present invention has been deposited on July 12, 1996 as ATCC accession number 98655. T1R-like riga having the amino acid sequence encoded by the cDNA of the deposited clone Provided is an isolated nucleic acid molecule that encodes a DNA II. Preferably, the nucleic acid molecule is Encodes the mature polypeptide encoded by the deposited cDNA described above.   The invention further relates to nucleic acid fragments of the nucleic acid molecules described herein. I do. The nucleotide sequence of the deposited cDNA or shown in FIG. 1 (SEQ ID NO: 1) The present invention relates to fragments of an isolated nucleic acid molecule having a nucleotide sequence. Less useful as diagnostic probes and primers as discussed in the textbook Both about 15 nt, and more preferably at least about 20 nt, and even more preferably less Fragments at least about 30 nt, and even more preferably at least about 40 nt in length Is intended. Of course, larger fragments 50 to 741 nt long are also better. In addition, the amino acid sequence of the deposited cDNA or the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) Like most (if not all) matching fragments, according to the invention Useful. Deposited by fragments at least 20 nt long, for example Nucleotide sequence of the cDNA or the nucleotide sequence shown in FIG. Fragments containing 20 or more contiguous bases from a row are contemplated. Gene deposited And the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) is provided. Therefore, producing such a DNA fragment is routine for those skilled in the art. It is. For example, restriction endonuclease cutting or ultrasonic shearing can be Can be easily used to generate fragments of the following sizes: Or this Such fragments can be made synthetically.   A preferred nucleic acid fragment comprises about 26 amino acid residues (about 1 to about 1 Leader sequence of about 26 amino acid residues; extracellular mature domain of about 168 residues (Fig. A transmembrane domain of about 23 amino acids (FIG. 1); (About 195 to about 217 amino acid residues of (SEQ ID NO: 2)); an intracellular domain of about 8 amino acids ( FIG. 1 (SEQ ID NO: 2) (about 218 to 229 amino acid residues); Contains nucleic acid molecules encoding peptides containing deleted extracellular and intracellular domains No.   A further embodiment of the present invention relates to any of the nucleic acid molecules described herein. At least 90% identical to the nucleotide sequence, and more preferably Both have nucleotide sequences that are 95%, 96%, 97%, 98%, or 99% identical Includes an isolated nucleic acid molecule.   The present invention also provides a recombinant vector, a recombinant vector comprising the isolated nucleic acid molecule of the present invention. Cells containing recombinant vector and T1R-like ligand II polypeptide by recombinant technology Or the production of fragments thereof.   The polypeptide of the present invention is a polypeptide encoded by the deposited cDNA. , The polypeptide of FIG. 1 (SEQ ID NO: 2) (specifically, the mature polypeptide), and The polypeptide encoded by the deposited cDNA, the polypeptide of FIG. 1 (SEQ ID NO: 2) At least 90% of the amino acid sequence of the peptide or their fragments Have an amino acid sequence with similarity, more preferably at least 95% similarity Including polypeptides. Further polypeptides of the invention may be provided by the deposited cDNA. Or the polypeptide of FIG. 1 (SEQ ID NO: 2), or At least 80% identical, more preferably less, to the amino acid sequence of these fragments Polypeptides having amino acid sequences that are 90% or 95% identical to each other.   Preferred polypeptide fragments according to the invention are mature polypeptides, cells All ectodomains, transmembrane domains, intracellular domains, or transmembrane domains. Or polypeptides containing extracellular or intracellular domains with or without deletions.   A further embodiment of the present invention is directed to an epitope of a T1R-like ligand II as described herein. The present invention relates to a polypeptide or peptide having an amino acid sequence of a loop-bearing portion. Book Peptides having the amino acid sequence of the epitope-bearing portion of an IL-1-like polypeptide of the invention The peptide or polypeptide has at least 6 to 30 or 9 to 50 amino acids. The polypeptides of the invention described herein, including portions of a polypeptide such as Epitopes of any length (including the whole) up to the length of the entire amino acid sequence of the peptide Partial polypeptides are also included.   In another embodiment, the present invention has an amino acid sequence described herein. An isolated antibody that specifically binds to a T1R-like ligand II polypeptide You.   The biological activity of the T1R-like ligand II of the present invention is the biological activity of T1R ligand and IL-1. It is believed that the activity can be similar to the activity. "Normal" T1R-like ligand II gene expression Levels (ie, individuals without T1R ligand-related disorders or IL-1-related disorders) Expression level in the original tissue or body fluid). Lower levels of T1R-like ligand II may cause a T1R ligand-related disorder or an IL-1-related disorder. Tissue or body fluid (eg, serum, plasma, urine, synovial fluid, or cerebrospinal fluid from an individual having ) Can be detected. Thus, the expression of the T1R-like ligand II gene Detecting expression is a diagnostic marker.   In a further embodiment, the present invention provides an increased or decreased level in the body. And methods for treating an individual having a need for T1R-like ligand II activity. this The method comprises forming a composition comprising a T1R-like ligand II polypeptide or an inhibitor thereof. Administration to such individuals.   The present invention relates to a T1R-like ligand II having the amino acid sequence described herein. Further provided are methods for isolating antibodies that specifically bind to a polypeptide. This Antibodies such as can be useful for diagnosis or therapy, as described above.                             BRIEF DESCRIPTION OF THE FIGURES   FIG. 1 shows that the cDNA clone contained in ATCC Accession No. 98655 was sequenced. Nucleotide sequence of T1R-like ligand II protein determined according to (SEQ ID NO: 1) And a deduced amino acid sequence (SEQ ID NO: 2). About 1 to about 26 amino acids are sig Indicates the null peptide (first underlined sequence); about 27 to about 194 amino acids are small. Indicates extracellular domain (sequence between first and second underlined sequence); about 195 to about 2 17 amino acids represent the transmembrane domain (second underlined sequence); and about 21 Eight to about 229 amino acids represent the intracellular domain (remaining sequence).   FIG. 2 shows the amino acid sequence of T1R-like ligand II and GenBank accession number U41804 (SEQ ID NO: 3). ) Shows regions of similarity to the protein sequence of FIG.   FIG. 3 provides an analysis of the T1R-like ligand II amino acid sequence. α, β, turn And coil regions; hydrophilic and hydrophobic regions; amphiphilic regions; mobile regions; The index as well as the surface probabilities are shown.                             Detailed description of the invention   The present invention relates to the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) (cloned cD T1R-like ligand II protein (determined by sequencing NA) Provided is an isolated nucleic acid molecule comprising a polynucleotide encoding a quality. Departure Ming T1R-like ligand II protein shares sequence homology with T1R ligand (FIG. 2) You.   The nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) corresponds to the HE96K24 clone. Obtained by determining. This is an American type on July 12, 1996 Culture Collection, 12301 Park Lawn Drvie, Rockville, Maryland 20852 And given accession number 97655. The deposited clone is p Included in Bluescript SK (-) plasmid (Stratagene, LaJolla, CA). Nucleic acid molecule   Unless otherwise indicated, determined by sequencing a DNA molecule herein. All sequenced nucleotide sequences are automatically sequenced by an automated DNA sequencer (eg, Applied B iosystems, Inc. Determined using Model 373) and determined herein. Peptide, polypeptide, or protein encoded by the DNA molecule All amino acid sequences of quality are obtained by translation of the DNA sequence determined as described above. As expected. Therefore, any DNA sequence determined by this automated approach As is known in the art for any of the nucleic acids determined herein. Otide sequences can contain some errors. Nucleochy determined by automation Sequence is representative of the actual nucleotide sequence of the DNA molecule to be sequenced. Has at least about 90% identity, more typically at least about 95% to at least About 99. 99% identical.   The actual sequence may be obtained from other applications, including manual DNA sequencing methods well known in the art. It can be more accurately determined by roach. As also known in the art, A single insertion in the determined nucleotide sequence compared to the actual sequence or Deletions cause a frameshift in translation of the nucleotide sequence, which The predicted amino acid sequence encoded by the determined nucleotide sequence Is actually due to the DNA molecule being sequenced starting at a point such as an insertion or deletion. Is completely different from the amino acid sequence encoded by   Unless otherwise indicated, each "nucleotide sequence" set forth herein is a Shown as the sequence of xyribonucleotides (abbreviated A, G, C, and T). However, depending on the "nucleic acid sequence" of the nucleic acid molecule or polynucleotide, the DNA molecule or the Or a polynucleotide contains a sequence of deoxyribonucleotides and an RNA molecule Alternatively, the polynucleotide has a corresponding arrangement of ribonucleotides (A, G, C, and U). Sequence (each thymidine deoxynucleotide in the deoxynucleotide sequence identified herein) The nucleotide (T) is replaced by the ribonucleotide uridine (U) Is intended. For example, indicated using abbreviations for deoxyribonucleotides Reference to an RNA molecule having the sequence of SEQ ID NO: 1 refers to each deoxynucleotide of SEQ ID NO: 1. Otide A, G or C is replaced by the corresponding ribonucleotide A, G or C And each deoxynucleotide T is replaced by a ribonucleotide U It is intended to indicate an RNA molecule having the resulting sequence.   An “isolated” nucleic acid molecule allows nucleic acid molecules (DN A or RNA) is intended. For example, a recombinant DNA molecule contained in a vector is: It is contemplated that it is isolated for the purposes of the present invention. Further isolation of isolated DNA molecules Examples are recombinant DNA molecules maintained in heterologous host cells, or in solution. Includes purified (partially or substantially) DNA molecules. The isolated RNA molecule is Includes in vivo or in vitro RNA transcripts of defined DNA molecules. According to the present invention Isolated nucleic acid molecule further includes those molecules that are produced synthetically.   The information provided herein (eg, the nucleotides in FIG. 1 (SEQ ID NO: 1) Nucleic acid molecules of the invention encoding T1R-like ligand II polypeptides Uses standard cloning and screening procedures (eg, starting material Procedure for cloning cDNA using mRNA). Example of the present invention The nucleic acid molecule described in Figure 1 (SEQ ID NO: 1) is a 9-week-old human fetal tissue Was found in the derived cDNA library. In addition, genes can also Found in a cDNA library from the following types: prostate, occult T cells , TF274 stromal cells, WI38, Soares breast cells, and Soares placenta.   The T1R-like ligand II cDNA has the initiation codon shown in FIG. 1 (SEQ ID NO: 1) Encodes a protein of about 229 amino acid residues 55-57 of the nucleotide sequence. Open reading frame; predicted leader of approximately 26 amino acid residues Sequence and estimated molecular weight of approximately 26 kDa. Mature T1R-like ligand II protein Amino acid residues 27 to 229 of the amino acid sequence are shown in FIG. 1 (SEQ ID NO: 2). Mature T1R-like ligand II protein has three major structural domains . These are extracellular from about 27 to about 194 amino acid residues in FIG. 1 (SEQ ID NO: 2). Domain; a transmembrane domain derived from about 195 to about 217 amino acid residues in FIG. 1 (SEQ ID NO: 2) Main; and cells derived from about 218 to about 229 amino acid residues in FIG. 1 (SEQ ID NO: 2). Inside domain. The T1R-like ligand II protein of the present invention in FIG. About 56% identical and about 75% similar to the ligand, which It can be used as accession number U41804.   As will be appreciated by those skilled in the art, the potential for sequencing errors described above, as well as different known CDNA deposited due to the variability of the leader cleavage site in other proteins The actual T1R-like ligand II encoded by contains approximately 229 amino acids, May be anywhere in the range of 5-245 amino acids; and a putative of this protein The leader sequence is about 26 amino acids, but may range from about 15 to about 30 amino acids. Can be a place. Further, for example, the T1R-like ligand I in FIG. 1 (SEQ ID NO: 2) I protein extracellular, intracellular, and transmembrane domains The location may vary slightly depending on the criteria used to define the domain (E.g., the exact amino acid positions may be from about 1 to about 5 residues).   As shown, the nucleic acid molecules of the invention can be in the form of RNA (eg, mRNA), or D The form of NA (eg, obtained by cloning or synthetically produced CDNA and genomic DNA). DNA is double-stranded or single-stranded Can be Single-stranded DNA or RNA consists of the coding strand (also known as the sense strand) Can be, or is not, the non-coding strand (also known as the antisense strand) possible.   The isolated nucleic acid molecule of the present invention has the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1). Open reading frame (ORF) with an initiation codon at positions 55-57 of the otide sequence ), And further wherein the initiation codon is the nucleus in FIG. 1 (SEQ ID NO: 1). A sequence that is substantially different from all or part of the ORF at positions 55-57 of the nucleotide sequence But due to the degeneracy of the genetic code, the T1R-like ligand II protein or its DNA fragments still encoding the fragment of Naturally, genetic code Are well known in the art. Therefore, degenerate mutants as described above are generated It is routine for those skilled in the art.   In another aspect, the present invention has been deposited on July 12, 1996 as ATCC Deposit No. 97655. Amino acid sequence encoded by the cDNA clone contained in the deposited plasmid Providing an isolated nucleic acid molecule encoding a T1R-like ligand II protein having a sequence I do. Preferably, the nucleic acid molecule is encoded by the deposited cDNA clone described above. Encoding the mature polypeptide to be made.   The present invention further relates to the nucleotide sequence shown in FIG. Is the nucleotide of T1R-like ligand II cDNA contained in the deposited clone An isolated nucleic acid molecule having a sequence or a sequence complementary to one of the above sequences A nucleic acid molecule is provided. Such isolated molecules, especially DNA molecules, are To perform gene mapping by in situ hybridization with And T1R-like ligand II inheritance in human tissues, for example by Northern blot analysis It is useful as a probe for detecting offspring expression. Described in detail below To detect changes in T1R-like ligand II gene expression in specific tissues May be indicative of a particular disorder.   The present invention further provides fragments of the isolated nucleic acid molecules described herein. About. The nucleotide sequence of the deposited cDNA or as shown in FIG. 1 (SEQ ID NO: 1) By a fragment of the isolated nucleic acid molecule having the nucleotide sequence As discussed herein, useful as diagnostic probes and primers Some are at least about 15 nt in length, and more preferably at least about 20 nt in length. More preferably at least about 30 nt, and even more preferably at least About 40 nt is intended. Naturally, larger fragments 50-12 00nt is also the nucleotide sequence of the deposited cDNA, or shown in FIG. 1 (SEQ ID NO: 1). Correspond to most if not all of the nucleotide sequences as shown in Like fragments that are useful according to the invention. For example, if the length is small Nucleotide sequence of the deposited cDNA, also by the 20 nt fragment, or figure 20 or more adjacent salts from the nucleotide sequence as shown in SEQ ID NO: 1 (SEQ ID NO: 1) Fragments containing groups are contemplated. This gene has been deposited and is shown in FIG. The nucleotide sequence shown in No. 1) is provided, such DNA Generating fragments is routine for those skilled in the art. For example, Nuclease cutting or shearing by sonication can be performed with various sizes of flags. Can be easily used to generate the Or such a fragment Can be generated synthetically.   Preferred nucleic acid fragments of the invention include nucleic acid molecules that encode: T1 Polypeptide containing R-like ligand II extracellular domain (about 2 in FIG. 1 (SEQ ID NO: 1)) Polypeptides containing T1R-like ligand II transmembrane domain (From about 195 to about 217 amino acid residues in FIG. 1 (SEQ ID NO: 1)); and T1R-like Riga And a polypeptide containing the intracellular domain of intracellular II (from about 218 to about 2 in FIG. 1 (SEQ ID NO: 2)). 29 amino acid residues); with all or part of the deleted transmembrane domain Polypeptide having extracellular and intracellular domains. The present invention More preferred nucleic acid fragments are epitopes of the T1R-like ligand II protein. A nucleic acid molecule encoding the carrier-bearing moiety. In particular, FIG. 1 (SEQ ID NO: 2) The present inventors have determined that it is the antigenic region of the T1R-like ligand II protein) An isolated nucleic acid molecule encoding a polypeptide containing the following amino acid residues in Provided: a polypeptide comprising about 43 to about 52 amino acid residues in FIG. 1 (SEQ ID NO: 2) A polypeptide comprising about 82 to about 98 amino acid residues in FIG. 1 (SEQ ID NO: 2); 1 (SEQ ID NO: 2) comprising a polypeptide comprising about 129 to about 146 amino acid residues; A polypeptide comprising about 162 to about 175 amino acid residues in SEQ ID NO: 2); and about 18 A polypeptide comprising 1 to about 197 amino acid residues. Other T1R-like ligand II proteins Methods for determining such epitope-bearing portions of are described in detail below. It is.   In another aspect, the invention relates to stringent hybridization conditions. In some cases, the nucleic acid molecule of the present invention described above (for example, the cDN contained in ATCC Deposit No. 97655) A) Polynucleotide that hybridizes to a part of the polynucleotide in Provided, comprising an isolated nucleic acid molecule comprising: "Stringent hybridization Solution (50% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7. 6), 5 × Denhardt's solution, 10% dextran sulfate, and 20 μg / ml denatured sheared salmon sperm D NA) overnight incubation at 42 ° C in 0. 1 × SSC It is intended to clean the filter. Hybridize to "part of" polynucleotide Depending on the polynucleotide soyed, at least about 15 nucleotides (nt), and more preferably at least about 20 nt, even more preferably Or at least about 30 nt, and even more preferably about 30-70 nt. The polynucleotide (either DNA or RNA) to be amplified is contemplated. They are Diagnostic probes and primers as discussed in more detail above, and below. Useful as a marker.   It will be appreciated that the reference polynucleotide (eg, the deposited cDNA clone) Part) (for example, a 100-750 nt length) or reference poly Polynucleotides that hybridize to the full length of the nucleotide also The nucleotide sequence of the deposited cDNA or a nucleotide sequence as shown in FIG. 1 (SEQ ID NO: 1). Polynucleotides that correspond to most, if not all, of the nucleotide sequences Thus, it is useful as a probe according to the present invention. For example, "Length at least The 20nT "polynucleotide portion allows the nucleoside of the reference polynucleotide to be Pide sequences (eg, the deposited cDNA, or as shown in FIG. 1 (SEQ ID NO: 1)) Or more contiguous nucleotides from the same nucleotide sequence is contemplated. Show As such, such portions may be made in accordance with conventional DNA hybridization techniques. As probes or as described, for example, in Sambrook, J .; Ed., Molecular Cloning, ALa boratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Sprin g Harbor, NY (1989) Polymerase chain reaction (PCR) target Diagnostically useful either as a primer for sequence amplification.   A T1R-like ligand II cDNA clone has been deposited and the determined Since the reotide sequence is provided in FIG. 1 (SEQ ID NO: 1), the T1R-like ligand IIc Generating polynucleotides that hybridize to a portion of a DNA molecule is an art. Everyday to the person. For example, the restriction endonuclease of a T1R-like ligand II cDNA clone Aase cleavage or ultrasonic shearing can cause some T1R-like ligand II cDNA molecules to To produce DNA fragments of various sizes that are polynucleotides to be hybridized Can be used easily. Alternatively, the hybridizing polynucleotide of the invention Can be produced synthetically according to known techniques.   Naturally, the TIR-like sequence shown in FIG. 1 (SEQ ID NO: 1) 3 (terminal poly (A) adduct of ligand II cDNA) or T (or U) complementary The polynucleotide that hybridizes to the stretch is a part of the nucleic acid of the present invention. Not included in the polynucleotide of the present invention used to hybridize to . Because such a polynucleotide may have a poly (A) extension or its complement. To any nucleic acid molecule (eg, virtually any double-stranded cDNA clone) To   As shown, the nucleic acid molecule of the invention encoding T1R-like ligand II comprises: Including, but not limited to: by itself, the amino acid of the mature polypeptide A nucleic acid molecule encoding an acid sequence; the coding sequence for the mature polypeptide and further Sequences (eg, sequences encoding about 26 amino acid leader sequences) (eg, Protein sequence or proprotein sequence or preproprotein sequence); The coding sequence of the mature polypeptide, including or including the additional coding sequence described above. First, they are assembled with additional non-coding sequences, which are composed of introns and And non-coding 5 ′ and 3 ′ sequences (eg, transcription, mRNA processing (splicing) And polyadenylation signals (eg, ribosome binding and mRNA stability) Transcribed and untranslated sequences that play a role in Additional codes encoding additional amino acids to provide additional functionality Array. Thus, for example, a sequence encoding a polypeptide may have a marker sequence (eg, For example, a sequence encoding a peptide that facilitates purification of the fused polypeptide) Can be fused. In certain preferred embodiments of this aspect of the invention, the marker The amino acid sequence may be a hexa-histidine peptide (eg, a pQE vector (especially , Qiagen, Inc. ), Many of which are public and / or Or commercially available). See, for example, Gentz et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989). Provides convenient purification of proteins. The “HA” tag is for influenza hemagglutinin (HA) Another peptide useful for purification corresponding to the protein-derived epitope And it is described by Wilson et al., Cell 37: 767 (1984). Other A fusion protein such as T1R-like ligand I fused to Fc at the N- or C-terminus I proteins or fragments thereof.   The invention further relates to a portion, analog, or derivative of a T1R-like ligand II protein. The present invention relates to a variant of the nucleic acid molecule of the present invention which encodes a conductor. Mutants are natural alleles Like a gene variant, it can occur naturally. "Allelic variants" One of several interchangeable forms of a gene occupying a given locus on a chromosome Intended. Non-naturally occurring variants can be obtained, for example, by mutagenesis techniques known in the art. Can be generated using   Such variants are generated by nucleotide substitutions, deletions, or additions. Mutants. Substitutions, deletions, or additions may involve one or more nucleotides You. Variants can be altered in the coding or non-coding region, or both. obtain. Mutations in the coding region can be conservative or non-conservative amino acid substitutions, deletions , Or an addition. Particularly preferred among these are silent substitutions. , Additions, and deletions, which are characteristic of T1R-like ligand II or a portion thereof. And does not change activity. Particularly preferred in these respects is the storability. Permutation.   A further embodiment of the present invention relates to (a) the complete amino acid sequence shown in FIG. 1 (SEQ ID NO: 2). No acid sequence (including leader) or contained in ATCC accession number 97655 Nucleic acid encoding full-length T1R-like ligand II encoded by a cDNA clone Otide sequence; (b) amino acid sequence from about position 27 to about position 229 in FIG. 1 (SEQ ID NO: 2) Or the cDNA clone contained in ATCC Accession No. 97655 Mature T1R-like ligand II (full length polypeptide with the leader sequence removed) Encoding nucleotide sequence; (c) from about position 27 to about 194 in FIG. 1 (SEQ ID NO: 2) CDNA sequence having the amino acid sequence of position 1 or contained in ATCC accession number 97655 Encoding the T1R-like ligand II extracellular domain encoded by the Otide sequence; (d) amino acid sequence from about position 195 to about position 217 in FIG. 1 (SEQ ID NO: 2) Or cloned by the cDNA clone contained in ATCC Accession No. 97655. A nucleotide sequence encoding the T1R-like ligand II transmembrane domain to be loaded; (e) Has the amino acid sequence from about position 218 to about position 229 in FIG. 1 (SEQ ID NO: 2); Or a T1R-like library encoded by a cDNA clone contained in ATCC accession number 97655. A nucleotide sequence encoding a Gand II intracellular domain; or (f) (a), (b), ( Nucleotide complementary to any of the nucleotide sequences of c), (d), or (e) Has a nucleotide sequence at least 90% identical to the nucleotide sequence, and is more preferably Or at least 95%, 96%, 97%, 98%, or 99% identical nucleotide sequence. An isolated nucleic acid molecule comprising a polynucleotide having the same.   A reference nucleotide sequence encoding a T1R-like ligand II polypeptide and at least May also be, for example, a polynucleotide having a 95% "identical" nucleotide sequence. The polynucleotide sequence encodes a T1R-like ligand II polypeptide That each nucleotide in the nucleotide sequence can contain up to 5 mutations. Except that the nucleotide sequence of the polynucleotide is identical to the reference sequence. Intended. In other words, at least 95% identical to the reference nucleotide sequence In order to obtain a polynucleotide having a nucleotide sequence, 5 Up to% nucleotides can be deleted or replaced with another nucleotide Or a large number of nucleotides up to 5% of the total nucleotides in the reference sequence Can be inserted into the reference sequence. These mutations in the reference sequence are At the 5 'or 3' end of the sequence or within nucleotides within the reference sequence Or in one or more contiguous groups within the reference sequence, It can occur anywhere between these terminal positions.   In practice, any particular nucleic acid molecule may be, for example, a nucleotide sequence as shown in FIG. At least 90%, 95%, in the nucleotide sequence of the sequence or deposited cDNA clone, 96%, 97%, 98%, or 99% identity is determined by the BESTFIT program (Wisc onsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer G roup, University Research Park, 575 Science Drive, Madison, WI 53711) It can be determined conventionally using such known computer programs. BEST FIT is described in Smith and Waterman, Adv. Appl. Math. 2: 482-489 (1981) local homology A sex algorithm is used to find the best segment of homology between the two sequences. Using BESTFIT or any other sequence alignment program, if a particular sequence is For example, to determine if it is 95% identical to a reference sequence according to the invention, the parameters Is, of course, the percent identity calculated over the entire length of the reference nucleotide sequence. And in homology up to 5% of the total nucleotide number of the reference sequence It is set so that caps are allowed.   The present application encodes a polypeptide having T1R-like ligand II protein activity. At least 90%, 95%, 96%, 97%, 98% % Or 99% identical nucleic acid molecules. This is because the specific nucleic acid molecule is T1R-like Even if they do not encode a polypeptide with ligand II activity, one of skill in the art How the acid molecule can be used, for example, in a hybridization probe or Because you still know whether to use it as a primer for the remerase chain reaction (PCR) . Nucleic acid molecules of the invention that do not encode a polypeptide having T1R-like ligand II activity The use of (1) T1R-like ligand II gene or its allelic variation Isolating the body from a cDNA library; (2) Verma et al., Human Chromosomes: a Ma T1R, described in the Manual of Basic Techniques, Pergamon Press, New York (1988) Metaphase chromosome spread to provide precise chromosomal location of ligand II gene In situ hybridization to (eg, "FISH"); and (3) Northern blocks to detect T1R-like ligand II mRNA expression in specific tissues Analysis.   However, in practice, polypeptides having T1R-like ligand II protein activity At least 90%, 95%, 96%, 97%, 98%, or 99% Nucleic acid molecules having sequences that are% identical are preferred.   By "polypeptide having T1R-like ligand II protein activity", The T1R-like ligand II protein of the invention, when measured in a biological assay Polypeptide exhibiting an activity similar (but not necessarily identical) to the quality activity Is intended. T1R-like ligand II activity was determined using a known receptor binding assay. (Mitcham, J. L. J. Biol. Chem. 271: 5777-5783 (1996); and Gayle, M. A. J. Biol. Chem. 271: 5784-5789 (1996)). These assays are based on NF-κ B gel shift assay, in vitro Thr-669 kinase assay, and IL-8 promoter Includes a protein activation assay.   To perform these assays, first a mammalian cell is loaded with the appropriate receptor. Must be transfected with an expression vector containing the cDNA for the cDNA. For example Expression vectors containing cDNA for the T1 / ST2 receptor can be used. This cDNA Can be obtained as described. (Klemenz R. Proc. Natl. Acad. Sci. U. S. A. 8 6: 5708-5712 (1989); Tominaga, S. , FEBS Lett. 258: 301-304 Bergers, G. EMBO J. 13: 1176-1188)). Alternatively, T1 / ST2 cDNA is amplified using the polymerase chain reaction. Can be widthed. Appropriate tissues or cell types (e.g., NIH-3T3 cells (Klemenz, R. Pro c, Natl. . Acad. Sci. U. S. A. 86: 5708-5712 (1989)). A cDNA library can be used as a template. Any known to those skilled in the art Using several transfection methods, the appropriate cell line (eg, COS 7 Vesicles) can be transfected with the T1 / ST2 expression plasmid. Receptor expression Can be confirmed by radioimmunoassay (Mitcham, J. L. J. Biol. Chem. 271: 5777-5783 (1996)). 1-3 days after transfection, Fluent, transfected COS7 cells produce 1-10 ng of T1R-like ligand II protein. Stimulated for 15 minutes to 2 hours. Sustained stimulation by T1R-like ligand II protein The time will vary depending on which assay is used, and for routine experiments Can be determined using only   To perform the NF-κB assay, nuclear extracts from transfected cells were Prepared immediately after stimulation (Ostrowski, J. et al. J. Biol. Chem. 266: 12,722-12,733 (19 91)). Duplex containing NF-κB enhancer element derived from immunoglobulin κ light chain The synthetic oligonucleotide probe (5'TGACAGAGGGACTTTCCGAGAGGA 3 ') was labeled [γ-³² 5 'end labeling by phosphorylation with [P] ATP. Nuclear extract (10 μg) Incubate with the radiolabeled probe for 0 min and allow the protein-DNA complex to Separated by electrophoresis on 5 × TBE, 10% polyacrylamide gel.   Transfected to perform the in vitro Thr-669 kinase assay A cytoplasmic extract of the isolated cells is prepared immediately after stimulation (Bird, T.A. et al., Cytokine 4 : 429-440 (1992)). 10 μl of the cell extract was mixed with 20 mM HEPES buffer (pH 7.4), 15 mM Mg Cl_Two, 15 μM ATP, 75 μl / ml [γ-³²P] ATP and 750 μM substrate peptide (remaining EGFR The reaction mixture is added to 20 μl of the reaction mixture containing the bases 663-673). Mixture replaces peptide And incubated with distilled water. Incubation at 30 ° C for 20 minutes Later, the reaction is terminated by the addition of formic acid. Reaction cleared by centrifugation And 30 μl of the supernatant are spotted on phosphocellulose filter paper discs. After washing (3 times with 75 mM orthophosphoric acid) and drying, the Is measured by monitoring the Cherenkov count. Result is Detected in unstimulated cells compared to the activity detected in stimulated cells It is expressed as a percentage of the Thr-669 kinase activity.   To perform the IL-8 promoter activation assay, COS7 cells (multiwell 1 × 10 per well in tissue culture plate^FiveCells) from T1 / ST2 receptor Co-transfected with the current vector and the pIL8p reporter plasmid (Mi tcham, J.L. et al., J. Biol. Chem. 271: 5777-5783 (1996)). Transfection 1 One day later, the medium is changed and cells are stimulated or punctured with 1 ng / ml IL-1α. Either not intensified. 12-16 hours after stimulation, cells are 5% (w / v) non-fat Wash twice with binding medium containing fat dried milk (5% MBM) and add 2 ml of 5% MBM Block for 30 minutes at room temperature. The cells are then 1 μg for 60-90 minutes at room temperature. 5% MBM containing 1.5 ml / ml anti-IL-2Rα antibody (R & D Systems, Minneapolis, MN) And shake with gentle shaking. Cells are 5% MBM Washed once and diluted 1: 100¹²⁵I goat anti-mouse IgG (Sigma, St. Louis, MO) With 1 ml / well of 5% MBM containing for 60 minutes at room temperature. We Are washed four times with 5% MBM and twice with phosphate buffered saline. Well Is 1 ml of 0. Peel off by the addition of 5M NaOH and measure the total count. Results are total cp averaged over two duplicate wells or three triple wells Expressed as m.   Therefore, "a polypeptide having T1R-like ligand II protein activity" Contains polypeptides that exhibit T1R-like ligand II protein activity in assays for .   Of course, due to the degeneracy of the genetic code, those skilled in the art Multiples having sequences that are 90%, 95%, 96%, 97%, 98%, or 99% identical The nucleic acid molecule encodes a polypeptide having “T1R-like ligand II protein activity”. Immediately recognize that In fact, degenerate variants of these nucleotide sequences Perform the comparative assay described above, since all encode the same polypeptide. Even without doing it will be apparent to the skilled person. Such nucleic acid components that are not degenerate variants For a child, a reasonable number also encodes a polypeptide having T1R-like ligand II activity. Is recognized in the art. This means that those skilled in the art Is likely to affect the function of the Any amino acid substitution (eg, one aliphatic amino acid in a second aliphatic (Substitution with an amino acid).   For example, how to make phenotypically silent amino acid substitutions. Guidance is provided by Bowie, J. U. Et al., Science 247: 1306-1310 (1990). Here the authors report two primary approaches to study tolerance to amino acid sequence changes. Shows that there is a unique approach. The first depends on the process of evolution, Here, the mutation is either accepted or rejected by natural selection. The second approach introduces amino acid changes at specific positions in the cloned gene Genetic engineering, and select or switch to identify sequences that maintain function. Use cleaning. As the authors state, these studies show that protein Have shown that they are surprisingly tolerant of amino acid substitutions. The authors Investigate whether an amino acid change is likely to be permissive at a particular position in the protein. Is shown in For example, most buried amino acid residues require nonpolar side chains. On the other hand, the properties of surface side chains are generally poorly conserved. Other like this Phenotypically silent substitutions are described in Bowie, J .; U. Et al., Cited above and in it. Described in references.   Vectors and host cells   The present invention also relates to a vector comprising the isolated DNA molecule of the present invention, a recombinant vector. Genetically engineered host cells, and recombinant T1R-like ligand II polypeptides For the production of a peptide or a fragment thereof.   Recombinant constructs can be used for infection, transduction, transfection, trans Well known techniques such as transvection, electroporation, and transformation It can be introduced into host cells using techniques. Vectors include, for example, phage vectors, Plasmid vector, viral vector, or retroviral vector obtain. Retroviral vectors can be replicable or replication-defective. the latter In this case, propagation of the virus generally occurs only in complementing host cells.   The polynucleotide is a vector comprising a selectable marker for propagation in a host. Can be combined. Generally, a plasmid vector contains a calcium phosphate precipitate. It is introduced in such a precipitate or in a complex with a charged lipid. vector If is a virus, the vector is imported using the appropriate packaging cell line. It can be packaged in vitro and then transduced into host cells.   Vectors containing a cis-acting control region for the polynucleotide of interest are preferred. No. Suitable trans-acting factors can be supplied by the host or Supplied by the vector, or supplied by the vector itself upon introduction into the host. Can be paid.   In certain preferred embodiments in this regard, the vector is inducible and And / or to provide specific expression which may be cell type specific. Vector like this Particularly preferred vectors among are those that can be manipulated such as temperature and nutrient additives. It is a vector that is easily induced by environmental factors.   Expression vectors useful in the present invention include chromosomal vectors and episomal vectors. And virus-derived vectors (eg, bacterial plasmids, Virus, yeast episome, yeast chromosome element, virus (eg, baculo Virus, papovavirus, vaccinia virus, adenovirus, trypock Virus, pseudorabies virus, and retrovirus) And vectors derived from combinations thereof (eg, cosmids and furs). Diimide).   The DNA insert is compatible with a suitable promoter (eg, to name a few Di λPL promoter, E. coli lac promoter, trp promoter, and tac promoter Motor, SV40 early and late promoters, and retroviruses. Irs LTR). Other suitable Motors are known to those skilled in the art. The expression constructs further include transcription initiation, transcription termination. Includes a site for ligation and a ribosome binding site for translation in the transcribed region . The coding portion of the mature transcript expressed by the construct A stop cod that contains the transcription initiation AUG at the beginning of the peptide and is properly positioned at the end Including   As indicated, the expression vector preferably comprises at least one selectable marker. including. Such markers include dihydro leaf for eukaryotic cell culture. Acid reductase or neomycin resistance, and E. coli and other bacteria For culture, tetracycline resistance genes or ampicillin resistance genes were listed. I can do it. Representative examples of suitable hosts include bacterial cells (e.g., E. coli). coli cells, Streptomyces cells, and Salmonella typhimurium cells); fungal cells (eg, yeast Mother cells); insect cells (eg, Drosophila S2 cells and Spodoptera Sf9 cells) Animal cells (eg, CHO cells, COS cells, and Bowes melanoma cells); Plant cells. Appropriate culture media and conditions for the above host cells are It is known in the art.   Among the preferred vectors for use in bacteria are pQE70, pQE60, and pQE-9. (Available from Qiagen); pBS vector, Phasescript vector, Bluescript vector PNH8A, pNH16a, pNH18A, pNH46A (available from Stratagene); and ptr Includes c99a, pKK223-3, pKK233-3, pDR540, pR1T5 (available from Pharmacia) You. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1, and And pSG (available from Stratagene); pSVK3, pBPV, pMSG, and pSVL (Pharmacic and pA2 (available from Qiagen). Other suitable vectors The parameters will be readily apparent to those skilled in the art.   Among known bacterial promoters suitable for use in the present invention are E. coli. coli lacI And lacZ promoter, T3 and T7 promoters, gpt promoter Promoter, λPR promoter and λPL promoter, and trp promoter included. Suitable eukaryotic promoters include the CMV immediate-early promoter, HSV Thymidine kinase promoter, early SV40 promoter and late SV40 promoter The retroviral LTR promoter (eg, Rous sarcoma virus (RSV) Promoters), as well as metallothionein promoters (eg, mouse meta Rothionein I promoter).   Introduction of the construct into host cells can be achieved by calcium phosphate transfection, DEAE Dextran-mediated transfection, cationic lipid-mediated transfection By electroporation, electroporation, transduction, infection or other methods Can be done. Such methods are described in Davis et al., Basic Methods in Molecular Biology ( 1986) in many standard laboratory manuals.   Transcription of a DNA encoding a polypeptide of the present invention by higher eukaryotes may be a vector Can be increased by inserting an enhancer sequence into the protein. Enhancers Acts to increase the transcriptional activity of the promoter in a given host cell type; It is always a cis-acting element of about 10-300 bp DNA. Examples of enhancers , SV40 enhancer, which is located 100-270 bp on the late side of the replication origin , Cytomegalovirus early promoter enhancer, late on the replication origin And adenovirus enhancers.   Into the lumen of the endoplasmic reticulum of the translated protein, into the periplasmic space, or into cells For secretion into the external environment, an appropriate secretion signal is added to the expressed polypeptide Can be incorporated. The signal can be endogenous to the polypeptide, or Or they can be heterologous signals.   Thus, the polypeptide is expressed in an altered form, such as a fusion protein. And may contain not only secretion signals but also additional heterologous functional regions. An example For example, additional amino acids, especially regions of charged amino acids, may be purified in host cells. To improve stability and durability during or during subsequent operations and storage To the N-terminus of the polypeptide. In addition, the peptide part facilitates purification Can be added to the polypeptide to Such a region is a region of the polypeptide It can be removed before final preparation. Stability, especially due to secretion or excretion To the polypeptide of the peptide moiety to improve purification and to facilitate purification The addition of is well known in the art and is a routine technique. preferable Fusion proteins are heterologous regions derived from immunoglobulins that are useful for solubilizing proteins. including. For example, EP-A-0 464 533 (Canadian correspondence application 2045869) discloses another human protein. It contains various parts of the constant region of the immunoglobulin molecule together with the protein or part thereof. A fusion protein is disclosed. In many cases, the Fc portion of the fusion protein And is of great advantage for use in diagnostics, thus, for example, with improved pharmacokinetics. Produces morphological properties (EP-A 0232 262). On the other hand, for some uses, fusion tags The protein was expressed, detected, and purified in the advantageous manner described. It is desirable that the Fc portion can be deleted later. This means that the Fc part is If the fusion protein proves to be an obstacle to use in If it is to be used as an antigen). In drug discovery, for example, hIL-5 Human proteins, such as, are high-throughput techniques for identifying hIL-5 agonists. It has been fused with an Fc portion for the purpose of a cleaning assay. D. Bennett et al., Journal  of Molecular Recognition Vol. 8 52-58 (1995), and K. Johanson et al., The Jou rnal of Biological Chemistry Vol. 270, No. 16, pages 9549-9471 (1995) When.   T1R-like ligand II is prepared by ammonium sulfate precipitation or ethanol precipitation, acid extraction, anion or Indicates cation exchange chromatography, phosphocellulose chromatography, Aqueous interaction chromatography, affinity chromatography, hydro Including xiapatite chromatography and lectin chromatography It can be recovered from recombinant cell culture and purified by well known methods. most Preferably, high performance liquid chromatography ("HPLC") is used for purification. You.   The polypeptides of the present invention can be obtained from natural purified products, products of chemical synthetic procedures, and prokaryotic Biological or eukaryotic hosts (eg, bacterial cells, yeast cells, higher plant cells, Insect cells, and mammalian cells). Including. Depending on the host used in the recombinant production procedure, the polypeptides of the invention Can be glycosylated or non-glycosylated. In addition, The clear polypeptide may also be opened in some cases as a result of a host-mediated process. An initial modified methionine residue may be included. T1R-like ligand II polypeptides and peptides   The present invention further provides an amino acid sequence encoded by the deposited cDNA, Is an isolated T1R-like ligand II polypeptide having the amino acid sequence of FIG. Peptide, or peptide or polypeptide containing a part of the above polypeptide I will provide a. The terms “peptide” and “oligopeptide” (commonly recognized ) Is considered synonymous, and each term is contextually linked by peptide bonds Exchangeable if needed to indicate a chain of at least two amino acids Can be used. The term "polypeptide" refers to a chain containing more than 10 amino acid residues. As used herein. All oligopeptides and polypeptides herein The peptide formula or sequence is from left to right and from the amino terminus to the carboxy terminus. Written in the direction.   By an "isolated" polypeptide or protein from its natural environment An isolated polypeptide or protein is contemplated. For example, in a host cell Recombinantly produced polypeptides and proteins expressed in h and Johnson, Gene 67: 31-40 (1988). Natural or recombinant polypeptides and proteins that have been substantially purified by the technique. As with proteins, it is considered isolated for the purposes of the present invention.   Some amino acid sequences of T1R-like ligand II It is recognized in the art that modifications can be made without significantly affecting function. Arrangement If such differences in columns are intended, the important area of the protein that determines activity Remember that territory exists. Generally, the remaining functions that perform similar functions If a group is used, substitution of residues forming a tertiary structure is possible. In another example And the type of residue is crucial if the change occurs in a non-critical region of the protein Maybe not.   Accordingly, the present invention further provides substantial T1R-like ligand II activity, or T1R-like ligands containing regions of T1R-like ligand II such as the protein portions discussed below Includes variants of Gand II. Such variants include deletions, insertions, inversions, repetitions, and And type substitutions (eg, substitution of a hydrophilic residue for another, but usually (Aqueous residues are not replaced by strongly hydrophobic residues). Small changes, or this Such "neutral" amino acid substitutions generally have little effect on activity.   Typically seen as conservative substitutions are the aliphatic amino acids Ala, Val, Leu, and I substitution of one amino acid for another in le; hydroxyl residues Ser and Exchange of Thr and Thr, exchange of acidic residues Asp and Glu, substitution between amide residues Asn and Gln With the exchange of the basic residues Lys and Arg, and the substitution between the aromatic residues Phe, Tyr is there.   As detailed above, which amino acid changes are phenotypically silent Probable (ie, likely to have a significant detrimental effect on function) Further guidance on Bowie, J. U. Et `` Deciphering the Message in Pr otein Sequences: Tolerance to Amino Acid Substitutions, '' Science 247: 13 06-1310 (1990).   The polypeptide of the present invention is encoded by the deposited cDNA comprising a leader sequence. From the polypeptide encoded by the deposited cDNA, Figure 1 including the leader-free polypeptide (ie mature protein) and leader The polypeptide of FIG. 1 (SEQ ID NO: 2) excluding the polypeptide of (SEQ ID NO: 2) and leader Peptide, T1R-like ligand II extracellular domain, T1R-like ligand II transmembrane domain, and And T1R-like ligand II intracellular domain, and at least 9 0% similarity, more preferably at least 95% similarity, and even more preferably Or polypeptides having at least 96%, 97%, 98%, or 99% similarity including. Further, the polypeptide of the present invention, the polypeptide described herein, At least 80% identical, more preferably at least 90% or 95% identical, and even more More preferably, polypeptides that are at least 96%, 97%, 98%, or 99% identical And also at least 30 amino acids, and more preferably at least Includes portions of such polypeptides having 50 amino acids.   The "% similarity" between two polypeptides allows the BESTFIT program (W isconsin Sequence Analysis Package, Version 8 for Unix, Genetics Compute r Group, University Resarch Park, 575 Science Drive, Madison, WI 53711) And two defaults using a default setting to determine similarity. The similarity score generated by comparing the amino acid sequences of the polypeptides is intended Is done. BESTFIT is described in Smith and Waterman, Adv. Appl. Math. 2: 482-489 (1981) Local homology algorithm to find the best segment of similarity between two sequences Use to get out.   At least a reference amino acid sequence of a T1R-like ligand II polypeptide, e.g., 95 % Polypeptide having a "identical" amino acid sequence Up to 5 for each 100 amino acids of the reference amino acid sequence of the R-like ligand II polypeptide Except that it may include amino acid changes, the amino acid sequence of the polypeptide is the reference sequence. It is intended to be identical to In other words, at least the reference amino acid sequence To obtain a polypeptide having an amino acid sequence that is 95% identical to the reference sequence, Up to 5% of amino acid residues can be deleted or replaced with another amino acid Or a number of amino acids of up to 5% of the total amino acid residues in the reference sequence Can be inserted into a column. These reference sequence modifications are based on the amino terminus of the reference amino acid sequence. Position or at the carboxy-terminal position, or within the reference sequence or one within the reference sequence Between these terminal positions individually scattered anywhere between the residues in these close groups Somewhere, it can happen.   In fact, any particular polypeptide may be, for example, as shown in FIG. 1 (SEQ ID NO: 2). Amino acid sequence or amino acid encoded by the deposited cDNA clone At least 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence The best fit program (Wisconsin Sequence Analysis Package, Ve rsion 8 Unix version, Genetics Computer Group, University Research Park, 575 S publicly known computer programs such as cience drive, Madison, WI 53711) Can be determined conventionally. A particular sequence may be, for example, a reference sequence of the invention. Bestfit or any other sequence alignment to determine if it is 95% identical When using an infusion program, the percentage identity is, of course, Calculated over the entire length of the sequence and up to 5% of the total number of amino acid residues in the reference sequence The parameters are set such that a gap in homology at is allowed.   As described in detail below, the polypeptides of the invention may be T1R-like as described below. Useful in diagnostic assays to detect ligand II expression, or T1R And antago that can enhance or inhibit the function of liposome-like ligand II protein To raise polyclonal and monoclonal antibodies Can be used. In addition, such polypeptides may be used as candidate agonists of the invention. To "capture" T1R-like ligand II binding proteins that are also antagonists For use in yeast two-hybrid systems. Yeast two hybrid Field systems are described in Fields and Song, Nature 340: 245-246 (1989). You.   In another aspect, the invention provides an epitope-bearing portion of a polypeptide of the invention. Or a peptide or polypeptide comprising: Epitope of this polypeptide The moieties are immunogenic or antigenic epilobes of a polypeptide of the invention. An "immunogenic epitope" is one that elicits an antibody response when the entire protein is the immunogen. Defined as part of the evolving protein. These immunogenic epitopes It is believed to be limited to a few focuses on the child. On the one hand, antibodies can bind The region of the protein molecule that is described can be defined as an "antigenic epitope." protein Is generally less than the number of antigenic epitopes. For example, Geysen, H. M. Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1984) checking ...   A peptide or polypeptide bearing an antigenic epitope (ie, an antibody (Including regions of protein molecules that can bind). Relatively short synthetic peptide mimicking part reacts with partially mimicked protein It is well known in the art that antisera can be routinely induced. For example, Sutcli ffe, J. G. See Science 219: 660-666 (1983). Protein-reactive serum Are often represented in the primary sequence of the protein, and Can be characterized by a simple set of chemical laws, and The immunodominant region of the protein (ie, the immunogenic epitope) also has an amino-terminal Nor is it limited to the carboxyl terminus. Extremely hydrophobic peptides and Peptides with up to 6 residues are generally used to induce antibodies that bind to the mimetic protein. Longer, soluble peptides, especially those containing proline residues, , Is usually effective. Sutcliffe et al., Supra, 661. For example, these guidelines Out of 20 peptides designed according to (influenza virus hemagglutination (Including 8-39 residues covering 75% of the sequence of the native HA1 polypeptide chain) Or induced antibodies that react with intact virus; and MuLV polymerase 12/12 peptide from rabies glycoprotein and 18/18 from rabies glycoprotein Antibodies that precipitate proteins were induced.   The antigenic epitope-bearing peptides and polypeptides of the present invention are therefore Elicit antibodies, including monoclonal antibodies, that specifically bind to a polypeptide of the invention Useful to do. Thus, a domain immunized with an antigenic epitope-bearing peptide Most of the hybridomas obtained by fusion of spleen cells from Secretes antibodies that are reactive with natural proteins. Sutcliffe et al., Supra, 663. antigen Antibodies elicited by a neutral epitope-bearing peptide or polypeptide mimic Useful for detecting proteins, and antibodies against different peptides Follow the path of various regions of the protein precursor undergoing post-translational processing Can be used for In immunoprecipitation assays, short peptides (eg, about 9 Even amino acids) can bind and displace longer peptides. Thus, peptides and anti-peptide antibodies may be used in various assays for mimetic proteins. It can be used in sexual or quantitative assays, such as competitive assays. An example For example, Wilson, I. A. See Cell 37: 767-778 (1984) 777. The present invention Peptide antibodies can also be used to purify mimetic proteins (eg, using methods well known in the art). Used by adsorption chromatography).   Antigenic epitope-bearing peptides of the invention designed according to the above guidelines The tides and polypeptides are preferably within the amino acid sequence of the polypeptides of the invention. At least 7, more preferably at least 9, and most preferably It includes sequences between about 15 and about 30 amino acids. However, the amino acids of the polypeptides of the invention The book, comprising any length and up to about 30 to about 50 amino acids or the entirety of the acid sequence. Peptides or polypeptides comprising a greater part of the amino acid sequence of the polypeptide of the invention Tides are also considered to be epitope-bearing peptides or polypeptides of the invention. And is also useful for inducing antibodies that react with the mimetic protein. Preferably, the amino acid sequence of the epitope-bearing peptide is substantially (Ie, the sequence is relatively hydrophilic) And highly hydrophobic sequences are preferably avoided); and the proline residue Sequences containing groups are particularly preferred.   Can be used to produce T1R-like ligand II-specific antibodies or fragments Non-limiting examples of antigenic polypeptides include about 43 to about 43 in FIG. 1 (SEQ ID NO: 2). A polypeptide comprising about 52 amino acid residues; from about 82 to about 82 in FIG. 1 (SEQ ID NO: 2). A polypeptide comprising 98 amino acid residues; from about 129 to about 1 in FIG. 1 (SEQ ID NO: 2). A polypeptide comprising 46 amino acid residues; from about 162 to about 1 in FIG. 1 (SEQ ID NO: 2). A polypeptide comprising 75 amino acid residues; and about 18 in FIG. 1 (SEQ ID NO: 2). Polypeptides containing from 1 to about 197 amino acid residues are included. As shown above In addition, the present inventors have determined that the above polypeptide fragment It was determined to be a region of origin.   Epitope-bearing peptides and polypeptides of the invention are nucleic acid molecules of the invention. For producing peptides or polypeptides including recombinant means using Can be produced by conventional means. For example, a short epitope-bearing amino acid sequence Has been approved during recombinant production and purification, and for the production of anti-peptide antibodies. During epidemiology, it can be fused to a larger polypeptide that acts as a carrier. D Pitope-bearing peptides can also be synthesized using known methods of chemical synthesis. . For example, Houghten was prepared and characterized in less than four weeks (ELISA- Single amino acid variant of a segment of the HA1 polypeptide (by type-binding studies) Shows the synthesis of multiple peptides such as 10-20 mg of 248 different 13 residue peptides An easy way to do that is described. Houghten, R. A. , Proc. Natl. Acad. Sci. U SA 82: 5131-5135 (1985). This "Simultaneous Multiple Peptide Synthesis ( The SMPS) process is further described in US Patent No. 4,631,211 to Houghten et al. (1986). Will be posted. In this procedure, the individual resins for solid phase synthesis of various peptides are: Many identical iterative steps involved in solid phase methods, contained in separate solvent permeable packets Enables optimal use of Complete manual procedures require more than 500-1000 synthesis Allow them to be done simultaneously. Houghten et al., Supra, 5134.   The epitope-bearing peptides and polypeptides of the present invention can be prepared by methods known in the art. Used to induce antibodies by the method. For example, Sutcliffe et al., Supra; Wil. son et al., supra; Chow, M. Proc. Natl. Acad. Sci. USA 82: 910-914; and Bi ttle, F. J. J. et al. Gen. Virol. 66: 2347-2354 (1985). Generally Animals can be immunized with free peptide; however, anti-peptide antibody titers can be To a polymer carrier (eg, keyhole limpet hemocyanin (KLH)) Can be boosted by coupling to tetanus toxoid. For example , A cysteine containing peptide is m-maleimidobenzoyl-N-hydroxys Coupling to carriers using linkers such as succinimide esters (MBS) Other peptides may be more common, such as glutaraldehyde. It can be coupled to a carrier using a linking agent. Rabbit, rat, and rabbit C Animals, either free or carrier-coupled peptides, For example, about 100 μg of peptide or carrier protein and Freund's adjuvant Immunized by intraperitoneal and / or intradermal injection of an emulsion containing bunt . Some booster injections use, for example, free peptide adsorbed on a solid surface. To provide useful titers of anti-peptide antibodies that can be detected by an ELISA assay For example, it may be required at intervals of about two weeks. In serum from immunized animals The titer of the anti-peptide antibody can be determined, for example, by the selection of the anti-peptide antibody. Adsorption to Peptides on Solid Supports and Selection of Selected Antibodies It can be increased by elution.   The immunogenic epitope-bearing peptide of the invention, ie, the entire protein If immunogenic, the portion of the protein that elicits the antibody response is known in the art. Identified by the method of For example, Geysen et al. (1984) supra provide an enzyme-linked immunosorbent. Hundreds of peptides that are pure enough for the reaction in the A procedure for rapid simultaneous synthesis is disclosed. The interaction of the synthetic peptide with the antibody then They are easily detected without removing them from the support. In this style, Peptides bearing an immunogenic epitope of the desired protein are routinely available to those of skill in the art. Can be identified. For example, immunology of foot-and-mouth disease virus coat protein Critical epitopes are all 208 that cover the entire 213 amino acid sequence of the protein. Geys by elucidation of 7 amino acids by synthesis of overlapping sets of possible hexapeptides Positioned by en et al. Then all 20 amino acids are in turn within the epitope A complete substitution set of peptides substituted at each position is synthesized and reacted with the antibody. Specific amino acids that confer specificity for response have been determined. Therefore, the epi of the present invention Peptide analogs of the tope-bearing peptide are routinely made by this method. obtain. Geysen (1987) US Pat. No. 4,708,781 discloses an immunogen for a desired protein. This method of identifying a peptide bearing a sexual epitope is further described.   Still further, Geysen (1990) US Pat. No. 5,194,392 describes the identification of antibodies of interest. Topological equivalent of an epitope that is complementary to the paratope (antigen binding site) of Escherichia coli Of monomers (amino acids or other compounds) that are (ie, “mimotopes”) A general method for detecting or determining a sequence is described. More generally, Geysen (1989) U.S. Pat. No. 4,433,092 discloses ligand binding of a particular receptor of interest. Detect or determine the sequence of monomers that are topologically equivalent to a ligand that is complementary to the site How to do it. Similarly, Ho in Peralkylated Oligopeptide Mixtures ughten, R.A. A. (1996) US Pat. No. 5,480,971 discloses a linear C₁-C₇-Alkyl Peralkylated oligopeptides and sets and such peptides Library that binds preferentially to the acceptor molecule of interest. To determine the sequence of the alkylated oligopeptide, such an oligopeptide And methods of using libraries. Therefore, the epitope of the present invention -Non-peptide analogs of retained peptides are also routinely made by these methods Can be done.   The entire disclosure of each document cited in this section of "Polypeptides and peptides" is , Hereby incorporated by reference herein.   As those skilled in the art will appreciate, the T1R-like ligand II polypeptides of the present invention and Its epitope-bearing fragment is the constant domain of an immunoglobulin (IgG) To produce a chimeric peptide. These fusion proteins are purified And show increased half-life in vivo. This is, for example, human CD4- The first two domains of the polypeptide and the heavy chain or Is shown for a chimeric protein consisting of various domains of the constant region of the light chain. (EPA 394,827; Traunecker et al., Nature 331: 84-86 (1988)). By IgG part A fusion protein with a disulfide-bonded dimer structure can also bind other molecules. In combination and neutralization, monomeric T1R-like ligand II protein or protein May be more efficient than fragments alone (Fountoulakis et al., J. Biochem. 270: 3958-3964 (1995)). Diagnosis of T1R-like ligand II-related disorders   For T1R-like ligand II-related disorders, the “standard” T1R-like ligand II gene expression level (Ie, T1R-like ligands in tissues or fluids from individuals without disorders) Substantially increased (increased or decreased) as compared to Levels of T1R-like ligand II gene expression are collected from individuals with such disorders Tissue or other cells or body fluids (eg, serum, plasma, urine, synovial fluid, Cerebrospinal fluid). Therefore, the present invention provides a T1R-like ligand I Provide useful diagnostic methods during the diagnosis of I-related disorders. This is the tissue or Is the expression level of the gene encoding T1R-like ligand II in other cells or body fluids. Measuring gene expression levels and standard T1R-like ligand II Comparing with gene expression levels. Thereby, the gene compared to the standard An increase or decrease in expression levels is indicative of a T1R-like ligand II-related disorder .   T1R-like ligand II-related disorders include leukemia, lymphoma, arteriosclerosis, autoimmune diseases Disease, inflammatory disease, Alzheimer's disease, eye disease, apoptosis, delayed intrauterine growth But may include, but are not limited to, preeclampsia, pemphigus, and psoriasis. Not determined.   By individual is intended a mammalian individual, preferably a human. "T1R-like ligand I Measuring the expression level of the gene that encodes I Directly at the sample (eg, absolute protein or mRNA levels By measuring or evaluating) or relative (eg, a second biological sample) Comparing T1R-like ligand II protein levels or mRNA levels in Depending on the level of T1R-like ligand II protein or T1R-like ligand Qualitative or quantitative measurement of the level of mRNA encoding Evaluation is intended. Preferably, a T1R-like ligand in the first biological sample Is measured or evaluated, and the standard T1R Like ligand II protein level or mRNA level. Standards for obstacles Or a disorder obtained from a second biological sample obtained from an individual without Can be determined by the average level from a population of individuals who do not have In the field As assessed, once the standard T1R-like ligand II protein level or mRNA level Once the file becomes known, it can be used repeatedly as a standard for comparison.   Depending on the "biological sample", the individual, body fluid, cell line, tissue culture, or T1 Any source obtained from other sources, including R-like ligand II protein or mRNA A physical sample is intended. As shown, the biological sample is secreted Body fluids containing mature T1R-like ligand II (eg, serum, plasma, urine, synovial fluid, and Solution) or tissue supply found to express T1R-like ligand II protein Including source. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art It is. If the biological sample contains mRNA, tissue biopsy is the preferred source .   Total cellular RNA can be obtained using any suitable technique (eg, Chomczynski and Sacchi, Anal. Biochem. 162: 156-159 (1987), one-step guanidine-thiocyane Can be isolated from biological samples using the You. The level of mRNA encoding T1R-like ligand II can then be determined by any suitable method. And assayed using These include Northern blot analysis, S1 nuclease Combined with polymerase chain reaction (PCR), polymerase chain reaction Reverse transcription (RT-PCR) and reverse transcription combined with ligase chain reaction (RT-LCR) including.   Northern blot analysis is described in Harada et al., Cell 63: 303-312 (1990). It can be done as follows. Briefly, total RNA is prepared from biological samples as described above. Made. For Northern blots, RNA is prepared in an appropriate buffer (eg, Xyl / dimethylsulfoxide / sodium phosphate buffer). Gallose gel electrophoresis and transfer to nitrocellulose filter You. After the RNA is bound to the filter by the UV linker, the filter is Muamide, SSC, Denhardt's solution, denatured salmon sperm, SDS, and sodium phosphate Prehybridization is performed in a solution containing lium buffer. Any suitable A sharp method (for example,³²P multiprime DNA labeling system (Amersham)) The recognized T1R-like ligand II cDNA is used as a probe. Overnight hybrid After dicing, the filters are washed and exposed to X-ray film. Book CDNAs for use as probes according to the invention are described in the section above, And a length of at least 15 bp is preferred.   S1 mapping was performed as described in Fujita et al., Cell 49: 357-367 (1987). Can be done. To prepare the probe DNA for use in S1 mapping, The sense strand of the above cDNA was used as a template, and the labeled antisense DN A is synthesized. The antisense DNA then provides the appropriate restriction endonuclease. Digestion to produce additional DNA probes of desired length. this Such an antisense probe will target the target mRNA (ie, T1R-like ligand II). This is useful for visualizing the protected band corresponding to the mRNA that has been read. No Zan blot analysis can be performed as described above.   Preferably, the level of mRNA encoding T1R-like ligand II is determined by Makino et al., Techn. assayed using the RT-PCR method as described in ique 2: 295-301 (1990) . According to this method, the release of “amplicons” in a polyacrylamide gel band The radioactivity is linearly correlated to the initial concentration of the target mRNA. Briefly, this method uses RT Isolate from biological samples in reaction mixtures containing primers and appropriate buffers And adding the obtained total RNA. For primer annealing After incubation, the mixture contains RT buffer, dNTPs, DTT, RNase inhibitors, and And reverse transcriptase. Incubation to achieve reverse transcription of RNA After that, the RT product is then subjected to PCR using labeled primers. is there Alternatively, rather than labeling the primers, labeled dNTPs Can be included. PCR amplification is performed in a DNA thermal cycler according to conventional techniques. obtain. After the appropriate number of rounds to achieve amplification, the PCR reaction mixture is Electrophoresed on a Lilamide gel. After drying the gel, the appropriate band (T1R-like Radioactivity is determined using an image analyzer. Is done. RT and PCR reaction components and conditions, reagent and gel concentrations, and standards Knowledge methods are well known in the art. Variations on the RT-PCR method will be apparent to those skilled in the art.   Set up any oligonucleotide primer that amplifies the reverse transcribed target mRNA. A kit may be used and may be designed as described in the section above.   Assaying T1R-like ligand II levels in biological samples can be performed by any Can be performed using known methods. Antibody-based technology in biological samples Preferred for assaying T1R-like ligand II levels. For example, T Expression of 1R-like ligand II can be studied by traditional immunohistological methods. these In some cases, specific recognition is by primary antibody (polyclonal or monoclonal) Although provided, the secondary detection system utilizes fluorescence, enzymes, or other conjugated secondary antibodies. Can be used. The result was immunohistological staining of tissue sections for pathology testing. It is. Tissue can also be obtained by Western blot or dot / slot assay (Jalk anen, M .; J. et al. Cell. Biol. 101: 976-985 (1985); Jalkanen, M et al. Cell. Bi ol. 105: 3087-3096 (1987)) for the release of T1R-like ligand II, for example It can be extracted with urea and a neutral detergent. Based on the use of cationic solid phase In this technique, the quantification of T1R-like ligand II is based on the isolation of isolated T1R-like ligand II. Can be achieved using as a standard. This technique can also be applied to body fluids. For these samples, the molar concentration of T1R-like ligand II was in serum, plasma, urine, For different bodily fluids such as synovial fluid and perfusion fluid, the standard value of the T1R-like ligand II content Assist in setting. Next, the normal value of the amount of T1R-like ligand II is derived from a healthy individual. Values that can be compared to values obtained from the test subject. You.   Other antibody-based methods useful for detecting T1R-like ligand II levels include Muno assays (eg, enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay) Assay (RIA)). For example, a T1R-like ligand II-specific monoclonal antibody The body can be used as an immunosorbent and for detecting and quantifying T1R-like ligand II. It can be used both as an enzyme-labeled probe. T1R-like solution present in sample The amount of Gand II was calculated using standard linear regression computer algorithms It can be calculated by comparison with the amount present in the product. For detecting tumor antigens Such ELISAs are described in Iacobelli et al., Breast Cancer Research and Treatment 11: 19-30 (1988). In another ELISA assay, two different Specific monoclonal antibodies are used to detect T1R-like ligand II in body fluids. Can be used. In this assay, one antibody is used as an immunosorbent, The other is used as an enzyme-labeled probe.   The above techniques are essentially performed as "one-step" or "two-step" assays. obtain. The “one-step” assay involves contacting the immobilized antibody with T1R-like ligand II. Washing and contacting the labeled antibody with the mixture. Is not included. A “two-step” assay consists of a washing step followed by a labeled antibody Contacting the mixture. Other conventional methods are also used properly obtain. It is usually desirable to immobilize one component of the assay system on a support, This allows other components of the system to come into contact with the components and to be easily removed from the sample. Can be generated.   Suitable enzyme labels, for example, catalyze the production of hydrogen peroxide by reaction with a substrate Including those from the oxidase group. Glucose oxidase is a good cheap Qualitative and its substrate (glucose) is readily available. Good. The activity of the oxidase label is formed by the enzyme-labeled antibody / substrate reaction. Can be assayed by measuring the concentration of hydrogen peroxide. In addition to enzymes , As other suitable labels, radioisotopes (eg, iodine (¹²⁵I,¹²¹I), charcoal Element (¹⁴C), sulfur (³⁵S), tritium (^ThreeH), indium (¹¹²In), and technetium(^99mTc)), and fluorescent labels (eg, fluorescein and Rhodamine) and biotin.   Assaying T1R-like ligand II levels in a biological sample obtained from an individual In addition, T1R-like ligand II is also detected in vivo by image analysis. Can be Antibody labels or markers for in vivo image analysis of T1R-like ligand II Cars include those that can be detected by radiography, NMR, or ESR . For radiography, appropriate labels emit detectable radiation, Radiation, such as barium or cesium, that is not explicitly harmful to the subject Sex isotopes. Related markers as appropriate markers for NMR and ESR Like deuterium, which can be incorporated into antibodies by labeling the hybridoma's nutrients One having a characteristic rotation that can be detected.   Radioisotopes (for example,¹³¹I,¹¹¹In,^99mTc), radioactive opaque (radio-op aque) appropriate detectable, such as substrate or substance detectable by nuclear magnetic resonance T1R-like ligand II-specific antibodies or antibody fragments labeled with Is administered to the mammal being tested for the disorder (eg, parenterally, subcutaneously, Or intravenously) introduced. Subject size and image analysis system used Determines the amount of image analysis needed to produce a diagnostic image. Is understood in the art. In the case of radioisotope parts, Thus, the amount of radioactivity injected is usually in the range of about 5-20 millicuries.^99mTc It is. The labeled antibody or antibody fragment then contains the T1R-like ligand II Accumulates preferentially at cell locations. In vivo tumor image analysis is described in SW. Burchiel Et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Portions" (Tumer Imaging Chapter 13: The Radiochemical Detection of Cancer, Burchiel, S.W. and Rhodes, B.A., Masson Publishing Inc. (1982)) You.   A T1R-like ligand II-specific antibody for use in the present invention comprises a complete T1R-like ligand II or an antigenic polypeptide fragment thereof. this is, With or with carrier proteins such as albumin long enough In the case of at least about 25 amino acids, animals without animal carriers (for example, rabbits or Can be presented to mouse).   As used herein, the term "antibody" (Ab) or "monoclonal antibody" The "body" (Mab) is a complete molecule and antibody molecule capable of specifically binding to T1R-like ligand II. Fragmentation (eg, Fab and F (ab ')_Two(Like fragments) To taste. Fab and F (ab ')_TwoFragment lacks Fc fragment of whole antibody And is more rapidly removed by the circulation, and non-specific tissue binding of intact antibodies. Can have little (Wahl et al., J. Nucl. Med. 24: 316-325 (1983)). Therefore , These parts are preferred.   The antibodies of the present invention can be prepared by any of a variety of methods. For example, T1R Cells expressing Gand II or an antigenic fragment thereof are polyclonal antibodies Can be administered to animals to induce the production of serum containing. In a preferred way The preparation of the T1R-like ligand II protein is substantially free of natural contaminants Prepared and purified as described above. Then, such a tone The product is used by animals to produce polyclonal antisera with greater specific activity. be introduced.   In the most preferred method, the antibodies of the invention are monoclonal antibodies (or T1R-like ligand II binding fragment). Such a monoclonal antibody , Hybridoma technology (eg, Colligan, Current Protocols in Immunology , Wiley Interscience, New York (1990-1996); Harlow and Lane, Antibodies : A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. . (1988), Chapters 6-9, Current Protocols on Molecular Biology, Ausubel, Previous See Chapter 11, which references are incorporated by reference in their entirety. , Incorporated by reference). Generally, such a procedure is a T1R-like Animals with Gand II antigen or more preferably cells expressing T1R-like ligand II Immunization of a mouse). Suitable cells are anti-T1R-like ligand I Can be recognized by their ability to bind to the I antibody. Such cells are optional Can be cultured in a suitable tissue culture medium; however, 10% fetal bovine serum (at about 56 ° C.) (Inactivated), about 10 μg / l of non-essential amino acids, about 1,000 U / ml of penicillin Earle modified Eagle medium supplemented with streptomycin and approximately 100 μg / ml streptomycin. Preferably, the cells are cultured in the ground. The spleen cells of such mice are extracted, And fused with an appropriate myeloma cell line. Any suitable myeloma cell line may be used according to the invention. But can be used according to the American Type Culture Collection (AT CC) (SP) (Rockville, Maryland, USA)_TwoUse O) Is preferred. After fusion, the resulting hybridoma cells are selected in HAT medium And then Wands et al., Gastroenterology 80: 225-232 (1981); Harlow et al. And Lane, limiting dilution as described in Chapter 7, supra, cloning Is done. Then, the hybridoma cells obtained by such a selection were T1R Assay to identify clones that secrete antibodies capable of binding to It is done.   Alternatively, an additional antibody capable of binding to a T1R-like ligand II antigen is an anti-idiota It can be produced in a two-step procedure through the use of ip antibodies. In such a method, antibodies Use the fact that it is itself an antigen, and therefore It is possible to get. According to this method, T1R-like ligand II-specific antibodies Used to immunize an object (preferably a mouse). Then, such behavior Spleen cells are used to produce hybridoma cells, and Tumor cells have the ability to bind to T1R-like ligand II-specific antibodies. Screen to identify clones producing antibodies that can be blocked by the Be tuned. Such antibodies can be used as anti-ideas to T1R-like ligand II-specific antibodies. Inducing additional T1R-like ligand II-specific antibodies It can be used to immunize animals to guide.   Fab and F (ab ')_TwoAnd other fragments of the antibodies of the invention are disclosed herein. Obviously, it can be used according to the method performed. Such a fragment Is typically papain (to produce a Fab fragment) or pepsin (F (ab ' )_TwoFor proteolytic cleavage using enzymes such as It is produced. Alternatively, the T1R-like ligand II-binding fragment is a recombinant DN It can be produced by the application of A technology or synthetic chemistry.   Using in vivo imaging for elevated levels of diagnostics in humans When detecting Bell T1R-like ligand II, a "humanized" chimeric monoclonal antibody It may be preferred to use Such an antibody may be a monoclonal antibody as described above. It can be produced using a genetic construct from a hybridoma cell that produces the antibody. Ki Methods for producing mela antibodies are known in the art. For a review, see Mo rrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4: 214 (1986); Cabilly et al. No. 4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494; Ne. uberger et al., WO 8601533; Robinson et al., WO 8702671; Boulianne et al., Nature 312: 643. (1984); Neuberger et al., Nature 314: 268 (1985).   Further suitable labels for the T1R-like ligand II-specific antibodies of the invention are provided below. You. Examples of suitable enzyme labels include malate dehydrogenase, Staphylococcus Creatase, Δ-5-steroid isomerase, yeast alcohol dehydrogenase , Α-glycerol phosphate dehydrogenase, triose phosphate isomerase, Peroxidase, alkaline phosphatase, asparaginase, glucose Oxidase, β-galactosidase, ribonuclease, urease, catala , Glucose-6-phosphate dehydrogenase, glucoamylase, and acetyl Contains rucholinesterase.   Examples of suitable radioisotope labels are^ThreeH,¹¹¹In,¹²⁵I,¹³¹I,³²P,³⁵S,¹⁴ C,⁵¹Cr,⁵⁷To,⁵⁸Co,⁵⁹Fe,⁷⁵Se,¹⁵²EU,⁹⁰Y,⁶⁷Cu,²¹⁷Ci,²¹¹Ai,²¹²Pb ,⁴⁷Sc,¹⁰⁹Including Pd.¹¹¹In is where in vivo imaging is used Are preferred isotopes. Because this is¹²⁵I or¹³¹Model labeled with I This is because the problem of liver dehalogenation of noclonal antibodies is avoided. Further In addition, this radionucleotide is more preferred for imaging. Gamma emission energy (Perkins et al., Eur. J. Nucl. Med. 10: 296-301 (1985); Carasquillo et al., J. Nucl. Med. 28: 281-287 (1987)). For example, 1- (P-isothiocyanate benzene B) coupled to a monoclonal antibody using -DPTA¹¹¹In a non-neoplastic group It showed little uptake in the tissues (especially the liver). Therefore, tumor localization (Esteban et al., J. Nucl. Med. 28: 861-870 (1987)).   Examples of suitable non-radioactive isotope labels include¹⁵⁷Gd,⁵⁵Mn,¹⁶²Dy,⁵²Tr, and⁵⁶Fe Including.   Examples of suitable fluorescent labels are¹⁵²Eu label, fluorescein label, isothiocyanate Label, rhodamine label, phycoerythrin label, phycocyanin label, aloph Lycocyanine labeling, o-phthaldehyde labeling, and fluorinated Includes resamine label.   Examples of suitable toxin labels include diphtheria toxin, ricin, and cholera toxin.   Examples of chemiluminescent labels are luminal label, isoluminal label, aromatic acridi Label, imidazole label, acridinium salt label, oxalate Includes Tel, Luciferin, Luciferase, and Aequorin labels No.   Examples of nuclear magnetic resonance contrast agents include heavy metal nuclei such as Gd, Mn, and Fe. Including.   Representative techniques for coupling the above labels to antibodies are described by Kennedy et al. (Clin. Chim. Acta 70: 1-31 (1976)) and Schurs et al. (Clin. Chim. Acta 81: 1-40 (1977)). Provided by The coupling technique mentioned in the latter is glutar alde Hyd method, periodic acid method, dimaleimide method, m-maleimidobenzyl-N-hydride Roxy-succinimide ester methods, all of which are described herein. Incorporated as a reference.   Chromosome assay   The nucleic acid molecules of the invention are also useful for chromosome identification. The sequence contains individual human stains. Specifically targeted to a specific location on the chromosome, and hybridized to that location obtain. In addition, there is now a need to identify specific sites on the chromosome. Currently, Chromosome labeling reagents based on sequence data (repetitive polymorphisms) Not available for signs. The mapping of DNA to chromosome according to the present invention This is an important first step in correlating the sequence with the gene associated with the disease.   In certain preferred embodiments in this regard, the cDs disclosed herein NA is used to clone the genomic DNA of the T1R-like ligand II gene . This uses a variety of well-known techniques and publicly available libraries. Can be achieved. The genomic DNA can then be converted using well-known techniques for this purpose. Used for in situ chromosome mapping. Typically, a chromosome map Follow the routines of ping, some trial and error, but good in-situ high Required to identify genomic probes that give hybridization signals Can get.   In some cases, in addition, sequences may be used to convert cDNA to PCR primers (preferred). Or 15-25 bp) can be mapped to the chromosome. 3 'untranslated gene Computer analysis of translation regions spans more than one exon in genomic DNA Used to quickly select primers that do not complicate the amplification process Is done. These primers are then used for somatic cell hybrids containing individual human chromosomes. Used for PCR screening of lids. The human gene corresponding to the primer Only those hybrids that contain produce an amplified portion.   PCR mapping of somatic cell hybrids assigns specific DNA to specific chromosomes A quick procedure for Use the same oligonucleotide primer with the present invention Use a large genome in a panel of parts from a particular chromosome or in a similar fashion With the pool of clones, sublocalization can be achieved. Dye Other mapping strategies that can also be used to map to color bodies are In situ hybridization, labeling and flow-sorted staining Prescreening using chromosomes and construction of chromosome-specific cDNA libraries Preselection by hybridization to perform   Fluorescence in situ hive on the metaphase chromosome spread of cDNA clones Redidation ("FISH") is a process that provides accurate chromosomal location in one step. Can be used. This technology uses probes from cDNAs as short as 50 bp or 60 bp. Can be used. For a review of this technology, see Verma et al., Human Chromosomes: A See Manual of Basic Techniques, Pergamon Press, New York (1988) .   Once a sequence has been mapped to a precise chromosomal location, the physical The location can be correlated with the genetic map data. Such data is described, for example, in McK usick, Mendelian Inheritance in Man (Johns Hopkins University, Welch Medi (available online from the Cal Library). Then, Linkage analysis (physical analysis) (Inheritance of adjacent genes).   Next, differences in the cDNA or genomic sequence between affected and unaffected individuals Need to decide. The mutation is observed in some or all affected individuals, If not observed in any normal individual, this mutation is a causative agent of the disease. It is.   With the current resolution of physical and genetic mapping techniques, disease A cDNA correctly located in a chromosomal region associated with a potential of between 50 and 500 It may be one of the causative genes. (This is a 1 megabase mapping resolution, And one gene per 20 kb). Treatment of T1R-like ligand II disorders   By the present inventors, the T1R-like ligand II polypeptide of the present invention It is thought to share biological activity with kin-1 (IL-1) and T1R ligands. Obedience Thus, T1R-like ligand II (especially the mature form) It can be added exogenously to the tissue, or to the body of the individual. In particular, T1R-like ligand II tan Disorders caused by a decrease in standard levels of protein activity are T1R-like It can be treated by administering an effective amount of a Ligand II polypeptide. Preferably Is an isolated amount of the present invention that is effective to increase T1R-like ligand II protein activity. A pharmaceutical composition comprising the administered T1R-like ligand II polypeptide is administered. This Disorders for which such treatments appear to be effective are discussed above and below.   One of skill in the art will recognize that an effective amount of a T1R-like ligand II polypeptide will It is recognized that administration of the drug can be empirically determined for each condition indicated. A polypeptide having T1R-like ligand II activity can have one or more than one polypeptide in a pharmaceutical composition. Injected in combination with a pharmaceutically acceptable carrier, diluent, and / or excipient. Can be given. When administered to human patients, the total daily usage of the pharmaceutical compositions of the present invention is It is understood that the sound medical decision is determined by the attending physician. Any specific The particular therapeutically effective dose level for a given patient will depend on the type of response to be achieved and Degree; specific composition and other drugs used (if any); age and weight of patient , General health, gender, and diet; time of administration, route of administration, and composition Excretion rate; duration of treatment; combined with or used with a particular composition Drugs (eg, chemotherapeutic agents); as well as similar elements well known in the medical arts. Depends on various factors.   The T1R-like ligand II compositions used for therapy may also vary in the individual patient's clinical Side effect of treatment with T1R-like ligand II alone), site of delivery of T1R-like ligand II composition Taking into account, dosing method, dosing schedule, and other factors known to the practitioner. Prescribed and dispensed in a manner consistent with good medical practice. Therefore, the eyes in this specification An “effective amount” of a T1R-like ligand II polypeptide for targeting depends on such considerations. Is determined.   As a general proposal, the T1R-like ligand II polypeptide administered parenterally per dose The total pharmaceutically effective amount of the peptide is about 0.01 ng / kg / day to 10 μg / kg / day per patient weight , But as noted above, this is subject to therapeutic discretion. More preferred Preferably, this dose is at least 1.0 ng / kg / day, and most preferably for humans. The hormone is about 1.0-100ng / kg / day. When given continuously, T1R-like Gand II is typically administered at a dose rate of about 0.01 ng / kg / hr to about 100 ng / kg / hr, 1-4 injections per day or continuous subcutaneous infusion, for example using a minipump Administered by any of An intravenous bag solution may also be used.   The course of T1R-like ligand II polypeptide treatment to affect the immune system is Optimum if lasting longer than a fixed minimum number of days (7 days for mice) It is. The length of treatment required to observe the change, and the response after treatment The interval to wake up seems to vary according to the desired effect.   The T1R-like ligand II polypeptide is also suitably administered by a sustained release system. Suitable examples of sustained release compositions include shaped articles (eg, films or microcapsules). A) a semipermeable polymer matrix in the form of The sustained release matrix is Polylactide (US Pat. No. 3,773,919, EP 58,481), L-glutamic acid and γ-d Copolymers with chill-L-glutamate (U. Sidman et al., Biopolymers 22: 547-556 (1 983)), poly (2-hydroxyethyl methacrylate) (R. Langer et al., J. Biomed Mater. Res. 15: 167-277 (1981) and R.M. Langer, Chem. Tech. 12: 98-105 (1982) ), Ethylene vinyl acetate (R. Langer et al., Ibid.), Or poly-D-(-) 3- Contains droxybutyric acid (EP 133,988). The sustained release T1R-like ligand II composition also comprises Includes T1R-like ligand II polypeptide encapsulated in liposomes. T1R-like ligand II Liposomes containing polypeptides are prepared by methods known per se: DE 3,218,121: Epstein et al., Proc. Natl. Acad. Sci. USA 82: 3688-3692 (1985); Hwang Proc. Natl. Acad. Sci. USA 77: 4030-4034 (1980); EP 52,322; EP 36,676; EP  88,046; EP 143,949; EP 142,641; Japanese Patent Application No. 83-118008; U.S. Patent No. 4,48 5,045 and 4,544,545; and EP 102,324. Usually, liposomes are small Sana (about 200-800 angstroms) monolayer type, where the lipid content is about Higher than 30 mol.% Cholesterol, the ratio chosen is the optimal T1R-like ligand II Adjusted for treatment.   For parenteral administration, in one embodiment, the T1R-like ligand II polypeptide is In general, unit dose injectable forms (solutions, suspensions, Or an emulsion) of the polypeptide with a pharmaceutically acceptable carrier (ie, Non-toxic to recipients at the dosages and concentrations employed, and And a carrier that is compatible with the other ingredients. For example, The formulation is preferably harmful to oxidants, and polypeptides Excludes other known compounds.   Generally, the formulation comprises a T1R-like ligand II polypeptide in a liquid carrier or Uniform and direct contact with finely divided solid carrier or both Prepared by Then, if necessary, the product is shaped into the desired formulation. Preferably, the carrier is a parenteral carrier, more preferably the blood of the recipient. And a solution that is isotonic. Examples of such carrier vehicles are water, saline , Includes Ringer's solution and dextrose solution. Fixed oil and ethyl oleate Non-aqueous vehicles such as liposomes are also useful herein, as well as in liposomes. is there.   Carriers may be added in small amounts, such as substances that enhance isotonicity and chemical stability. Agents are suitably included. Such substances may be added to the recipe at the dosages and concentrations used. Non-toxic to phosphates, and phosphoric, citric, succinic, acetic, and other Buffers such as organic acids or salts thereof; antioxidants such as ascorbic acid; Low molecular weight (less than about 10 residues) polypeptides (eg, polyarginine or tripe Peptides); proteins such as serum albumin, gelatin, or immunoglobulin Quality; hydrophilic polymers such as polyvinylpyrrolidone; glycine, glutamic acid, Amino acids such as aspartic acid or arginine; cellulose or its Monosaccharides, disaccharides containing derivatives, glucose, mannose or dextrin And other carbohydrates; chelating agents such as EDTA; mannitol or sorby Sugar alcohols such as tall; counterions such as sodium; and / or Is a nonionic such as polysorbate, poloxamer or PEG Contains a surfactant.   T1R-like ligand II is typically present in such vehicles at about 0.001 ng / ml to 500 ng. / ml, preferably at a concentration of 0.1-10 ng / ml, at a pH of about 3-8. As mentioned above Use of certain of the excipients, carriers, or stabilizers may lead to T1R-like ligand II salts It is understood that this results in a formulation.   T1R-like ligand II to be used for therapeutic administration must be sterile Absent. Sterility is passed through a sterile filtered membrane (eg, a 0.2 micron membrane). This is easily achieved by subsequent filtration. Therapeutic T1R-like ligand II compositions are commonly used In a container having a sterile access port (for example, an intravenous solution bag or a hypodermic injection needle). Is placed in a vial with a stopper which can be pierced.   The T1R-like ligand II is usually administered in unit-dose or multi-dose containers (eg, sealed Aqueous solution or lyophilized for reconstitution Stored as a dry formulation. As an example of a lyophilized formulation, a 10 ml vial is available Filled with 5 ml of a filtered 1% (w / v) aqueous T1R-like ligand II solution and obtained The resulting mixture is lyophilized. Injection solution contains lyophilized T1R-like ligand II Prepared by using bacteriostatic distilled water for injection.   For example, satisfactory results have been seen in single or divided doses of 1 to 4 per day. Administered once, 0.05 to 5000 ng / kg / day, preferably 0.1 to 1000 ng / kg / day, more preferably Or T1R-like ligand II activity at dosages on the order of 10-100 ng / kg / day. Obtained by oral administration of the polypeptide. For example, by i.v. Parenteral administration, 0.01 to 500 ng / kg / day, preferably 0.05 to 100 ng / kg / day, and More preferably, dosages on the order of 0.1-50 ng / kg / day may be used. Therefore, Suitable daily dosages for patients are 2.5 ng to 250 μg (oral), preferably 5 ng to 50 μg. μg (oral), more preferably on the order of 50 ng to 12.5 μg (oral), or Or 0.5 ng to 25 μg (iv), preferably 2.5 ng to 500 μg (iv), and more Preferably it is on the order of 5 ng to 2.5 μg (iv).   T1R-like ligand II antibody therapy   In accordance with the present invention, an increased level of T1R-like ligand II protein activity Obstructs the effective amount of an antagonist of the T1R-like ligand II polypeptide of the present invention. It can be treated by administration. Therefore, T1R-like ligand II receptor Soluble T1R-like ligand II tan competes with intact proteins for binding As with proteins (eg, extracellular domains), the T1R-like ligand II polypeptides of the invention Antibodies (preferably monoclonal) or antibody fragments that bind the peptide , Useful in treating T1R-like ligand II-related disorders. Such antibodies and And / or the soluble T1R-like ligand II protein is preferably pharmaceutically acceptable Provided in a composition.   Pharmaceutical compositions of the invention include, for example, parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, It can be administered transdermally or by the buccal route. Alternatively or simultaneously, the administration is Can be oral. The dosage administered will depend on the age, health, and condition of the recipient. Weight, type of concurrent treatment (if any), frequency of treatment, and desired effect Depends on the nature.   Compositions within the scope of the present invention are those wherein the antibody, fragment, or derivative has an intended purpose. And all compositions contained in an amount effective to achieve the intended purpose. Individual must Determining the optimal range of effective amounts for each ingredient, while varying in necessity, is within the skill of the art. Is within. Effective doses include individual chimeric or monoclonal antibodies, bound The presence and nature of the therapeutic agent (see below), a function of the patient and its clinical condition And can vary from about 10 ng / kg body weight to about 100 mg / kg body weight. Preferred dosage Contains 0.1-10 mg / kg body weight.   Detectable labeled form for imaging or release for therapeutic purposes Or T1R-like ligand II antibody for parenteral administration, such as Fragment preparations can be prepared in sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Contains liquid. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol , Vegetable oils (eg, olive oil), and injectable organic esters (eg, Ethyl formate). Aqueous carriers include saline and buffered media. Water, alcoholic / aqueous solutions, emulsions or suspensions, including sodium chloride solution Oral vehicle, Ringer's dextrose, dextrose and sodium chloride , Lactated Ringer's, or fixed oils. Intravenous vehicles contain fluid supplements and Nutritional replenishers (eg, supplements based on Ringer's dextrose) ). Preservatives and other additives may also be present, for example, antimicrobials, antioxidants, Rate agents, and inert gases and the like. Generally, Remington ' s Pharmaceutical Science, 16th edition, Mack Publishing Co., Easton, PA, 1980 checking ...   Antibodies described herein are compatible with other monoclonal or chimeric antibodies. Or increase the number or activity of effector cells that interact with the antibody Useful in combination with lymphokines or hematopoietic growth factors Can be done. Expected pleiotropic biological effects of T1R-like ligand II   The T1R-like ligand II polypeptides of the present invention have many of the effects shown in Table 1 below. It is expected to have pleiotropic biological effects including: A similar biological effect is IL -1, especially pancreatic endocrine tissue (Mandrup-Poulsen, T. et al., Cytokine 5: 185 (1993)), thyroid (Rasmussen, A.K., Autoimmunity 16: 141 (1993)), hypothalamus -Pituitary-Adrenal axis (Fantuzzi, G., and Ghezzi, P., Mediator Inflamm. 2: 263 (1993); Rivier, C., Ann. NY Acad. Sci. 697: 97 (1993); Rivier, C., and Rive st, S., Ciba. Found. Symp. 172: 204 (1993)), fever (Coceani, F., "Fever: B asic Mechanisms and Management ”, New York, NY, Raven (1991) p. 59), bone Metabolism (Takakis, D.N., J. Peridontol 64: 416 (1993)), disease of rheumatoid arthritis Destruction of cartilage in the cause (Arend, W.P., and Dayer, J.M., Arthritis Rheum 33 : 305 (1990); Krane, S.M. et al., Ann. NY Acad. Sci. 580: 340 (1990)), implantation into the uterus ( Lewis, M.P. et al., Placenta 15:13 (1994)) and loss of red body mass (Roubenoff J., R. et al. Clin. Invest. 93: 2379 (1994)). You.                Table 1. Possible biological effects of T1R-like ligand II Assay used: pancreatic endocrine tissue (Mandrup-Poulsen, T. et al., Cytokine 5: 185 (19 93)), thyroid (Rasmussen, A.K., Autoimmunity 16: 141 (1993)), hypothalamus-lower Pituitary-adrenal axis (Fantuzzi, G. and Ghezzi, P., Mediator Inflamm. 2: 263 (1993) Rivier, C., Ann. NY Acad. Sci. 697: 97 (1993); Rivier, C., and Rivest, S. ., Ciba. Found. Symp. 172: 204 (1993)), fever (Coceani, F., "Fever: Basic" Mechanisms and Management ”, New York, NY, Raven (1991), p. 59), bone metabolism ( Tatakis, D.N., J. Peridontol 64: 416 (1993)), the etiology of rheumatoid arthritis Cartilage destruction (Arend, W.P. and Dayer, J.M., Arthritis Rheum 33: 305 (199 0); Krane, S.M. et al., Ann. NY Acad. Sci. 580: 340 (1990)), implantation into the uterus (Lewis, M. .P. Et al., Placenta 15:13 (1994)) and loss of red body mass (Roubenoff, R. et al., J. . Clin. Invest. 93: 2379 (1994)).   Having generally described the invention, the invention is provided by way of illustration and This can be more easily explained by reference to the following examples, which are not intended to be limiting. Understood.                                  Example Example 1: Expression and purification of T1R-like ligand II in E. coli   Mature extracellular solubilizing portion of T1R-like ligand II in the deposited cDNA clone The amino acid terminal sequence of T1R-like ligand II and the gene On the other hand, using a PCR oligonucleotide primer specific for the vector sequence 3 '. Width. Additional nucleotides containing restriction sites to facilitate cloning Was added to the 5 'and 3' sequences, respectively.   One skilled in the art will appreciate that the full-length mature T1R-like ligand II protein (about 27 to about 229 amino acids) Using appropriate 5 'and 3' oligonucleotide primers in E. coli Understand that it can be expressed.   Copy the extracellular domain of full-length T1R-like ligand II in the deposited clone. CDNA sequences to be loaded are translated into PCR oligonucleotides corresponding to the 5 'and 3' sequences of the gene. Amplify using primers. The 5 'primer has the sequence 5' CGCCCA TGG CCG GCT It has a TCA CAC CTT CC 3 '(SEQ ID NO: 4), which contains an underlined NcoI restriction site. T1R-like ligand II protein encoding the sequence of FIG. 1 (SEQ ID NO: 1) The 17 nucleotides (nucleotides 131 to 147) of the protein are immediately after the signal peptide. Start.   The 3 'primer has the sequence 5'CGCAAG CTT TCA TCT ATC AAA GTT GCT TTC 3 '(distribution No. 5), which contains a HindIII restriction site, followed by FIG. 1 (SEQ ID NO: 1) Is complementary to nucleotides 619-621 of T1R-like ligand II encoding the sequence And contains the opposite stop codon and 18 nucleotides.   The restriction site is convenient for the restriction enzyme site of the bacterial expression vector pQE60, In these examples used for bacterial expression in M15 / rep4 host cells (Qiag en, Inc. Chatsworth, CA, 91111). pQE60 is resistant to ampicillin antibiotics ("A mp^r)), The bacterial origin of replication ("ori"), an IPTG-inducible promoter, Includes asome binding site ("RBS"), a 6-His tag, and a restriction enzyme site.   Both the amplified T1R-like ligand II DNA and the vector pQE60 were digested with NcoI and Hin. Digest with dIII and then ligate the digested DNA together. T1R-like ligand II DNA Insertion into the pQE60 vector is restricted by the T1R-like ligand II coding region. Downstream of and operably linked to the IPTG-inducible promoter of the And inflation into the starting AUG appropriately located for translation of T1R-like ligand II Place it on the   Transform the ligation mixture into competent E. coli cells using standard procedures did. Such a procedure is described in Sambrook et al., Molecular Cloning: A Laboratory Manua. l, 2nd edition; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). Multiple copies of plasmid pREP4 (this is the lac Expression and kanamycin resistance (Kan^rE.) E. coli strain M15 / rep4 is used in performing the illustrative examples described herein. This strain (which is one of many strains that are suitable for expressing T1R-like ligand II) Is commercially available from Qiagen.   Transformants were grown on LB plates in the presence of ampicillin and kanamycin. Identify by their ability to breed. Isolate plasmid DNA from resistant colonies And the identity of the cloned DNA is confirmed by restriction analysis.   Clones containing the desired construct were ligated with ampicillin (100 μg / ml) and kanamycin. Overnight ("O / N") in liquid culture in LB medium supplemented with both (25 μg / ml) Bred.   Large scale cultures were inoculated at a dilution of about 1: 100 to 1: 250 using the O / N culture. Replace cells with 0 Grow to an absorbance at 600 nm ("OD600") of between 0.4 and 0.6. Next, Add isopropyl-B-D-thiogalactopyranoside ("IPTG") to a final concentration of 1 mM And inactivate the lacI repressor to increase the lac repressor sensitivity Induces transcription from the promoter. Continue incubation of cells for another 3-4 hours. To The cells are then harvested by standard methods by centrifugation and disrupted. Break. The inclusion bodies are purified from the disrupted cells using routine harvest techniques and The protein is solubilized from the inclusion bodies into 8M urea. 8 containing solubilized proteins M urea solution is passed through a PD-10 column in 2x phosphate buffered saline ("PBS") , Thereby removing urea, replacing the buffer, and refolding the protein No. The protein is purified by an additional step of chromatography and Removes xin. Then, it was sterilized by filtration. Filter-sterilized protein preparation Save in 2x PBS.   Analysis of the preparation by standard methods of polyacrylamide gel electrophoresis Contains about 95% of monomeric T1R-like ligand II with a predicted molecular weight of about 26 kDa It revealed that. Example 2: Cloning of T1R-like ligand II in baculovirus expression system And expression   CDNA sequence encoding full-length T1R-like ligand II in the deposited clone To the PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of this gene. Amplify using an immer:   The 5 'primer has the sequence 5' CGCGGA TCC GCC ATC ATG GGC GAC AAG ATC TGG 3 ′ (SEQ ID NO: 6) and contains an underlined BamHI restriction enzyme site, followed by FIG. 18 nucleotides (nucleotide) of the sequence of T1R-like ligand II of the sequence (SEQ ID NO: 1) Pide 55-72). T1R-like Riga inserted into the expression vector as described below The 5 'end of the amplified fragment encoding Provide Effective signals for initiating translation in eukaryotic cells are described in Kozak, M. ., J. Mol. Biol. 196: 947-950 (1987). Properly placed on the part.   The 3 'primer has the sequence 5' CGCGGT ACC TCA CAA TGT TAC GTA CTC TAG 3 '(distribution Column number 7), which contains the underlined Asp718 restriction site and is subsequently shown in FIG. Nucleotides 754 to 771 of T1R-like ligand II encoding the sequence (SEQ ID NO: 1) And a stop codon and 18 nucleotides that are complementary to and reverse to.   Copy the extracellular domain of full-length T1R-like ligand II in the deposited clone. The cDNA sequences to be ligated are translated into PCR oligonucleotides corresponding to the 5 'and 3' sequences of this gene. Amplify using leotide primers:   The 5 'primer has the sequence 5' CGCGGA TCC GCC ATC ATG GGC GAC AAG ATC TGG 3 ′ (SEQ ID NO: 6) and contains an underlined BamHI restriction enzyme site, followed by FIG. 18 nucleotides of the sequence encoding T1R-like ligand II shown in SEQ ID NO: 1 Reotide (nucleotides 55-72). Insert into expression vector as described below The 5 'end of the amplified fragment encoding T1R-like ligand II Provide an effective signal peptide. Effective system for initiation of translation in eukaryotic cells Gunnar is described by Kozak, M., J .; Mol. Biol. 196: 947-950 (1987) As such, it is appropriately located in the vector portion of the construct.   The 3 'primer has the sequence 5' CGCGGT ACC TCA TCT ATC AAA GTT GCT TTC 3 '(distribution Column number 8), which contains the underlined Asp718 restriction site and is subsequently shown in FIG. Nucleotides 619 to 636 of T1R-like ligand II encoding the sequence And a stop codon and 18 nucleotides that are complementary to and reverse to.   The amplified fragment was purified using a commercially available kit (“Geneclean” BIO 101 Inc., La. (Jolla, Ca.) using a 1% agarose gel. Then this flag Is digested with BamHI and Asp718 and purified again on a 1% agarose gel. You. This fragment is designated herein as F2.   Using the vector pA2, Summers et al., A Manual of Methods for Baculovirus Ve ctors and Insect Cell Culture Procedures, Texas Agricultural Experimenta l Station Bulletin No. Using the standard method described in 1555 (1987), the full-length T Baculoyl for extracellular domains of 1R-like ligand II and T1R-like ligand II Is expressed in the expression system. The pA2 vector contains the signal peptide coding region. No. Therefore, the T1R-like ligand II signal peptide is (nucleotide of FIG. 1) 55-132 (SEQ ID NO: 1)); depends on amino acids 1-26 (SEQ ID NO: 2) in FIG. .   T1R-like ligand II signal peptide is effective for T1R-like ligand II protein If no significant expression occurs, the pA2-GP vector can be used instead of the pA2 vector. A The signal peptide of cMNPV gp67 (including the N-terminal methionine) is located after the BamHI site. It is located upstream. Those skilled in the art will appreciate that if a pA2-GP expression vector is used, 5 ′ oligonucleotide encodes a T1R-like ligand II signal peptide Understand that it should not contain any sequences. Instead, the 5 'oligonucleotide is Should start at nucleotide 131.   Both pA2 and pA2-GP expression vectors are Autographa californica nuclear polyhedra. Strong polyhedrin promoter of disease virus (AcMNPV) followed by unfavorable Including restriction sites. Simian virus 40 ("SV40") polyadenylation site Used for efficient polyadenylation. For easy selection of recombinant viruses , The β-galactosidase gene from E. coli is oriented in the same direction as the polyhedrin promoter And followed by the polyadenylation signal of the polyhedrin gene. Polyhe The drin sequence is inserted into the virus for cell-mediated homologous recombination with wild-type viral DNA. Viable flanked by sequences and expressing cloned polynucleotides Produces a virus.   As will be readily appreciated by those skilled in the art, the construction must be suitable for transcription, translation, transport, etc. Positioned signals (eg, AUG and signal pairs in frame if necessary) Many other baculovirus vectors (eg, pAc373, pVL941, and pAcIM1) can be used instead of pA2 or pA2-GP. This Such vectors are described, inter alia, in Luckow et al., Virology, 170: 31-39.   Digest the plasmid with the restriction enzyme XbaI using routine procedures known in the art. Followed by dephosphorylation using bovine intestinal phosphatase. Then, a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca) using 1% agarose gel Isolated from the This vector DNA is designated herein as "V2".   Fragment F2 and dephosphorylated plasmid V2 were ligated together with T4 DNA ligase. Tie. E. coli HB101 cells are transformed with the ligation mixture and plated on culture plates. Sow. Digest DNA from individual colonies using XbaI, then run on gel electrophoresis Therefore, by analyzing the digestion product, it is possible to have the human T1R-like ligand II gene. Identify the bacteria containing the plasmid. The sequence of the cloned fragment is Confirm by column determination. This plasmid is referred to herein as pBacT1R-like ligand Name it I.   5 μg of plasmid pBacT1R-like ligand I was transferred to Felgner et al., Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987) using the lipofection method. 1.0 μg of commercially available linearized baculovirus DNA (“BaculoGold^TM baculovirus DN A ", Pharmingen, San Diego, CA.). 1 μg BaculoGold^TMViral DNA and 5 μg of plasmid pBacT1R-like ligand I , 50 μl serum-free Grace's medium (Life Technologies Inc., Gaithersburg, MD) Mix in sterile wells of a microtiter plate containing Then 10 μl Add Lipofectin and 90 μl Grace's medium, mix and at room temperature Incubate for 15 minutes. The transfection mixture is then Sf9 insect cells seeded in 35 mm tissue culture plates with 1 ml of clear Grace's medium (ATCC CRL 1711). Mix the plate with the newly added solution. Shake back and forth. The plate is then incubated at 27 ° C. for 5 hours. After 5 hours, the transfection solution was removed from the plate and 10% calf Add 1 ml Grace's insect medium supplemented with baby serum. Incubate plate And continue the culture at 27 ° C. for 4 days.   After 4 days, the supernatant was collected and described in Summers and Smith (cited above). Perform plaque assay as described. Gal expression produces blue-stained plaques To allow for easy identification and isolation of clones, use "Blue Gal" (Life Tec agarose gel with hnologies Inc., Gaithersburg) is used. (This Thailand A detailed description of the “plaque assay” is also available from Life Technologies Inc., Gait Insect cell culture and baculovirology user guide distributed in hersburg (Also found in pages 9-10).   Four days after serial dilution, virus is added to the cells. Proper incubation Later, the plaque stained blue is picked up with the tip of an Eppendorf pipette. Then Agar containing recombinant virus, eppendorf containing 200 μl Grace's medium Resuspend in tube. Agar is removed by brief centrifugation and recombined Infection of Sf9 cells seeded in 35 mm dish with supernatant containing baculovirus Used to Four days later, the supernatants of these culture dishes are collected and then Store them at 4 ° C. Claw containing hESSB I, II, and III properly inserted Are identified by DNA analysis including this restriction mapping and sequencing. This This is named V-T1R-like ligand I in this specification.   Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. Cells At a multiplicity of infection ("M0I") of about 2 (about 1 to about 3), the recombinant baculovirus V-T1R-lik Infect with e ligand I. After 6 hours, the medium was removed and methionine and SF900 II medium (Life Technologies Inc., Gaithersburg? Available). 42 hours later, 5 μCi³⁵S-methionine and 5 μCi of³⁵Add S-cysteine (available from Amersham). Cells for an additional 16 hours Incubate, then collect cells by centrifugation, lyse and label The proteins are visualized by SDS-PAGE and autoradiography.   Example 3: Cloning and expression in mammalian cells   Transient expression of T1R-like ligand II protein gene sequence in mammalian cells Most currently used vectors should have the SV40 origin of replication. this This means that cells expressing the T antigen required to initiate viral DNA synthesis (eg, COS cells) Vesicles) allows the replication of high copy number vectors. Any other mammal Cell lines may also be used for this purpose.   A typical mammalian expression vector is a promoter element (an mRNA transcription opener). Mediating initiation), protein coding sequences, and termination of transcription and transcription of transcripts. Contains signals required for liadenylation. A further element is Enhan Kozak and intervening sequences flanked by donors, donors, and RNA splices Acceptor sites for Thing. Very effective transcription from SV40 Early and late promoters, long terminal repeats (LTRs) from retroviruses (eg For example, the early promoters of RSV, HTLVI, and HIVI) and cytomegalovirus (CMV) Can be achieved with data. However, cellular signals can also be used (eg, human Actin promoter). Suitable expression vectors for use in the practice of the present invention For example, pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATC C37152), pSV2dhfr (ATCC 37146), and pBC12MI (ATCC 67109) Vector. Mammalian host cells that can be used include human Hela, 283 , H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos1, Cos7 and CV1, African green monkey cells, quail QC1-3 cells, mouse L cells, and Chinese Hamster ovary cells.   Alternatively, the gene is transferred to a stable cell line containing the gene, which is integrated into the chromosome. Can be expressed in Selectable markers (eg, dhfr, gpt, neomycin, high Glomycin) Which co-transfection identifies transfected cells And allows for isolation.   Transfected genes can also be amplified to encode large amounts of encoded protein. Can be expressed. DHFR (dihydrofolate reductase) contains hundreds of genes of interest Or a marker useful for developing cell lines with thousands of copies. Another A useful selectable marker for is the enzyme glutamine synthase (GS) (Murphy et al., Biochem J. 227: 277-279 (1991); Bebbington et al., Bio / Technology 10: 169-175 (19 92)). Using these markers, mammalian cells can be grown in selective media. And select the cells with the highest resistance. These cell lines integrate into chromosomes. Contains the amplified gene (s) to be incorporated. Chinese hamster ovary (CHO) cells are often used for the production of proteins.   The expression vectors pC1 and pC4 contain the strong promoter of Rous sarcoma virus (LT R) (Cullen et al., Molecular and Cellular Biolugy, 438-4470 (March 1985)) And fragments of the CMV-enhancer (Boshart et al., Cell 41: 521-530 (1985)) )including. Multiple cloning sites (eg, restriction sites BamHI, XbaI, And Asp718) facilitate cloning of the gene of interest. Vector In addition, the 3 'intron, polyadenylation, and And termination signals. Example 3 (a): Cloning and expression in COS cells   Expression plasmid, cDNA encoding T1R-like ligand II, expression vector pcDNA Created by cloning into I / Amp (available from Invitrogen, Inc.). To make.   The expression vector pcDNAI / amp is as follows: (Dower, Colotta, F. et al., Immunol Today 15 : 562 (1994)) E. coli replication effective for growth in E. coli and other prokaryotic cells (Greenfeder, S.A., et al., J. Biol. Chem. 270: 13757 (1995)) Plasmid included Ampicillin resistance gene for selection of prokaryotic cells; (Polan, M.L. et al., Am . J. Obstet. Gynecol. 170: 1000 (1994)) SV for growth in eukaryotic cells (Carinci, Mora, M. et al., Prog. Clin. Biol. Res. 349: 205 (1990). ) CMV promoter, polylinker, SV40 intron; Often under the control of expression of the CMV promoter and restriction sites in the polylinker Position operably linked to SV40 intron and polyadenylation signal A polyadenylation signal arranged in such a manner.   DNA fragment encoding the complete T1R-like ligand II precursor and its 3 'end HA tag fused in-frame to the vector and cloned into the polylinker region of the vector. Thus, the recombinant protein expression is driven by the CMV promoter. HA The influenza blood clot described by Wilson et al., Cell 37: 767 (1984). Corresponds to an epitope from the confluent protein. HA tag fusion to target protein Enables simple detection of recombinant proteins using antibodies that recognize the HA epitope Nasu You.   The plasmid construction strategy is as follows.   The T1R-like ligand II cDNA of the deposited clone was replaced with the T1R in E. coli described above. As well as for the construction of expression vectors for the expression of Amplification using primers containing restriction sites. Expressed T1R-like ligand II To facilitate detection, purification, and characterization of Hemagglutinin tag ("HA tag").   One skilled in the art will appreciate that the full length T1R-like ligand II protein (about 1 to about 229 amino acids) Generated in COS cells using the appropriate 5 'and 3' oligonucleotide primers Understand what it can do.   Copy the extracellular domain of full-length T1R-like ligand II in the deposited clone. CDNA sequences to be loaded are translated into PCR oligonucleotides corresponding to the 5 'and 3' sequences of the gene. Amplify using primers. The 5 'primer has the following sequence:   5 'CGCGGA TCC Has GCC ATC ATG GGC GAC AAG ATC TGG 3 '(SEQ ID NO: 6) This is the underlined BamHI site and the T1R-like ligase shown in FIG. 1 (SEQ ID NO: 1). And 18 nucleotides of the coding sequence (nucleotides 55-72).   The 3 'primer has the following sequence:   5 'CGCTCT AGATCA AGC GTA GTC TGG GAC GTC GTA TGG GTA TCT ATC AAA GTT  GCT TTC 3 '(SEQ ID NO: 9), which is underlined XbaI restriction site, stop Don, HA tag, and T1R-like ligand II code shown in FIG. 1 (SEQ ID NO: 1) 18 nucleotides that are reverse and complementary to nucleotides 619-639 of the sequence (nucleotide 5 5-72).   Digest PCR amplified DNA fragment and vector pcDNAI / Amp with BamHI and XbaI And then ligate. The ligation mixture was transformed into E. coli strain SURE (Stratagene Cl oning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037 Possible), and then incubate the transformed cultures for ampicillin resistance Plate onto ampicillin media plates that allow colonies to grow. Plasmid DNA was isolated from the resistant colonies and the T1R-like ligand II-encoded fragment Is tested for the presence of the fragment by restriction analysis and gel size fraction.   For expression of recombinant T1R-like ligand II, COS cells were prepared as described, for example, in Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, Co Using DEAE-DEXTRAN described in ld Spring Harbor, New York (1989), Transfected with an expression vector. Expression of huXAG-1 by vector in cells Incubate under conditions for   Expression of a T1R-like ligand II HA fusion protein is described, for example, in Harlow et al., Antibodi. es: A Laboratory Manual, 2nd edition; Cold Spring Harbor Laboratory Press, Cold Radiolabeling and immunoprecipitation using the method described in Spring Harbor, New York (1988). Detect by descending method. To achieve this goal, two days after transfection And the cells³⁵By incubating for 8 hours in a medium containing S-cysteine Sign. Harvest cells and media, wash cells, and use Wilson et al. Detergent-containing RIPA buffer as described in (cited above): 150 mM Na Dissolved in Cl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM TRIS, pH 7.5 I do. Proteins are lysed and cultured using HA-specific monoclonal antibodies. Settle out of the nutrient medium. Then, the precipitated protein was subjected to SDS-PAGE gel and Analyze by triradiography. Cell lysis of expression product of expected size , Which is not observed in the negative control. Example 3 (b): Cloning and expression in CHO cells   The vector pC4 is used for the expression of the T1R-like ligand II protein. Plastic Smid pC4 is a derivative of plasmid pSV2-dhfr (ATCC Accession No. 37146). This Contains the mouse DHFR gene under the control of the SV40 early promoter. Tea lacking dihydrofolate activity transfected with these plasmids Inish hamster ovary cells or other cells receive the chemotherapeutic drug methotrexate. Grow cells in supplemented selection medium (α minus MEM, Life Technologies) Can be selected by In cells that are resistant to methotrexate (MTX) Amplification of the DHFR gene has been well documented (eg, Alt, F.W., Kellems, R. et al. M., Bertino, J.R. and Schimke, R.T., 1978, J.M. Biol. Chem. 253: 1357-1370 , Hamlin, J.L. and Ma, C. 1990, Biochem. et Biophys. Acta, 1097: 107-143, P See age, M.J. and Sydenham, M.A. 1991, Biotechnology 9: 64-68. ). Cell growth at increasing concentrations of MTX was targeted as a result of DHFR gene amplification. Overproduction of the enzyme DHFR results in resistance to the drug. The second gene is DH When linked to the FR gene, it is usually co-amplified and over-expressed. Heredity Developing cell lines with more than 1,000 copies of offspring is state of the art. Continued Therefore, if methotrexate is removed, the cell line will be chromosomal (single or multiple). )).   Plasmid pC4 is used for Rous sarcoma virus (Cullen et al., Molecular and Cellulor biology., March 1985, 438-4470) A powerful promoter for the purpose of long terminal repeats (LTRs). Gene and human cytomegalovirus (CMV) (Boshart et al., Cell 41: 521-530,1985) fragment isolated from the immediate-early gene enhancer. Including gene expression. Downstream of the promoter allows for subsequent gene uptake Single restriction enzyme cleavage site for BamHI, PvuII and NruI. These cloni Behind the reading site, the plasmid contains transcriptional readings in all three reading frames. Top codon followed by the 3 'intron of the rat preproinsulin gene and Contains a polyadenylation site. Other high efficiency promoters are also used for expression (Eg, the human β-actin promoter, SV40 early or late promoter). Long terminal repeats from other retroviruses (eg, HIV and HTLVI) ). Due to polyadenylation of mRNA, other signals (eg, human growth hormone) Or from the globin gene) can be used as well.   Stable cell lines with the gene of interest inserted into the chromosome can also be used as selectable markers. (Eg, gpt, G418, or hygromycin) You can make a selection based on: Two or more selectable markers at the start (eg, G418 and And methotrexate).   Plasmid pC4 is digested with the restriction enzyme BamHI, followed by bovine intestinal phosphatase. And dephosphorylation by procedures known in the art. The vector is then % Agarose gel.   A DNA sequence encoding a T1R-like ligand II protein is PCR oligos specific for the amino terminal sequence of the protein and the 3 'vector sequence of the gene Amplify using nucleotide primers. System to facilitate cloning Additional nucleotides, including restriction sites, are added to the 5 'and 3' sequences, respectively.   The cDNA sequence encoding full-length T1R-like ligand II was replaced with the 5 'and 3' sequences of the gene. Amplify using the corresponding PCR oligonucleotide primers. The 5 'primer is , Sequence 5 'CGCGGA TCC GCC ATC ATG GGC GAC AAG ATC TGG 3 '(SEQ ID NO: 6) This is an underlined BamHI restriction enzyme site, followed by the Tam in FIG. 1 (SEQ ID NO: 1). Includes 18 nucleotides (nucleotides 55-72) of the sequence of 1R-like ligand II. Expression Amplification encoding human T1R-like ligand II inserted into a vector (described below) The 5 'end of the resulting fragment provides an effective signal peptide. Eukaryote Signal sufficient for translation initiation in cells (Kozak, M., J. Mol. Biol. 196: 9 47-950 (1987)) in the vector portion of the construct .   The 3 'primer has the sequence 5' GCGGGT ACC TCA CAA TGT TAC GTA CTC TAG 3 '(distribution Column number 7), which is underlined Asp718 restriction, followed by a stop codon and Nucleotides 754-771 of the T1R-like ligand II coding sequence of FIG. Includes reverse as well as complementary 17 nucleotides. The restriction site is CHO expression vector PC-4 Is convenient for the restriction enzyme site.   The cDNA sequence encoding the extracellular domain of full-length T1R-like ligand II Amplify using PCR oligonucleotide primers corresponding to the 'and 3' sequences.   The 5 'primer has the sequence 5' CGCGGA TCC GCC ATC ATG GGC GAC AAG ATC TGG 3 ' (SEQ ID NO: 6), which is an underlined BamHI restriction enzyme site and FIG. 18 nucleotides (nucleotides 55 to 72) of the sequence of T1R-like ligand II of SEQ ID NO: No. 1). T1R-like ligand II inserted into an expression vector (described below) The 5 'end of the encoded amplified fragment provides an effective signal peptide You. Signals effective for translation initiation in eukaryotic cells (Kozak, M., J. Mo. l. Biol. 196: 947-950 (1987)) in the vector portion of the construct. Place properly.   The 3 'primer has the sequence 5' CGCGGT ACC TCA TCT ATC AAA GTT GCT TTC 3 '(distribution Column number 8), which is underlined Asp718 restriction, followed by a stop codon and Figure 1 (SEQ ID NO: 1) reverse to nucleotides 619-636 of the T1R-like ligand I coding sequence And 18 complementary nucleotides.   The amplified T1R-like ligand II DNA is digested with BamHI and Asp718. vector pC4 is digested with BamHI, and the digested DNA is ligated together. Then isolated Ligated fragment and dephosphorylated vector with T4 DNA ligase. T1R Insertion of ligand II protein DNA into a BamHI restricted vector is a T1R-like The Gand II protein coding region is placed downstream of the vector promoter and And operably linked to a vector promoter. Then, E. coli HB101 cells And the plasmid inserted in the correct orientation using the restriction enzyme BamHI. Bacteria containing pC4 are identified. The ligation mixture can be used, for example, in Sambrook et al., MOLECUAR CL ONING: A LABORATORY MANUAL, 2nd edition, Cold Spring Harbor Laboratory Press, Using standard procedures as described in Cold Spring Harbor, N.Y. (1989), Transform competent E. coli cells. Transform the culture into ampicillin medium Plate on plate, then incubate to allow ampicillin resistant colonies Allows Ronnie to grow. Plasmid DNA was isolated from resistant colonies and Restriction analysis and gel determination of the sequence of the 1R-like ligand II coding fragment Test by doing. The sequence of the inserted gene is confirmed by DNA sequencing. Admit. Transfection of CHO-DHFR cells   Transferring Chinese hamster ovary cells lacking active DHFR enzyme Used for action. 5 μg of expression plasmid C4 was lipofected (Felgner et al., Supra) using 0.5 μg of plasmid pSV2-neo for simultaneous tracing. Transfect. Plasmid pSV2-neo contains a dominant selectable marker (a group of It contains the gene neo) from Tn5 which encodes an enzyme that confers resistance to antibiotics. cell Are seeded in α-minus MEM supplemented with 1 mg / ml G418. After 2 days, try to remove cells Shin-treated and seeded on hybridoma cloning plates (Greiner, Germany) And culture for about 10-14 days. The single clone is then trypsinized, Then different concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200 nM, 400 nM) To seed a 6-well petri dish or 10 ml flask. Then the highest concentration Clones that grow on methotrexate are replaced with higher concentrations of methotrexate (50 (NM, 1 μM, 2 μM, 5 μM). Same procedure Is repeated until the clones grow at a concentration of 100 μM.   Expression of the desired gene product can be determined, for example, by SDS-PAGE and Western blot analysis. Analyze by Expression of a T1R-like ligand II fusion protein is determined, for example, by Harlo w et al., Antibodies: A Laboratory Manual, 2nd edition; Cold Spring Harbor Laboratory  Press, Cold Spring Harbor, New York (1988) Detection by immunological precipitation and immunoprecipitation. For this purpose, transfection Two days after, the cells are³⁵8 hours incubation in medium containing S-cysteine Label with Harvest cells and media and wash cells, and Wils detergent containing RIPA buffer (150 mM Na Dissolved in Cl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM TRIS (pH 7.5) Let it. The protein was lysed and analyzed using a HA-specific monoclonal antibody. And precipitate from the cell culture medium. Then, the precipitated protein was subjected to SDS-PAGE gel and And analyzed by autoradiography. Transfer the expression product of the expected size to the cell. Found in the lysate, which is found in the negative control Absent. Example 4: T1R-like ligand II tissue expression tissue distribution   Northern blot analysis was performed and described, inter alia, in Sambrook et al. (Cited above). Thus, using the method described, the T1R-like ligand II gene in human tissues Test expression levels. The complete T1R-like ligand II nucleotide sequence of the invention ( A cDNA probe (SEQ ID NO: 1) containing SEQ ID NO: 1) was^TMDNA labeling system (Am ersham Life Science) according to the manufacturer's instructions³²Label with P. After labeling, the probe was changed to CHROMA SPIN-100.^TMColumns (Clontech Laboratories, Inc. ) According to the manufacturer's protocol number PT1200-1. Then Expression of T1R-like ligand II gene using purified labeled probe Test various human tissues.   Multi-tissue Northern (MTN) containing various human tissues (H) and human immune system tissues (IM) ) Blots were obtained from Clontech and ExpressHyb^TM Hybridization Solutio n (Clontech) according to the manufacturer's protocol number PT1190-1 Test with probe. Following hybridization and washing, blots are Mount and expose to film overnight at -70 ° C and follow standard procedures To develop the film.   The present invention may be practiced other than as specifically described in the foregoing description and examples. Is obvious.   Numerous modifications and variations of the present invention are possible in light of the above teachings, It is within the scope of the appended claims.   The entire disclosure of all publications incorporated herein by reference is incorporated herein by reference. Incorporated as a reference.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C07K 16/28 C07K 16/28 C12N 1/15 C12N 1/15 1/19 1/19 1/21 1 / 21 5/10 C12P 21/02 C C12P 21/02 C12Q 1/68 Z C12Q 1/68 G01N 33/53 D G01N 33/53 M 33/566 33/566 C12P 21/08 // C12P 21/08 C12N 5 / 00 A (81) Designated countries EP (AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AM, AU, BG, BR, BY, CA, CN, CZ, EE, FI, GE, HU, IL, JP, KG, KP, KR , KZ, LT LV, MD, MN, MX, NO, NZ, PL, RO, RU, SG, SI, SK, TJ, TM, TR, UA, US, UZ, VN (72) Inventor Genz, Rainer L. USA Maryland 20904, Silver Spring, Fairland Park Drive 13404 (72) Inventor Leuven, Stephen M. Maryland, United States 20832, Olney, Heritage Hills Drive 18528

Claims (1)

[Claims] 1. A nucleotide that is at least 95% identical to a sequence selected from the group consisting of: Nucleic acid molecule containing a polynucleotide having a nucleotide sequence:   (a) has the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) or has an ATCC accession number No. 98655, full length T1R-like ligand encoded by the cDNA clone contained in A nucleotide sequence encoding a II polypeptide;   (b) has the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) or has an ATCC accession number No. 98655, mature T1R-like ligand encoded by the cDNA clone contained in A nucleotide sequence encoding a II polypeptide;   (c) has the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) or has an ATCC accession number No. 98655, encoded by a cDNA clone contained in T1R-like ligand II A nucleotide sequence encoding an extracellular domain;   (d) has the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) or has an ATCC accession number No. 98655, encoded by the cDNA clone contained in T1R-like ligand II membrane A nucleotide sequence encoding a transduction domain;   (e) has the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) or has an ATCC accession number No. 98655, encoded by a cDNA clone contained in T1R-like ligand II A nucleotide sequence encoding an intracellular domain;   (f) a nucleic acid of any one of the polynucleotides of (a), (b), (c), (d) or (e); A nucleotide sequence that is complementary to an otide sequence. 2. The polynucleotide has all or part of the transmembrane domain deleted. Encoding extracellular and intracellular domains of T1R-like ligand II polypeptides 2. The method of claim 1, wherein the nucleotide sequence is at least 95% identical to the corresponding sequence. Nucleic acid molecules listed. 3. The nucleotide sequence of (a), (b), (c), (d), (e), or (f) according to claim 1. A polynucleotide having the same nucleotide sequence as Isolation involving polynucleotides that hybridize under hybridization conditions A nucleic acid molecule, wherein the hybridizing polynucleotide is a string Under gentle hybridization conditions, only A residue or T residue Does not hybridize to a polynucleotide having the nucleotide sequence of Isolated nucleic acid molecule. 4. The T having the amino acid sequence of (a), (b), (c), (d), or (e) according to claim 1. Encodes the amino acid sequence of the epitope-bearing portion of the 1R-like ligand II polypeptide An isolated nucleic acid molecule, including a polynucleotide. 5. An epitope of a T1R-like ligand II polypeptide selected from the group consisting of: 5. The isolated nucleic acid molecule of claim 4, which encodes a retaining moiety: Figure 1 (SEQ ID NO: 2) a polypeptide comprising about 43 to about 52 amino acid residues; FIG. 1 (SEQ ID NO: 2) A polypeptide comprising 82 to about 98 amino acid residues; about 129 to about 1 in FIG. 1 (SEQ ID NO: 2) A polypeptide comprising 46 amino acid residues; a polypeptide comprising about 162 to about 175 amino acid residues A peptide; and a polypeptide comprising about 181 to about 197 amino acid residues. 6. Inserting the isolated nucleic acid molecule of claim 1 into a vector. , A method for producing a recombinant vector. 7. A recombinant vector produced by the method of claim 6. 8. A method comprising introducing a host cell into the recombinant vector according to claim 7. A method for producing a recombinant host cell. 9. A recombinant host cell produced by the method of claim 8. 10. A recombinant method for producing a polypeptide, wherein the inn according to claim 9 is used. Culturing the main cells under conditions such that the polypeptide is expressed; and A method comprising recovering the polypeptide. 11. An amino acid that is at least 95% identical to a sequence selected from the group consisting of: An isolated T1R-like ligand II polypeptide having the sequence:   (a) shown in FIG. 1 (SEQ ID NO: 2) or included in ATCC Accession No. 98655 Amino acids of full-length T1R-like ligand II polypeptide encoded by a cDNA clone Acid sequence;   (b) shown in FIG. 1 (SEQ ID NO: 2) or included in ATCC Accession No. 98655 Amino acid of mature T1R-like ligand II polypeptide encoded by cDNA clone Acid sequence;   (c) shown in FIG. 1 (SEQ ID NO: 2) or included in ATCC Accession No. 98655 Amino acids in the extracellular domain of the T1R-like ligand II polypeptide encoded by the cDNA No acid sequence;   (d) shown in Figure 1 (SEQ ID NO: 2) or included in ATCC Accession No. 98655 T1R-like ligand II polypeptide encoded by cDNA No acid sequence;   (e) shown in FIG. 1 (SEQ ID NO: 2) or included in ATCC Accession No. 98655 T1R-like ligand II polypeptide encoded by cDNA No acid sequence;   (f) as shown in FIG. 1 (SEQ ID NO: 2) or included in ATCC Accession No. 98655 T1R-like ligand II polypeptide extracellular domain encoded by cDNA and The amino acid sequence of the intracellular domain, wherein all or part of the transmembrane domain is missing. Missing amino acid sequence; and   (g) an antibody to any one of the polypeptides of (a), (b), (c), (d), (e), or (f). Amino acid sequence of pitope-bearing part. 12. An isolated polyprotein comprising an epitope-bearing portion of a T1R-like ligand II protein An isolated polypeptide, wherein said moiety is selected from the group consisting of: Peptide: a polypeptide comprising about 43 to about 52 amino acid residues of FIG. 1 (SEQ ID NO: 2); 1 (SEQ ID NO: 2) comprising about 82 to about 98 amino acid residues; No. 2) a polypeptide comprising about 129 to about 146 amino acid residues; A polypeptide comprising an amino acid residue; and a polypeptide comprising from about 181 to about 197 amino acid residues. peptide. 13. Specifically binds to the T1R-like ligand II polypeptide of claim 11, An isolated antibody. 14． Treating individuals with a need for increased levels of T1R-like ligand II activity A method comprising: wherein the individual comprises the isolated polypeptide of claim 11. Administering a substance. 15. Treating individuals with a need for reduced levels of T1R-like ligand II activity A method comprising administering to said individual a composition comprising the isolated antibody of claim 13. A method comprising the steps of: 16. Methods that are useful during the diagnosis of a disorder:   (a) measuring the T1R-like ligand II gene expression level in the cells or body fluids of the individual Step;   (b) the T1R-like ligand II gene expression level of the individual and the standard T1R-like ligand II Gene expression level, thereby comparing T1R-like ligand II An increase or decrease in offspring expression levels is indicative of a T1R-like ligand II-related disorder. Process A method comprising: