CN1216994A - Apoptosis inducing molecule II - Google Patents

Abstract

The present invention relates to a novel member of the TNF-Ligand superfamily, Apoptosis Inducing Molecule II (AIM II). In particular, isolated nucleic acid molecules are provided encoding the human AIM II protein. AIM II polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of AIM II activity. Also provided are therapeutic methods for treating lymphadenopathy, autoimmune disease, graft versus host disease, and to inhibit neoplasia, such as tumor cell growth.

Description

Apoptosis inducing molecule II

Invention field

The present invention relates to a newcomer of TNF-aglucon superfamily.Specifically, the invention provides the isolated nucleic acid molecule of coding people's apoptosis inducing molecule II (Apoptosis Inducing Molecular II, AIM II).The present invention also provides AIM II polypeptide, and carrier, host cell and the recombination method of producing this polypeptide.The invention still further relates to the screening method of identifying active agonist of AIM II and antagonist.The methods of treatment that the present invention also provides treatment lymphadenopathy, autoimmune disease, graft versus host disease and suppressed tumour such as growth of tumour cell.

Background technology

Huamn tumor necrosis factory alpha (TNF-α) and β (TNF-β, or lymphotoxin) is a relevant member in the big class of polypeptide reporter molecule, such polypeptide reporter molecule comprises Interferon, rabbit, interleukin-and somatomedin, be generically and collectively referred to as cytokine (Beutler B. and Cerami A., Annu.Ret.Immunol., 7:625-655 (1989)).

Tumour necrosis factor (TNF-α and TNF-β) is because its anti-tumor activity effect and found at first, yet it is counted as a kind of multiple-effect cytokine at present, has the various biological activity, comprise the apoptosis that participates in some transformation cell lines, the activation and the propagation of mediated cell, and in immunoregulation and inflammation, also play an important role.

Up to now, the known member of TNF-aglucon superfamily has: TNF-α, TNF-β (lymphotoxin-α), LT-β, OX40L, Fax aglucon, CD30L, CD27L, CD40L and 4-IBBL.The aglucon of TNF aglucon superfamily is the molecule of tart, similar TNF, has at ectodomain that about 20% (the bioactive type of its tool is tripolymer/multimeric complexes for scope, sequence homology 12%-36%), and mainly existing with film combining form.(general summary is seen Gruss H. and Dower S.K., blood, 85 (12): 3378-3404 (1995)) at present only to identify the soluble form of TNF aglucon superfamily from TNF, LT α and Fas aglucon.Introduce this document as a reference in full herein.

These protein participate in the regulation and control of cell proliferation, activation and atomization, comprise survival or death (Armitage R.J., Curr.Opin.Immunol., 6:407 (1994) and Smith C.A. by apoptosis or cytotoxicity control cell, cell, 75:959 (1994)).

Mammiferous growth depends on the propagation and the differentiation of cell, and the programmed cell death that takes place in the apoptosis process (Walker etc., Methods Achiev.Exp.Pathol., 13:18 (1988).Apoptosis plays important effect in the destructive process of the immune thymocyte of identification autoantigen.The inefficacy of normal exclusion process may in autoimmune disease, have certain effect (Gammon etc., today immunology, 12:193 (1991)).

Itoh etc. (cell, 66:233 (1991)) have described a kind of cell-surface antigens-Fas/CD95.It mediates apoptosis, participates in the clonal deletion of T-cell.Fas is having expression in activated T-cell, B-cell and neutrophil and thymus gland, liver, heart, the lung.Fas is except expressing in activated T-cell, B-cell and neutrophil, and its also expresses (Watanate-Fukunaga etc., Journal of Immunology, 148:1274 (1992)) in the adult mice ovary.In the experiment that the monoclonal antibody of Fas and Fas is crosslinked, can cause apoptosis (Yonehara etc., The Journal of Experimental Medicine, 169:1747 (1989); Trauth etc., science, 245:301 (1989)).In addition, have example to show, being combined with of monoclonal antibody and Fas may stimulate T-cell (Alderson etc., The Journal of Experimental Medicine, 178:2231 (1993)) under certain condition.

Fas antigen is a kind of cell surface protein, and common phase is 45kd to molecular weight.The Fas gene of people and mouse is by (Journal of Immunology, (cell, 66:233 (1991) clones such as 148:1274 (1992) and Itoh such as Watanabe-Fukunaga.The protein of two kinds of coded by said gene is transmembrane protein, have structural homology with nerve growth factor/tumor necrosis factor receptor super family, described superfamily comprises two kinds of TNF acceptors, low affinity trk C and LT beta receptor CD40, CD27, CD30 and OX40.

Recently the existing description of Fas aglucon (Suda etc., cell 75: II 69 (1993)).Its aminoacid sequence shows that the Fas aglucon is the II type transmembrane protein that belongs to TNF family.The Fas aglucon is expressed in splenocyte and thymocyte, and purified Fas aglucon molecular weight is 40kd.

Recently, proved that interaction between the Fas/Fas aglucon is apoptosis process necessary (Ju etc., nature, the 373:444 (1995) behind the t cell activation; Brunner etc., nature, 373:441 (1995)).But lip-deep these the two kinds of protein of the activation inducing cell of T cell, the interaction between aglucon and acceptor has subsequently caused the apoptosis of cell.Prove that thus in normal immunoreaction, Fas/Fas aglucon interaction institute inductive apoptosis process may have certain regulating and controlling effect.

According to structure and similarity biologically, polypeptide of the present invention has been accredited as a newcomer of TNF aglucon superfamily.

Obviously, should there be some factors, they are adjustable normal and paracytic activation and differentiation.Therefore, be necessary to identify and be characterized in this class factor of regulating and control normal and paracytic activation and differentiation under normal and the morbid state.Specifically, be necessary to separate and identify other the Fas aglucon of control programming cell death with treatment autoimmune disease, graft versus host disease and lymphadenopathy.

Summary of the invention

The invention provides the isolated nucleic acid molecule of the polynucleotide that contain coding AIM II polypeptide, described AIM II polypeptide has aminoacid sequence shown in Figure 1A-C (SEQ ID NO:2) or by the coded aminoacid sequence of cDNA clone that is preserved in host bacterium, this host bacterium has carried out preservation on August 22nd, 1996 with ATCC preserving number 97689.

The present invention also relates to contain isolated nucleic acid molecule of the present invention recombinant vectors, contain the host cell of described recombinant vectors, and prepare described carrier and host cell and utilize their to produce the method for AIM II polypeptide or peptide by recombinant technology.

The present invention also provides the isolating AIM II polypeptide that has by the aminoacid sequence of polynucleotide encoding described herein.

Term used herein " AIM II " polypeptide comprises the protein of the membrane bound protein that kept AIM II polypeptide active (contain a tenuigenin structural domain, a membrane spaning domain, and an ectodomain) and brachymemma thereof.In one embodiment, solubility AIM II polypeptide contains all or part of ectodomain of AIM II albumen, strides the film district but lack described polypeptide to be remained on the cytolemma.As long as solubility AIM II albumen can be secreted out, it also can contain part and stride film district or part cytoplasmic structure territory or other sequence.This solubility AIM II polypeptide one section allos signal peptide can be blended in the N-end of solubility AIM II polypeptide, so that can be secreted out when expressing.

The present invention also provides the AIM II polypeptide that can be used for treating lymphadenopathy, autoimmune disease and graft versus host disease, people AIM polypeptide particularly, described AIM II polypeptide can be used for stimulating peripheral tolerance, destroys some transformation cell lines, mediated cell activation and propagation, also can be used as the elementary reporter molecule of immunomodulatory and inflammatory reaction on function.

The present invention also provides the composition that contains AIM II polynucleotide or AIM II polypeptide, and described composition can be applied to cell in vitro, (ex vivo) cell and the cells in vivo that exsomatize, and maybe can be applied to multicellular organisms.In this respect in some particularly preferred embodiment, contain AIM II polynucleotide in the said composition, in the present invention so that in host living beings, express the AIM II polypeptide that is used for the treatment of disease.Thus, particularly preferably in expressing in the patient body, so that treatment and the unusual relevant disease of AIM II endogenous activity.

The present invention also provides and has identified the screening method that can strengthen or suppress by the compound of AIM II institute inductive cell response, this screening method comprises that the cell that will express the AIM II contacts with candidate compound, test cell is reacted and this cell response and standard cell lines reacting phase is compared that described standard is to measure under the contact of not having this candidate compound; Thus, cell response shows then that than the standard enhancing this compound is an agonist, and cell response shows then that than the standard reduction this compound is an antagonist.

On the other hand, the invention provides the shaker test of AIM II agonist and antagonist.Antagonist can be used for preventing activation, graft-host's rejection, bone resorption, rheumatoid arthritis and the emaciation (becoming thin or malnutrition) of septic shock, inflammation, cerebral malaria, HIV virus.

The present invention relates to the methods of treatment of the active individuality of AIM II in the higher levels of body of needs on the other hand, and described method comprises uses the composition that separates AIM II polypeptide or its agonist of the present invention that contains the treatment effective dose to this class individuality.

The present invention also relates to the methods of treatment of the active individuality of AIM II in the lower level body of needs on the other hand, and described method comprises uses the composition that contains the AIM II antagonist for the treatment of effective dose to this class individuality.

The accompanying drawing summary

Figure 1A-C shows the nucleotide sequence (SEQ ID NO:1) of AIM II and the aminoacid sequence (SEQ ID NO:2) of inferring.The molecular weight that this protein is inferred is approximately 26.4kDa.The membrane spaning domain that AIM II albumen is inferred is represented with underscore.

Fig. 2 A-F shows the similar district between the aminoacid sequence of AIM II albumen and humanTNF-(SEQ ID NO:3), people TNF-β (SEQ ID NO:4), human lymphocyte toxin (SEQ ID NO:5) and people Fas aglucon (SEQ ID NO:6).

Fig. 3 A-F shows AIM II amino acid sequence analysis.α, β, corner and the district of curling have been illustrated among the figure; Wetting ability and hydrophobicity; Amphiphilic district, flex region; Antigenicity exponential sum surface possibility.In " antigenicity index-Jameson-Wolf " chart, about 13-20,23-36,69-79,85-94,167-178,184-196,221-233 amino acids are corresponding to demonstrating high antigenic zone in the AIM II albumen among Figure 1A-C.

Detailed Description Of The Invention

The invention provides the isolated nucleic acid molecule of the polynucleotides that contain coding AIM II polypeptide, this nucleic acid molecules checks order by the cDNA to the clone and measures, and described AIM II polypeptide has amino acid sequence shown in Figure 1A-C (SEQ ID NO:2). AIM II albumen of the present invention and humanTNF-α (SEQ ID NO:3), people TNF-β (SEQ ID NO:4), human lymphocyte toxin (SEQ ID NO:5) and people Fas aglucon (SEQ ID NO:6) have sequence homology (Fig. 2 A-F). Nucleotide sequence shown in Figure 1A-C is obtained from cDNA clone's sequencing result, described cDNA is cloned in and was preserved in American type culture collection, 12301 Park Lawn Drive, Rockville on August 22nd, 1996, Maryland 20852, and preserving number is 97689. This preservation the clone be contained in pBluescript SK (-) plasmid (Stratagene, La Jolla, CA).

Unless otherwise indicated, all nucleotide sequences that this paper is determined by the dna molecular order-checking all are to utilize automation dna sequencing instrument (such as Applied Biosystems, Inc. 373 types) measure, all amino acid sequences of the polypeptide that the dna molecular of being measured by this paper is coded are all translated the above-mentioned dna sequence dna of measuring and are inferred. Therefore, as known to any dna sequence dna that this area is measured Automation Approach thus, all may there be some mistakes in any nucleotide sequence that this paper measures. Usually have an appointment at least between the nucleotide sequence of measuring by Institute of Automation and the true nucleotide sequence of sequenced dna molecule 90% homogeneity, more generally have an appointment at least 95 % extremely at least about 99.9% homogeneity. Can measure more accurately true sequence by other approach, these approach comprise manual dna sequencing known in the art. This area is also known, compare with true sequence, move frame when single insertion or disappearance can cause the nucleotide sequence translation in the nucleotide sequence of measuring, therefore cause beginning fully different with amino acid sequence by the true coding of sequenced dna molecule from this class insertion or missing point by the coded speculating acid sequence of the nucleotide sequence of measuring.

The information of utilizing this paper to provide, such as the nucleotide sequence among Figure 1A-C, the gram by standard falls and screening technique, employed method when using mRNA as parent material clone cDNA, the nucleic acid molecules of the present invention of the AIM II polypeptide that might obtain to encode. As described herein, nucleic acid molecules described in Figure 1A-C (SEQ ID NO:1) is found in the cDNA library from human macrophage ox LDL (HMCCB64). In from the cDNA library of activating T cell (HT4CC72), also identify this gene. The nucleotide sequence that AIM II cDNA measures among Figure 1A-C (SEQ ID NO:1) contains the ORFs of the protein of 240 amino acid residues of encoding, its initiation codon that has is arranged in Figure 1A-C (SEQ ID NO:1) nucleotide sequence 49-51 position, ectodomain contains among Figure 1A-C (SEQ ID NO:2) the about the 60th to about the 240th amino acid residue, membrane spaning domain contains among Figure 1A-C (SEQ ID NO:2) the about the 37th to about the 59th amino acid residue, born of the same parents' intracellular domain contains among Figure 1A-C (SEQ ID NO:2) by the about the 1st to about the 36th amino acid residue, infers the about 26.4kDa of its molecular weight. The amino acid sequence of AIM II albumen and people Fas aglucon (Fig. 2 A-F) has about 27 % homogeneity and about 51% similitude shown in Figure 1A-C (SEQ ID NO:2), has about 26% homogeneity and about 47% similitude with humanTNF-α's (Fig. 2 A-F) amino acid sequence.

As a those of ordinary skill, will be understood that the supposition AIM II polypeptide coded by the cDNA of preservation contains about 240 amino acid owing to there is the wrong possibility of order-checking discussed above, but amino acid no may be 230-250. Should be understood that further that according to employed standard the born of the same parents of AIM II polypeptide are outer, born of the same parents are interior and may there be fine difference in definite site membrane spaning domain. May have small difference (may be between about the 1st to 5 residue " drift " such as concrete site) owing to being used for limiting this regional standard such as the definite site of AIM II ectodomain among, Figure 1A-C (SEQ ID NO:2).

As mentioned above, nucleic acid molecules of the present invention can be rna form, such as mRNA, or dna form, comprise such as cDNA and genomic DNA by clone or synthetic generation. DNA can be two strands or strand. Single stranded DNA or RNA can be coding strand (also claiming to be sense strand), also can be noncoding strands (being also referred to as antisense strand).

The nucleic acid molecules of " separation " means isolated nucleic acid molecules-DNA or RNA from its natural surroundings. For example, for the object of the invention, also regard the recombinant DNA molecules that is contained in the carrier as " separation ". Other example of the dna molecular that separates comprises the purifying that is present in the intracellular recombinant DNA molecules of heterologous host or exists with solution state (part or basically) DNA molecule. The RNA molecule that separates comprises the interior or external rna transcription of the body of dna molecular of the present invention originally. According to the present invention, the nucleic acid molecules of separation also comprises synthetic this quasi-molecule of producing.

Isolated nucleic acid molecule of the present invention comprises the dna molecular that contains ORFs (ORF) shown in Figure 1A-C (SEQ ID NO:1); The dna molecular that contains AIM II albumen coded sequence shown in Figure 1A-C (SEQ ID NO:2); And contain and above-mentioned sequence different but because the dna molecular of the sequence of genetic code degeneration and the AIM II albumen of still encoding basically. Certainly, genetic code is well known in the art. Therefore, to those skilled in the art, the method that produces this class degeneracy variant is very conventional.

On the other hand, the invention provides the isolated nucleic acid molecule of coding AIM II polypeptide, described AIM II polypeptide has the coded amino acid sequence of cNDA clone, and this cDNA clone is arranged in the plasmid of on August 22nd, 1996 with 97689 preservations of ATCC preserving number. Preferably, this nucleic acid molecule encoding is by the coded polypeptide of above-mentioned preservation cDNA clone. The present invention also provides the nucleotide sequence shown in (SEQ ID NO:1) that has Figure 1A-C or has had the isolated nucleic acid molecule that the nucleotide sequence of contained AIM II cDNA is cloned in above-mentioned preservation, or has the nucleic acid molecules with the complementary sequence of one of above-mentioned sequence. Molecule, especially dna molecular that this class is separated can effectively be used as probe, carry out gene mapping by Chromosomal in situ hybridization, and by detect the expression of AIM II gene in people's tissue such as the Northern engram analysis.

The present invention also relates to the fragment of isolated nucleic acid molecule as herein described. The fragment that has the nucleotide sequence of preservation cDNA or have an isolating nucleic acid of nucleotide sequence shown in Figure 1A-C (SEQ ID NO:1) mean as described herein can be effectively as the length of diagnostic probe and primer at least approximately 15nt, more preferably at least about 20nt, more more preferably at least about 30nt even more preferably at least about the fragment of 40nt. Certainly, according to the present invention, the more large fragment of 50-1500nt length also is useful, and the fragment consistent with the nucleotide sequence overwhelming majority (if not whole words) shown in preservation cDNA or Figure 1A-C (SEQ ID NO:1) is useful equally. For example, length means the fragment of 20 or the more continuous bases in the nucleotide sequence that contains preservation cDNA or the source of the nucleotide sequence shown in Figure 1A-C (SEQ ID NO:1) at least about the fragment of 20nt.

Preferred nucleic acid fragment of the present invention comprises the nucleic acid molecules that contains the zone of epi-position in the coding AIM II albumen. Specifically, this class nucleic acid fragment of the present invention comprises the nucleic acid molecules of the following polypeptide of encoding: contain about the 13rd polypeptide to about the 20th amino acids residue among Figure 1A-C (SEQ ID NO:2); Contain about the 23rd polypeptide to about the 36th amino acids residue among Figure 1A-C (SEQ ID NO:2); Contain about the 69th polypeptide to about the 79th amino acids residue among Figure 1A-C (SEQ ID NO:2); Contain about the 85th polypeptide to about the 94th amino acids residue among Figure 1A-C (SEQ ID NO:2); Contain about the 167th polypeptide to about the 178th amino acids residue among Figure 1A-C (SEQ ID NO:2); Contain about the 184th polypeptide to about the 196th amino acids residue among Figure 1A-C (SEQ ID NO:2); And contain among Figure 1A-C (SEQ ID NO:2) the 221st to the polypeptide of about the 233rd amino acids residue. The inventor has measured the antigenicity zone that the aforementioned polypeptides fragment all is AIM II albumen. Describe in detail to measure below other the method in the zone that contains epi-position of AIM II albumen.

According to the present invention, AIM II polynucleotide can be used in the multiple application, have especially utilized in the application of chemistry and biology characteristic of AIM II.These application relate to autoimmune disease and abnormal cell proliferation.Some other application relates to unusual diagnosis of cell, tissue and organism and treatment.

The present invention also relates to AIM II polynucleotide are used to detect the purposes of complementary polynucleotide chain, for example as diagnostic reagent.Detection to the AIM II mutant form relevant with dysfunction will provide a kind of diagnostic tool, and this diagnostic tool can strengthen or limit and results from the AIM II and cross in the diagnosis of the low disease of expressing, cross high expression level or unconventionality expression or disease susceptibility (as autoimmune disease).Because AIM II gene is present in the kinds of tumor cells system, comprises pancreatic neoplasm, tumor of testis, endometrial tumors and T cell lymphoma, therefore, the polynucleotide of coding AIM II also can be used as diagnostic flag to detect polypeptide expression of the present invention.

On the other hand, the invention provides the isolated nucleic acid molecule that contains certain polynucleotide, these polynucleotide under stringent hybridization condition with above-mentioned nucleic acid molecule of the present invention (as the contained cDNA clone of ATCC preserving number 97689) in the polynucleotide section can hybridize." stringent hybridization condition " means in containing the solution of following compositions in 42 ℃ of incubated overnight: 50% methane amide, 5 * SSC (150mM NaCl, the 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5 * Denhardt ' s solution, the salmon sperm DNA through shearing of 10% T 500 and 20g/ml sex change washs filter membrane down in about 65 ℃ subsequently in 0.1 * SSC.

Can mean with the polynucleotide of " section " of polynucleotide hybridization one with the standard polynucleotide in about at least 15 Nucleotide (nt), more preferably at least about 20nt, more more preferably at least about 30nt even the more preferably polynucleotide (DNA or RNA) that can hybridize of the section of about 30-70nt.Discuss in detail as mentioned and hereinafter, they can effectively be used as diagnostic probe and primer.

For example, the section of the polynucleotide of " length is at least 20nt " means 20 or more a plurality of continuous nucleotide in the nucleotide sequence that derives from standard polynucleotide (nucleotide sequence shown in the cDNA of preservation or Figure 1A-C (SEQ ID NO:1)).

Certainly, only the polynucleotide that can hybridize with the complementary extended chain of poly A sequence (shown in Figure 1A-C (SEQ ID NO:1) 3 ' terminal poly (A) of AIM II cDNA district) or T (or U) residue and being not included in are used in the polynucleotide of the present invention with the hybridization of nucleic acid segment of the present invention, and this is because this polynucleotide molecule and any nucleic acid molecule (cloning as any double-stranded cDNA in the reality) of containing poly (A) extended chain or its complementary segment can both be hybridized.

As described herein, the nucleic acid molecule of the present invention of coding AIM II polypeptide can include, but are not limited to following nucleic acid molecule: those nucleic acid molecule of the aminoacid sequence of coding said polypeptide; Polypeptid coding sequence and other sequence are as the sequence of coding leader sequence or secretion sequence (as preceding albumen or proteinogen or preproprotein sequence); Contain or do not contain the polypeptid coding sequence of aforesaid other encoding sequence, described polypeptid coding sequence also contains other non-coding sequence, including, but not limited to as intron, 5 ' and 3 ' non-coding sequence (, comprise and shearing and polyadenylation signal) as having in shearing with mRNA as the transcribing but the sequence do not translated of functions such as binding ribosomal body, stable mRNA transcribing; Encode other amino acid as amino acid whose other encoding sequence of other function is provided.Therefore, the sequence of this polypeptide of encoding can merge with flag sequence, and described flag sequence for example is the sequence of polypeptide that coding can be simplified the purifying of fusion polypeptide.In the present invention's some preferred embodiment in this respect, marker amino acid sequence is six-Histidine peptide, as the pQE carrier (Qiagen, the mark that provides on Inc.), most commercially available in this class peptide.For example, as Gentz etc., institute of NAS newspaper, 86:821-824 (1989) is described, and the existence of six-Histidine is convenient to fusion rotein is carried out purifying." HA " mark is another peptide that can be effective to purifying, and this " HA " mark is corresponding to the epi-position in influenza hemagglutinin protein source, and this epi-position has been described in Wilson etc., cell, 37:767 (1984).As mentioned below, other this class fusion rotein is included in the AIM II that N-terminal or C-terminal and Fc merge.

Nucleic acid molecule of the present invention comprises that also coding lacks the nucleic acid molecule of the total length AIM-II polypeptide of the terminal methionine(Met) of N-.

The invention still further relates to the variant of nucleic acid molecule of the present invention, the proteic section of these variant coding AIM II, analogue or derivative.Variant can be naturally occurring, as natural allele variant.One " allele variant " means one of some kinds of variant forms that are arranged in certain gene of specific site on certain organism bar karyomit(e) (gene II, Lewin B. volume, JohnWiley﹠amp; Sons, New York (1985)).The variant that non-natural exists can utilize the prominent technology generation that causes known in the art.

This class variant comprises the nucleic acid molecule that the Nucleotide that can relate to one or more Nucleotide replaces, lacks or add and produces.Change can all take place in these variants in coding region, non-coding region or two kinds of zones.Change in the coding region can produce conservative or nonconservative aminoacid replacement, disappearance or interpolation.Preferred especially reticent replacement, interpolation and disappearance during these change, they do not change the character and the activity of AIM II albumen or its section.Thus, also preferred especially conservative the replacement.

Comprise in another embodiment of the present invention and contain certain polynucleotide and isolated nucleic acid molecule, the identity of one of these polynucleotide and following nucleotide sequence is at least 90%, more preferably be at least 95%, 96%, 97%, 98% or 99%:(a) coding has among Figure 1A-C (SEQ IDNO:2) all nucleotide sequences of the AIM II polypeptide of aminoacid sequences; (b) coding has the nucleotide sequence of the AIM II polypeptide of the coded whole aminoacid sequences of cDNA clone, and this cDNA clone is contained in the ATCC preserving number 97689; (c) nucleotide sequence of coding AIM II polypeptide ectodomain; (d) nucleotide sequence of coding AIM II polypeptide membrane spaning domain; (e) nucleotide sequence of coding AIM II polypeptide born of the same parents intracellular domain; (f) nucleotide sequence of coding solubility AIM II polypeptide, this solubility AIM II polypeptide has the outer and born of the same parents' intracellular domain of born of the same parents, but lacks membrane spaning domain; And (g) and above-mentioned (a) and (b), (c), (d), (e) or (f) in any nucleotide sequence complementary nucleotide sequence.

For example, containing the nucleotide sequence and the standard sequence that mean described polynucleotide with polynucleotide that the standard nucleotides sequence of coding AIM II polypeptide has a nucleotide sequence of at least 95% " identity " is identical haply, and just this polynucleotide sequence can contain in per 100 Nucleotide in the standard nucleotides sequence of AIM II polypeptide of encoding and is no more than 5 point mutation.In other words, in order to obtain to contain the polynucleotide that have the nucleotide sequence of at least 95% identity with the standard nucleotides sequence, being no more than 5% Nucleotide in the standard sequence can lack or be replaced by other Nucleotide; Or, in standard sequence, can insert and account for the Nucleotide that standard sequence total nucleic acid number is no more than 5% number.These sudden changes of standard sequence can occur in 5 of standard nucleotides sequence ' or 3 ' terminal position, also can occur between these terminal positions Anywhere, they or between standard sequence inner nucleotide sequence, disperse to exist, or in standard sequence with one or several continuously forms of group exist.

As a real work, whether arbitrary specific nucleic acid molecule and the nucleotide sequence shown in Figure 1A-C or preservation cDNA clone's nucleotide sequence has at least 90%, 95%, 96%, 97%, 98% or 99% identity can be utilized routinely as Bestfit program (Wisconsin Sequence Analysis Package, 575 Science Drive, Madison, WI 53711) etc. the known computer program measure.The Bestfit program has been used Smith and Waterman, the applied mathematics progress, and local homology's algorithm of 2:482-489 (1981) is to seek the best section of tool homology between two sequences.When utilizing Bestfit or other any sequence comparison program to determine whether a certain particular sequence and standard sequence of the present invention have at least as 95% identity, yes in order to ensure identity per-cent is that the total length of relative standard's nucleotide sequence is calculated in the setting of parameter, and also allow to exist the Nucleotide sum that accounts for standard sequence to be no more than 5% homology breach.

Whether present patent application relates to and nucleotide sequence shown in Figure 1A-C (SEQ ID NO:1) or the nucleic acid molecule that has 90%, 95%, 96%, 97%, 98% or 99% identity with the nucleotide sequence of preservation cDNA at least, and do not need to ask these nucleic acid molecule to encode to have the active polypeptide of AIM II.Even this is that those skilled in the art also should know how to utilize these nucleic acid molecule because a certain specific nucleic acid molecule is not encoded and had the active polypeptide of AIM II, as being used as hybridization probe or polymerase chain reaction (PCR) primer.The nucleic acid molecule with the active polypeptide of AIM II of not encoding among the present invention comprises following application: (1) separates AIM II gene or its allele variant from the cDNA library; (2) as Verma etc., " human chromosomal: the basic technology handbook, Pergamon press, New York (1988) are described, carry out in situ hybridization (as " FISH ") to carry out the accurate chromosomal localization of AIM II gene with Metaphase Chromosome; And the Northern engram analysis is to detect AIM mRNA expression in the specific tissue.

Yet preferred nucleic acid molecule is to have the sequence of at least 90%, 95%, 96%, 97%, 98% or 99% identity between the nucleotide sequence that has with nucleotide sequence shown in Figure 1A-C (SEQ ID NO:1) or preservation cDNA and the nucleic acid molecule of the polypeptide with AIM II protein-active of encoding really." have the active polypeptide of AIM II " and mean by the particular biological test, have similar to AIM II protein-active of the present invention but need identical active polypeptide.For example, as Zarres etc., cell, 70:31-46 (1992) is described, and AIM II albuminous cell cytotoxic activity can be measured by propidium iodide staining analysis apoptosis situation.Perhaps, also can be by Gavierli etc., the cytobiology magazine, AIM II inductive apoptosis is measured in the described TUNEL dyeing of 119:493-501 (1992).

In brief, the painted operation of propidium iodide is as follows: will organize or the cell in culture source fixing in formaldehyde, make frozen section, dye with propidium iodide again.Utilizing altogether, collection point fluorescent microscope can be observed nucleus by propidium iodide.By pyknotic nucleus (fragmentation of chromosome condensation, shrinkage and/or nuclear) the necrocytosis situation can be shown.

Certainly, because the degeneracy of genetic code, those of ordinary skills can understand very soon, contain also the encode polypeptide of " having AIM II protein-active " of a large amount of nucleic acid molecule that nucleotide sequence or the nucleotide sequence shown in Figure 1A-C (SEQ ID NO:1) with preservation cDNA have the sequence of at least 90%, 95%, 96%, 97%, 98% or 99% identity.In fact, the same protein because the degeneracy variant of these nucleotide sequences is all encoded, even do not carry out above-mentioned contrast test, those skilled in the art also know this point.Those skilled in the art also understand, are not the nucleic acid molecule of degeneracy variant for those, and quite a few also can be encoded and have the polypeptide of AIM II protein-active.This is because those skilled in the art understand the aminoacid replacement (for example, a kind of aliphatic amino acid is replaced by another kind of aliphatic amino acid) of those few possibilities or unlikely remarkably influenced protein active fully.

For example, Bowie J.U. etc., " information in the decipher protein sequence: the tolerance of aminoacid replacement ", science, put down in writing relevant rule how not have the aminoacid replacement of phenotype variation among the 247:1306-1310 (1990), wherein the author points out that protein unexpectedly can tolerate aminoacid replacement.Carrier and host cell

The present invention also relates to contain the carrier of DNA isolation molecule of the present invention, the host cell that utilizes this recombinant vectors to carry out the genetics operation, and AIM II polypeptide or its segmental production undertaken by recombinant technology.

These polynucleotide can with contain selected marker and couple together with the carrier of in the host, breeding.Usually plasmid vector can be by throw out such as calcium phosphate precipitation thing or the mixture importing host with charged lipid.If carrier is a kind of virus, utilize suitable package cell line it to be wired up external, transduce to host cell again.

DNA inserts fragment and should effectively be connected with suitable promotor, as phage PL promotor, intestinal bacteria lac, trp and tac promotor, SV40 is early stage and late promoter, retrovirus LTR promotor etc.Those skilled in the art also know other suitable promotor.Expression construct also contains transcripting start point, terminating point, and is used to the ribosome bind site translated in the transcriptional domain.The coding section of the ripe transcript of construct expression preferably contains translation initiation sequence at section start thus, contains terminator codon (UAA, UGA or UAG) in the terminal appropriate position of polypeptide to be translated.

As mentioned above, expression vector preferably contains at least one selected marker.This class mark comprises neomycin resistance gene, the dihydrofolate reductase gene that is used for the eukaryotic cell cultivation, is used for the tsiklomitsin or the ampicillin resistance gene of intestinal bacteria and other microbial culture.Suitably host's representative example has bacterial cell such as intestinal bacteria, streptomycete and salmonella typhimurium cell; The fungal cell is as yeast cell; Insect cell is as fruit bat S2 and Spodoptera Sf9 cell; Zooblast is as CHO, COS and Bowes melanoma cells; And vegetable cell, but be not limited to above-mentioned cell.The suitable developing medium and the culture condition of well known above-mentioned host cell.

The preferred vector that is used for bacterium comprises pQE70, pQE60 and the pEQ-9 that can Qiagen obtains; Can be from pBS carrier, Phageseript carrier, Bluescript vector, pNH8A, pNH16a, pNH18A and the pNH46A of Stratagene acquisition; And can be from ptrc99a, pKK223-3, pKK233-3, pDR540 and the pRIT5 of Pharmacia acquisition; Or the like.Preferred eukaryote carrier has can be from pWLNEO, pSV2CAT, pOG44, pXT1 and the pSG of Stratagene acquisition; And can be from pSVK3, pBPV, pMSG and the pSVL of Pharmacia acquisition; Deng.To those skilled in the art, Shi Yi other carrier also is conspicuous.

Can construct be imported host cell by following method: the transfection of calcium phosphate precipitation transfection, the mediation of DEAE-dextran, transfection, electric shocking method, transduction, infection or other method of cation lipoid mediation.These methods have been recorded in the multiple standards laboratory manual, as Davis etc., " molecular biology basic skills " (1986).

Polypeptide can modified forms such as fusion protein form expression, and not only can contain secretion signal, also can contain other heterology functional zone.For example, can contain the particularly charged amino acid whose zone of other amino acid, so that in host cell, in purge process or in subsequently use and storage process, provide stability and persistence terminal interpolation of the N-of polypeptide.In addition, also little peptide can be added in the polypeptide so that purifying, and can be before the preparation eventually of polypeptide this class zone of removal.Little peptide is added in the polypeptide with this class zone of secretion removal.Adding in the polypeptide little peptide with secretion and discharging polypeptide, improve polypeptide stability, make things convenient for the technology of purified polypeptide is the skilled and routine techniques of this area.Preferred fusion protein contains the allos zone that helps the protein dissolved to derive from immunoglobulin (Ig).For example, EP-A-O 464 533 (Canada corresponding number 2045869) discloses the various sections that contain the immunoglobulin molecules constant region and the fusion rotein of other human protein or its part.Under multiple situation, the Fc part in the fusion rotein is that using value is arranged very much in treatment and diagnosis, and can improve as pharmacokinetic properties (EP-A 0 232 262).On the other hand, in some applications, preferably express, detect by the better method of having stated and this fusion rotein of purifying after remove wherein Fc part.When the Fc section is proved for fusion rotein that the application in treatment and diagnosis has undesirable action such as fusion rotein as immunizing antigen, be exactly like this.For example, in the excavation of medicine, human protein such as hIL-5 just merge to reach the heavy body purpose of the shaker test of identifying the hIL-5 antagonist with the Fc section.Referring to D.Bennett etc., the molecular recognition magazine, the 8th volume: 52-58 (1995) and K.Johanson etc., journal of biological chemistry, the 270th rolls up 16 phases: 9459-9471 (1995).

By well-known method, comprise methods such as ammonium sulfate or ethanol sedimentation, acid extraction, negatively charged ion or cation-exchange chromatography, phosphorylated cotton chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite and Sugar receptors chromatography, can from the reconstitution cell culture, reclaim and purifying AIM II polypeptide.In purge process, most preferably use high performance liquid chromatography method (" HPLC ").Polypeptide of the present invention comprises the product of natural purified product, the generation of chemosynthesis approach and comprises the product that produces by recombinant technology as bacterium, yeast, more high plant, insect and mammalian cell etc. from prokaryotic organism or eukaryote host.According to the host type of using in recombinant method for production, polypeptide of the present invention may be by glycosylation, also may be not by glycosylation.In addition, polypeptide of the present invention also may contain the initial methionine residues of having modified, and this is because the process of host's mediation produces under some situation.AIM II polypeptide and fragment

The present invention also provides the separation AIM II polypeptide with the aminoacid sequence among the coded aminoacid sequence of preservation cDNA or Figure 1A-C (SEQ ID NO:2), or contains the peptide or the polypeptide of a section of aforementioned polypeptides.

Some aminoacid sequences that can change AIM II polypeptide are known very well and not remarkably influenced this proteic structure or function in this area.If can anatomize this class sequence difference, should be able to know to have its active important area of decision in the protein.

Therefore, the present invention also comprises the AIM II variant polypeptides that has significant AIM II polypeptide active or contain AIM II albumen zone (protein section described as follows).This class mutant comprises that disappearance, insertion, conversion, repetition and type replace.As mentioned above, relevant which kind of amino acid changes rule that might not have phenotypic difference and is found in Bowie J.U. etc., " information in the decipher protein sequence: to the tolerance of amino acid replacement ", science, 247:1306-1310 (1990).

Therefore, the polypeptide of Figure 1A-C (SEQ ID NO:2) or can be by fragment, derivative or the analogue of preservation cDNA encoded polypeptide: (ⅰ) wherein one or more amino-acid residues are replaced by conservative or nonconservative amino-acid residue (preferred conservative amino-acid residue), and the amino-acid residue of this replacement can be, also can not be by the coded amino acid of this genetic code; Or (ⅱ) wherein one or more amino-acid residues contain substituting group; Or (ⅲ) wherein mature polypeptide merge mutually with the compound (as polyoxyethylene glycol) that another kind of compound if can improve this polypeptide transformation period; Or (ⅳ) wherein merged other amino acid in the mature polypeptide, as IgG Fc corresponding circle of sensation peptide, leader sequence, secretion sequence or can be used for the sequence of mature polypeptide purifying, or the proteinogen sequence.This class fragment, derivative and analogue are also within those skilled in the art's teaching herein scope.

Especially noticeable is that charged amino acid is replaced by the charged amino acid of another kind, neutrality or electronegative amino acid, and the latter can produce with the protein of positive charge still less, thereby can improve the proteic characteristic of AIM II.The utmost point is necessary to avoid agglutination phenomenon.Proteinic aggegation not only can destroy activity, and also can bring big problem (Pinckard etc., clinical experiment immunology, 2:331-340 (1967) owing to having immunogenicity when useful in preparing drug formulations; Robbins etc., diabetes, 36:838-845 (1987)); Cleland etc., Crit.Rev.Therapeutic Drug CarrierSystems, 10:307-377 (1993)).

Amino acid whose displacement also can change the selective binding of polypeptide and cell surface receptor.Ostade etc., nature, described among the 361:266-268 (1993) some sudden change can cause TNF-α only with two kinds of known types of TNF acceptor in a kind of selective binding.Therefore, AIM II acceptor of the present invention can contain one or more aminoacid replacement, disappearance or interpolation, and it can be natural sudden change or manually-operated result that this class changes.

As described, preferably influence less change, replace (seeing Table 1) as not remarkably influenced protein folding or active conserved amino acid.

Table 1 conserved amino acid replaces

Aromatic amino acid	Phenylalanine tryptophane tyrosine
		Hydrophobic amino acid	Leucine Isoleucine Xie Ansuan
Polare Aminosaeren	The glutamine l-asparagine
		Basic aminoacids	Arginine Methionin Histidine
Acidic amino acid	Aspartic acid L-glutamic acid
		P1 amino acid	L-Ala serine threonine methionine(Met) glycine

Pass through means known in the art, as site-specific mutagenesis method or alanine scanning mutagenesis method (Cunningham and Wells, science, 244:1081-1085 (1989)), can identify in the AIM II albumen of the present invention its function amino acid that is absolutely necessary.Back one method is to introduce single alanine mutation at any one residue place of intramolecularly, measures the biologic activity of thus obtained mutant molecule then, and as acceptor binding force, or body is interior or in-vitro multiplication is active.Also can be by structural analysis, as crystallisation process, nucleus magnetic resonance or photoaffinity labeling (Smith etc., molecular biology magazine, 224:899-904 (1992) and deVos etc., science, 255:306-312 (1992)) determine to aglucon-acceptor in conjunction with vital site.

Preferably provide polypeptide of the present invention with unpack format." isolated polypeptide " means the polypeptide that extracts from its natural surroundings.Therefore, for the object of the invention, the interior polypeptide of producing and comprising of recombinant host cell also is considered to " isolating "." isolated polypeptide " also refers in the recombinant host part or the polypeptide of purifying basically.For example, can be by Smith and Hohnson, gene, the basic purification of Recombinant type of production of the described single stage method of 67:31-40 (1988) AIM II polypeptide.

Polypeptide of the present invention comprises the encoded polypeptides by preservation cDNA, the polypeptide of Figure 1A-C (SEQ ID NO:2), the polypeptide that lacks Figure 1A-C (SEQ ID NO:2) of the terminal methionine(Met) of N-, ectodomain, membrane spaning domain, born of the same parents' intracellular domain, contain the outer and born of the same parents' intracellular domain of all or part of born of the same parents but the soluble polypeptide of shortage membrane spaning domain, and and the polypeptide of preservation cDNA encoded polypeptides or Figure 1A-C (SEQ IDNO:2) between identity be at least 80%, more preferably be at least 90% or 95%, more more preferably be at least 96%, 97%, 98% or 99% polypeptide also comprises and contains at least 30 amino acid, the more preferably section of at least 50 amino acid whose these type of polypeptide.

Contain that standard amino acid sequence with AIM II polypeptide has at least as the polypeptide of the aminoacid sequence of 95% " identity " to mean this amino acid sequence of polypeptide basic identical with standard sequence, be that this peptide sequence per 100 amino acid in the standard amino acid of AIM II polypeptide can contain no more than 5 amino acid whose changes.In other words, in order to obtain to contain the polypeptide that has the aminoacid sequence of at least 95% identity with the standard amino acid sequence, can be to being no more than in the standard sequence that 5% amino-acid residue lacks or being replaced by other amino acid; Or, can be no more than the aminoacid insertion of 5% quantity to standard sequence with accounting for the interior total amino acid residue of standard sequence.These changes of standard sequence can be positioned at the amino or the C-terminal position of standard amino acid sequence, but any position between these terminal positions, they or be scattered in separately in the residue of standard sequence, or be present in the standard sequence with the form of one or more continuous groups.

As a real work, can utilize as Bestfit degree (WisconsinSequence analysis Package, 575 Science Drive, Madison, WI53711) etc. the known computer program is measured arbitrary specific polypeptide routinely and is cloned coded aminoacid sequence with aminoacid sequence as Figure 1A-C (SEQ ID NO:2) shown in or preservation cDNA and whether have at least 90%, 95%, 96%, 97%, 98% or 99% identity.Utilize Bestfit or other any sequence comparison program to analyze whether to have between a certain particular sequence and standard sequence of the present invention at least as during 95% identity, yes in order to ensure identity per-cent is to calculate with respect to the total length of standard amino acid sequence in the setting of parameter, and also allow to exist the amino acid sum that accounts for standard sequence to reach 5% homology breach.

Term used herein " AIM II " polypeptide comprises membrane-binding albumen (containing cytoplasmic structure territory, membrane spaning domain and ectodomain), and the truncated protein matter that remains with AIM II polypeptide active.In one embodiment, solubility AIM II polypeptide contains all or part of of AIM II albumen ectodomain, but lacks the TMD that polypeptide can be stranded on the cytolemma.As long as solubility AIM II can be secreted out, it also can contain part membrane spaning domain or parts of fine cytoplasmic structure territory or other sequence.Can be at one section allos signal peptide of the terminal fusion of the N-of solubility AIM II polypeptide, so that after expressing solubility AIM II polypeptide, it is secreted out.

Utilize method well known to those skilled in the art, can be with polypeptide of the present invention as the molecular weight marker on SDS-PAGE gel or the molecular sieve gel filtration column.

On the other hand, the invention provides the peptide or the polypeptide of the section that contains epi-position that contains polypeptide of the present invention.The epi-position of this polypeptide section is the immunogenicity or the antigenic epitopes of polypeptide described herein." immunogenicity epi-position " can cause the protein portion of antibody response when being meant whole protein as immunity, can then be called as " antigenic epitopes " with the zone in the protein molecule of antibodies.The number of immunogenicity epi-position generally lacks than antigenic epitopes in the protein.Referring to as Geysen etc., institute of NAS newspaper, 81:3998-4002 (1983).

As for the selection of the peptide that contains antigenic epitopes or polypeptide (promptly contain in the protein molecule can with the peptide or the polypeptide in the zone of antibodies), the antiserum(antisera) that the very similar relative short synthetic peptide of well known and Partial Protein south sequence generally can stimulate generation can the protein similar to this part to react.Referring to as Sutcliffe H.G., Shinnick T.M., Green N. and Learner R.A. (1983), " antibody that can react with predetermined site in the protein ", science, 219:660-666.How can cause the peptide that produces proteins react serum represents with proteinic primary sequence, they can be determined by the simple chemical rule of a cover, and be not limited to immundominance zone (being the immunogenicity epi-position) or its amino or the C-terminal of whole protein.

Therefore, contain among the present invention the peptide of antigenic epitopes and polypeptide can be effective to preparation can with polypeptid specificity bonded antibody of the present invention, comprise monoclonal antibody.Referring to as Wilson etc., cell, 37:767-778 (1984) is in 777 pages.

The present invention carry the peptide of antigenic epitopes and one section contained sequence of polypeptide be contained in the amino acid sequence of polypeptide of the present invention preferred at least 7, more preferably at least 9, most preferably about at least 15 to about 30 amino acid.

Can be used for preparing the antigenic polypeptide of AIM II specific antibody or the example of peptide includes but are not limited to: as follows: contain about the 13rd the polypeptide of Figure 1A-C (SEQ ID NO:2) to about the 20th amino acids residue; Contain about the 23rd polypeptide among Figure 1A-C (SEQID NO:2) to about the 36th amino acids residue; Contain about the 69th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 79th amino acids residue; Contain about the 85th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 94th amino acids residue; Contain about the 167th polypeptide among Figure 1A-C (SEQ IDNO:2) to about the 178th amino acids residue; Contain about the 184th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 196th amino acids residue; And contain about the 221st polypeptide to about the 233rd amino acids residue among Figure 1A-C (SEQ ID NO:2).As mentioned above, the inventor has determined that the aforementioned polypeptides fragment is the proteic antigenicity of AIM II zone.

Can carry the peptide and the polypeptide of epi-position by any classical pathway production the present invention.Houghten R.A. (1985), " general method of the quick a large amount of polypeptide of solid phase synthesis: the specificity of antigen-antibody reaction on the single amino acids level ", institute of NAS newspaper, 82:5131-5135.This " a plurality of polypeptide simultaneously synthetic (SMPS) " approach is further described in the U.S. Patent number 4,631,211 of Houghten etc.

AIM II polypeptide of the present invention can be used for the treatment of the lymphoproliferative disease that brings out lymphadenopathy.Because the AIM II can pass through to stimulate the clonal deletion and then the mediation apoptosis of T-cell, thereby, the AIM II can be applied to treat autoimmune disease, stimulate peripheral tolerance and the cell-mediated Cytotoxic apoptosis process of tool of T-.Also can be with the AIM II as research tool, to illustrate autoimmune disorder and anaphylactoid biological mechanism, and the treatment graft versus host disease, described autoimmune disorder comprises systemic lupus erythematous (SLE), immunoproliferative disease, lymphadenopathy (IPL), blood vessel immunoproliferating lymphadenopathy (AIL), lymphoblast lymphadenopathy (IBL), rheumatoid arthritis, diabetes and multiple sclerosis.

Also AIM II polypeptide of the present invention can be used for suppressing tumour, as growth of tumour cell.AIM II polypeptide may be by apoptosis with to the cytotoxicity of some cell and play a part certain to the destruction of tumour.Since the propagation of AIM II energy stimulating endothelial derived cell, thereby also the AIM II can be used for the treatment of the disease that some need growth-promoting activity, as the restenosis disease.And the AIM II also can be used for regulating the hemopoietic function in the endotheliocyte growth course.

The present invention also provide identify can with the method for AIM II bonded molecule such as acceptor molecule.By numerous methods well known by persons skilled in the art, select and FACS classifies as aglucon, can identify coding can with the gene of AIM II bonded protein such as receptor protein.In many laboratory manuals such as Coligan etc., immunology modernism, 1 (2): in the 5th chapter (1991), all record these class methods.

For example, for this purpose, can use the cloning by expression method.For reaching this purpose, at first from the cell that the AIM II is had reaction, prepare the RNA of polyadenylation, from then on RNA construction cDNA library is divided into several groups with the library, transforms respectively the unresponsive cell of AIM II again.Then with transformant and mark AIM II combination treatment.(mark of AIM II can be known technology by multiple, comprises that radioiodine handles or comprise standard method such as locus specificity protein kinase recognition site.) after the processing, fixed cell, and measure the combination rate of AIM II.This method can be on slide glass easy carrying out.

Identify each group that contains the cDNA that can produce AIM II associativity cell.These positive components are become subgroup, again the transformed host cell row filter of going forward side by side as stated above.By screening (the sub-pooling and re-screening) process of the inferior grouping of this repeatability-again, separablely go out binding molecule that coding infers such as one or more mono-clonals of acceptor molecule.

Or will carry out the light affinity through the aglucon of mark and cell extract such as film or film extract and be connected, this cell extract be from can express can with the cell of this aglucon bonded molecule such as acceptor molecule prepare.Separate cross-linked material by polyacrylamide gel electrophoresis (" PAGE "), again x-ray film is exposed.Cutting-out contains the labeled complex of aglucon-acceptor, and it is cracked into peptide fragment, carries out the protein microsequencing again.The aminoacid sequence that utilization obtains from the microsequencing result can be designed specificity or degeneracy oligonucleotide probe, so that the cDNA library is screened, and the gene of the acceptor molecule that identifying encodes infers.

Also can be with the ability that is subjected to AIM II associativity molecule that peptide is used for verifying cell or acellular prepared product such as acceptor molecule in conjunction with the AIM II of the present invention.

Those skilled in the art know very well, AIM II polypeptide of the present invention or above-mentioned its can be contained the combined generation chimeric polyeptides of a part of the fragment and immunoglobulin (Ig) (IgG) constant domain of epi-position.This class fusion rotein can be convenient to purifying, and has in vivo the longer transformation period.As the chimeric protein that contains each structural domain in the constant region of preceding two structural domains of people CD4 polypeptide and mammalian immune sphaeroprotein heavy chain or light chain has just embodied These characteristics (EPA394,827; Traunecker etc., nature, 331:84-86 (1988)).The fusion rotein that has the couple structure that disulfide linkage connects owing to IgG part and monomer A IM II albumen or independent protein fragments are compared, the former also can more effective combination and other molecule of neutralization (Fountoulakis etc., journal of biological chemistry, 270:3958-3964 (1995)).

The inventor has been found that the AIM II all has expression in spleen, thymus gland and myeloid tissue.To a series of disorders such as septic shock, inflammation, cerebral malaria, the activation of HIV virus, graft-host's repellency, bone resorption, rheumatoid arthritis and emaciation, at some tissue of the individuality with this class disorder (as spleen, thymus gland and myeloid tissue) or body fluid (as serum, enchylema, urine, synovia or spinal fluid) in, can detect apparently higher than or be lower than the AIM II expression of gene of " standard " AIM II gene expression dose, wherein " standard " AIM II gene expression dose is the expression level of AIM II in the tissue of the individuality with this class disorder or the body fluid.Therefore, the invention provides a kind of diagnostic method very useful in disorderly diagnostic procedure, this method comprises: (a) measure AIM II gene expression dose in individual cell or the body fluid; (b) AIM II gene expression dose and the standard A IM II gene expression dose that records compared, the AIM II gene expression dose that wherein records is higher or lower than the standard expression level and all shows certain disorder of existence.AIM II agonist and antagonist

The present invention also provide SCREENED COMPOUND with identify the effect that can strengthen or prevent AIM II pair cell as with the method for the interactional compound of AIM II associativity molecule (as acceptor molecule).Agonist is to strengthen the compound that AIM II natural biological is learned function or played a role in the mode that is similar to the AIM II; Antagonist then can reduce or eliminate this class function.

For example, can be from expressing in conjunction with the molecule of AIM II as by preparing cellular component the cell of AIM II by the molecule of signal or the regulation and control of adjusting approach, as the membrane prepare thing.Prepared product is incubated with the AIM II of mark lacking or exist under the situation of testing molecule (this testing molecule may be the agonist or the antagonist of AIM II).The reduction level of mark aglucon bonding force has reflected the ability that testing molecule and associativity molecule or AIM II itself combine.Can not induce " gratuitously " molecule of AIM II reaction when combination promptly combines with AIM II associativity molecule most possibly is good antagonist.Fine combination of energy and identical with the AIM II or the closely-related molecule of action effect are good agonists.

For example, measure the activity of second messenger system by the interaction between potential agonist or antagonist and cell or suitable cellular preparations, and with the AIM II or have with the activity of the molecule of AIM II identical function and compare, can measure the AIM II similarity activity of testing molecule.In this respect, effectively second messenger system includes but not limited to AMP guanylate cyclase, ionic channel or phosphoinositide hydrolysis second messenger system.

Another example of AIM II antagonist method of testing is competitive method of testing, and this testing method is to be suitable for competing under the felicity condition that suppresses test, and AIM II and potential antagonist and membrane-bound AIM II acceptor molecule or the AIM II acceptor molecule of recombinating is combined.Can be by the AIM II being carried out mark as radioactive activity etc., so that can accurately measure quantity with acceptor molecule bonded AIM II molecule, thereby estimate the effect of this potential antagonist.

Thereby the potential antagonist comprises combining with polypeptide of the present invention and can suppress or eliminate its more active little organic molecules, peptide, polypeptide and antibody.The potential antagonist also can be can combine with the same loci of associativity molecule such as acceptor molecule and do not induce AIM II inducibility activity thereby suppress some little organic molecules, peptide or the polypeptide of the effect of AIM II by the combination that stops the AIM II, as closely-related protein or antibody.

Other potential antagonist comprises antisense molecule.Can utilize the antisense technology controlling gene to express by antisense DNA or sense-rna or by the triplet spiralization.Antisense technology has been described in as Okano, neurochemistry magazine, 56:560 (1991); " as the oligodeoxynucleotide of genetic expression antisense inhibitor ", CRC Press, BocaRaton, RL (1988).The triplet spiralization is recorded in as Lee etc., nucleic acids research, 6:3073 (1979); Cooney etc., science, 241:456 (1988); And Dervan etc., science, 251:1360 (1991).These methods all are based on combining of polynucleotide and complementary DNA or RNA.For example, can utilize 5 ' coding region of the polynucleotide of code book invention mature polypeptide, the antisense RN oligonucleotide of about 10～40 base pairs of design length.The gene regions complementation that the DNA oligonucleotide is designed to and participates in transcribing, thereby can suppress transcribing and generating of AIM II.MRNA hybridization in antisense rna oligonucleotide and the body, thus blocking-up mRNA molecule is translated as the process of AIM II polypeptide.Also above-mentioned oligonucleotide can be directed in the cell so that express this sense-rna or DNA in vivo, thereby suppress the generation of AIM II.

Antagonist can be made composition with pharmaceutical carrier (as described later) uses.

For example, antagonist can be used for the treatment of emaciation, this disease is because the systematicness of lipoprotein lipase lacks the lipoid removal of defects that causes, and it is said that this lipoprotein lipase can be suppressed by the AIM II.Also AIM II antagonist can be used for the treatment of cerebral malaria, the AIM II may have the pathology effect in this disease.Also can use this antagonist for treating is rheumatoid arthritis, and this is to be undertaken by the generation that suppresses the IL1 in AIM II inductive inflammatory factor such as the synovial cell.When treatment of arthritis, preferably AIM II antagonist is injected intraarticular.

Also can utilize AIM II antagonist, the graft-host's rejection that takes place when stoping immune stimulation to prevent graft to exist.

Also can utilize AIM II antagonist to suppress bone resorption, thereby treat and/or prevent osteoporosis.

Also antagonist can be used as anti-inflammatory agent, and the treatment endotoxin shock.This precarious position results from bacterium or other type is infected the extraordinary reaction of making.The cancer prediction

Compare with corresponding " normally " Mammals, suffer from mammiferous some tissue expression AIM II albumen of cancer and the level of the proteic mRNA of coding AIM II and significantly reduce.Normal mammalian promptly is meant and suffers from the not cancered individuality that the cancer Mammals belongs to same kind.In addition, and belong to same kind but not cancered mammiferous serum is compared, the AIM II level that measures in suffering from mammiferous some body fluid (as serum, kytoplasm, urine and spinal fluid) of cancer obviously reduces.Therefore, the invention provides the diagnostic method that in diagnosing tumor, effectively to use, this method comprises the proteic expression of gene level of coding AIM II in mammalian cell or the body fluid of measuring, and the gene expression dose that records compared with standard A IM II gene expression dose, if being lower than standard, the gene expression dose that records promptly shows to suffer from certain tumour.

In the time of having carried out diagnosing tumor according to ordinary method, the present invention can be effectively as the prediction indicator, the clinical effectiveness that wherein has the patient that strengthens the genetic expression of the AIM II patient lower than gene expression dose is more better possibly.

" measure coding AIM II proteic expression of gene level " mean directly (as by measuring or estimate the absolute magnitude of protein level or mRNA level) or relatively (as by comparing) with the AIM II protein level or the mRNA level of second kind of biological sample qualitative or measure or estimate the level of the AIM II protein level in first kind of sample or the proteic mRNA of AIM II that encodes quantitatively.

Preferably, measure or estimate in first kind of biological sample AIM II protein level or mRNA level and compare with standard A IM II protein level or mRNA level, this standard value is to record from the second kind of biological sample that derives from the individuality of long cancer not.This area is known very well, in case recorded standard A IM II protein level or mRNA level, this value can be repeated as standard of comparison.

" biological sample " means any biological sample that derives from individuality, clone, tissue culture or other source of containing AIM II albumen or mRNA.Biological sample comprises and contains the ripe proteic mammalian body fluid of AIM II (as serum, kytoplasm, urine, synovia and spinal fluid) of excretory, and ovary, prostate gland, heart, placenta, pancreas, liver, spleen, lung, chest and navel tissue.

The present invention can be effective in the mammiferous cancer diagnosis.The present invention especially can be effective in the diagnosis of the cancer of following each organoid in the Mammals: chest, ovary, prostate gland, bone, liver, lung, pancreas and spleen.Preferred Mammals comprises monkey, ape, cat, dog, ox, pig, horse, rabbit and the mankind.Especially preferred human.

Utilize Chomczynski and Sacchi, biological chemistry yearbook (Anal.Biochem.), the guanidine thiocyanate-phenol-chloroform single stage method of 162:156-159 (1987) record can be separated total cell RNA from biological sample.Utilize appropriate means to measure the level of the proteic mRNA of coding AIM II then.These methods comprise Northern engram analysis (Harada etc., cell, 63:303-312 (1990)), S1 nuclease mapping (Fujita etc., cell, 49:357-367 (1987)), combination (the RT-PCR) (Makino etc. of polymerase chain reaction (PCR), reverse transcription and polymerase chain reaction, technology, 2:295-301 (1990)), and the combination of reverse transcription and ligase chain reaction (RT-LCR).

Utilization can be measured the proteic level of AIM II in the biological sample based on the technology of antibody.For example, by traditional immunohistology method (Jalkanen M. etc., cytobiology magazine, 101:976-985 (1985); Jalkanen M. etc., cytobiology magazine, 105:3087-3096 (1987)), but the proteic expression of AIM II in the research organization.

Other method based on antibody that can be effective to AIM II protein gene expression mensuration comprises immunoassay, connects immunosorbent assay (ELISA) and radioimmunoassay (RIA) as enzyme.

Well known various suitable mark, they comprise enzyme labelling such as glucose oxidase, radio isotope such as iodine ( ¹²⁵I, ¹²¹I), carbon ( ¹⁴C), sulphur ( ³⁵C), tritium ( ³H), indium ( ¹¹²In) and technetium ( ^99mAnd fluorescent mark such as fluorescein, rhodamine and vitamin H Tc).Therapy

AIM II polypeptide especially people AIM II polypeptide can be used for the treatment of tumorigenesis, lymphadenopathy, autoimmune disease, graft versus host disease.In addition, AIM II polypeptide of the present invention also can be used for suppressing knurl and generates, as the growth of tumour cell.AIM II polypeptide may participate in destroying tumour by apoptosis with to the cytotoxicity of some cell.Because the AIM II has cultivation effect to the cell in endothelium source, thus needing also the AIM II can be used for the disease treatment of growth-promoting activity, as restenosis.Therefore, also the AIM II can be used for regulating the hemopoietic function of endotheliocyte growth course.Administering mode

Should be understood that above-mentioned illness can obtain medical treatment by taking AIM II albumen.Therefore, the present invention also provides treatment to need the method for the individuality of raising AIM II activity level, this method comprises to this class individuality takes separation AIM II polypeptide, the particularly medicinal compositions of the mature form of AIM II of the present invention that contains significant quantity, with the intravital AIM II of this individuality of effective raising activity level.

Although can grasp consumption flexibly according to the treatment needs as mentioned above, as general recommendations, total treatment significant quantity of the AIM II polypeptide of taking through parenteral is about 1 μ g/kg patient body weight/sky～10mg/kg patient body weight/sky for every dose.This dosage is more preferably 0.01mg/kg/ days at least, to the mankind most preferably this hormone taking dose be about 0.01～1mg/kg/ days.If continue medication, can finish by every day 1～4 time injection or continuity hypodermoclysis (as utilizing micropump) usually, wherein the AIM II polypeptide dose rates of taking is about 1 μ g/kg/hour～50 μ g/kg/hour.Also can use intravenously bag solution.

The medicinal compositions that contains AIM II of the present invention can pass through administration in oral administration, drop rectum with drug, parenteral admin, the brain pond, intravaginal administration, intraperitoneal administration, topical (by powder, ointment, drops or epidermis paster), cheek (bucally) administration or pass through oral cavity or nasal mist administration." pharmaceutical carrier " means the preparation assistant agent of nontoxic solid, semisolid or liquid formulations, thinner, capsule class material or any kind.Term used herein " parenteral " mean comprise intravenously, intramuscular, intraperitoneal, breastbone is interior, subcutaneous and the administering mode of intra-articular injection and transfusion etc.

Except that can using solubility AIM II polypeptide, also can use by adding stain remover such as triton x-100 and damping fluid the suitably lysed AIM II polypeptide of striding the film district that contains.Karyomit(e) detects

Nucleic acid molecule of the present invention also is of great value in karyomit(e) evaluation work.But this sequence specificity be directed to the chromosomal specific site of individual human and with its hybridization.According to the present invention, it is very important first step when getting in touch sequence and disease related gene that DNA is positioned on the karyomit(e).

In some preferred embodiment in this respect, can utilize the proteic genomic dna of cDNA clone's AIM II disclosed herein.Utilize multiple technologies well known in the art and library can finish this work.These libraries are generally commercially available.Then, by technology of carrying out the original position chromosome mapping well known in the art, utilize this genomic dna to carry out the original position chromosome mapping.

In addition, in some cases, sequence can be positioned on the karyomit(e) by prepare PCR primer (preferred 15-25bp) from cDNA.By 3 ' non-translational region of this gene of Computer Analysis, can pick out the primer of not crossing over an above exon in the genomic dna fast, thereby can make amplification procedure complicated.Then, utilize these primers, carry out the PCR screening containing the chromosomal somatocyte heterozygote of individual human.

Utilize the cDNA clone that Metaphase Chromosome is carried out fluorescence in situ hybridization (" FISH ") and can a step provide accurate chromosomal localization.Can use in this technology and be as short as 50 or the probe of 60bp from cDNA.The summary of relevant this technology is referring to Verma etc., human chromosomal: basic technology handbook, Pergamon Press, New York (1988).

In case when sequence has been positioned on the karyomit(e) a certain accurate site, physical location and the genetic map data of this sequence on karyomit(e) can be connected.These class data are found in as V.McKusick, " human Mendelian inheritance ", by with Johns HopkinsUniversity, the online acquisition of Welch Medical Library.By the linkage analysis common heredity of gene (physically in abutting connection with) gene that is positioned same chromosomal region and the relation between the disease are identified again.

Then, be necessary infected individuals and the cDNA or the difference between the genome sequence of infected individuals are not carried out assay determination.If observe the existence of sudden change in some or all infected individuals, and all do not find sudden change in any normal individual, so, this sudden change is likely the cause of disease that this is sick.

The present invention has been carried out general description above, following embodiment will help to understand better the present invention, and these embodiment provide with way of example, but not be used for limiting the present invention.EXAMPLE Example 1: in e. coli expression and purifying AIM II

A. have the expression of the AIM II of the terminal HA mark of N-

Utilization is specific to the PCR Oligonucleolide primers of carrier sequence of 3 ' side of AIM II albumen N-terminal sequence and this gene, amplifies the proteic dna sequence dna of coding AIM II in the preservation cDNA clone.Respectively 5 ' and 3 ' sequence in added the extra Nucleotide that contains the restriction site of being convenient to clone.

Utilize following primer can express the AIM II protein fragments of a 22kDa (lack the N-end and stride the film district):

The sequence of 5 ' Oligonucleolide primers is 5 ' GCGGGATCCGGAGAGATGGTCACC3 ' (SEQ ID NO:3), it is corresponding to 244-258 position Nucleotide in the AIM II albumen coded sequence among Figure 1A-C (SEQ ID NO:1), and contains a BamH I restriction site that is marked by underscore therein;

The sequence of 3 ' primer is 5 ' CGCAAGCTTCCTTCACACCATGAAAGC3 ' (SEQ ID NO:8), and it contains 756-783 position Nucleotide shown in a Hind III restriction site that is marked by underscore and Figure 1A-C following closely.

But by following primer The expressed AIM II albumen:

The sequence of 5 ' Oligonucleolide primers is 5 ' GACCGGATCC ATG GAG GAGAGT GTC GTA CGG C3 ' (SEQ ID NO:9), it is corresponding to 22 Nucleotide in the AIM II albumen coded sequence among Figure 1A-C (SEQ ID NO:1), and contains one therein by the following BamH I restriction site that lines out;

The sequence of 3 ' primer is 5 ' CGCAAGCTT CCT TCA CAC CAT GAAAGC3 ' (SEQ ID NO:10), and it contains 756-783 position Nucleotide shown in a Hind III restriction site that is marked by underscore and Figure 1A-C following closely.

Restriction enzyme site in these restriction sites and the bacterial expression vector pQE9 is complementary, and can be used for the expression of bacterium in these embodiments.(Qiagen,Ine.9259?Eton?Avenue,Chatsworth,CA,91311)。The pQE9 penbritin antibiotics resistance (" Ampr ") of encoding, and contain a bacterium replication orgin (" ori "), IPTG inducible promoter, a ribosome bind site (" RBS "), a 6-His mark and some restriction enzyme sites.

Utilize AIM II DNA and the carrier pQE9 of BamH I and Hind III digestion through amplification, the DNA that these have been digested links together then.After in the pQE9 of restricted cutting carrier, inserting AIM II protein D NA, AIM II protein-coding region is placed in the downstream of IPTG inducible promoter in the carrier, and effectively link to each other with it, and the on position of AIM II protein-coding region makes it and suitably places so that the initial AUG codon frame of AIM II protein translation is consistent.B. the expression that has the AIM II of the terminal HA mark of C-

Use bacterial expression vector pQE60 to carry out bacterial expression in the present embodiment.(QIAGEN,Inc..9259?Eton?Avenue,Chatsworth,CA,91311)。The pQE60 penbritin antibiotics resistance (" Ampr ") of encoding, and contain six codons of a bacterium replication orgin (" ori "), IPTG inducible promoter, a ribosome bind site (" RBS "), encoding histidine residue, and suitable single restriction enzyme site, wherein said histidine residues can allow by utilizing the affine resin of QIAGEN company (CompanyAddress the is the same) nickel-nitrilotriacetic acid(NTA) of selling (" Ni-NTA ") to carry out affinity purification.The mode of these element arrangements can guarantee that the expressed polypeptide in dna fragmentation insertion back of coded polypeptide can covalently bound 6 histidine residues (i.e. " 6 * His mark ") at its C-terminal.

But utilize respectively can with the sequence annealed PCR Oligonucleolide primers of 3 ' side of cDNA encoding sequence in the N-terminal sequence of required AIM II albumen section and the preservation construct, the dna sequence dna of the required AIM II albumen section of amplification coding from preservation cDNA clone.5 ' and 3 ' sequence in added the extra Nucleotide that contains the restriction site that can be convenient to be cloned into the pQE60 carrier respectively.

In order to clone protein, the sequence of used 5 ' primer is 5 ' GACGC CCATGGAG GAG GAG AGT GTC GTA CGC C3 ' (SEQ ID NO:17), contain the Nco I restriction site that marks by underscore in this sequence, be thereafter can with the N-terminal encoding sequence complementary Nucleotide of AIM II sequence among Figure 1A-C.Certainly, those of ordinary skills know very well, can change 5 ' primer initiation site in the protein coding sequence, with the dna fragmentation (shorter or longer) of any required section in the amplification coding whole protein.The sequence of 3 ' primer is 5 ' GACC GGATCC CAC CAT GAA AGCCCC GAA GTA AG3 ' (SEQ ID NO:18), contain the BamH I restriction site that marks by underscore in this sequence, be thereafter can with encoding sequence 3 before the terminator codon in the AIM II dna sequence dna among Figure 1A-C '-terminal complementary Nucleotide, encoding sequence can guarantee that with the mode that restriction site is arranged its frame is consistent with the frame of interior 6 the His codons of pQE60 carrier.

Utilize the AIM II dna fragmentation and the carrier pQE60 of BamH I and Nco I digest amplification, the DNA that will digest links together then.AIM II DNA is inserted in the downstream that makes AIM II protein-coding region place the IPTG inducible promoter in the pQE60 carrier of restrictive diges-tion, and consistent with initiator codon AUG and 6 Histidine codon frames wherein.

Utilize standard method, the connection mixture of the expression construct that contains the HA mark made among above-mentioned A or the B is converted in the competence Bacillus coli cells.Sambrook etc., " molecular cloning: laboratory manual ", second edition, press of cold spring harbor laboratory, the cold spring port, this class methods have been put down in writing in (1989) in New York.The intestinal bacteria M15/rep4 bacterial strain that will contain multiple copied plasmid pREP4 is used to carry out embodiment as herein described, and wherein, described plasmid pREP4 can express the lac repressor, and gives kalamycin resistance (" Kanr ").This bacterial strain only is applicable to expressing a kind of in the proteic multiple bacterial strain of AIM II, and it can be available from Qiagen company.

By identifying transformant at the energy for growth that contains on the LB flat board of penbritin and kantlex.From the resistance bacterium colony, extract plasmid DNA, prove conclusively the identity of cloned DNA again by restricted enzyme cutting analysis.

(" the O/N ") cultivation of spending the night in the liquid LB substratum that is added with penbritin (100 μ g/ml) and kantlex (25 μ g/ml) contains the clone of required construct.

Weighing apparatus degree of releasing by about 1: 100 to 1: 250 is seeded to the O/N culture in a large amount of cultures.Culturing cell to the optical density value (" OD600 ") at 600nm place is 0.4～0.6, adding isopropyl-(" IPTG ") to final concentration then is 1mM, to induce from lac repressor susceptibility promoter transcription by deactivation lac I repressor.Further subsequently culturing cell 3 to 4 hours.Then, by centrifugal collecting cell, and by the standard method lysing cell.Utilize conventional collection technique purifying inclusion body in the lysing cell, will forgive intravital protein again and be dissolved in the 8M urea.In 2 * phosphate buffered saline(PBS) (" PBS "), will contain the proteinic 8M urea soln of dissolved and cross a PD-10 post, remove urea thus, exchange buffering liquid, and make protein folding again.By another step-chromatography, protein is further purified to remove intracellular toxin again.Then, carry out sterile filtration.The protein of sterile filtration is prepared liquid to be stored among 2 * PBS with the concentration of 95 μ/ml.C. the proteic expression of AIM II and the purifying that do not contain the HA mark

Use bacterial expression vector pQE60 to carry out bacterial expression in the present embodiment.(QIAGEN,Inc..9259?Eton?Avenue,Chatsworth,CA,91311)。The pQE60 penbritin antibiotics resistance (" Ampr ") of encoding, and contain six codons of a bacterium replication orgin (" ori "), IPTG inducible promoter, a ribosome bind site (" RBS "), encoding histidine residue, and suitable single restriction enzyme site, wherein said histidine residues can allow by utilizing the affine resin of QIAGEN company (CompanyAddress the is the same) nickel-nitrilotriacetic acid(NTA) of selling (" Ni-NTA ") to carry out affinity purification.The mode of these element arrangements can guarantee that the expressed polypeptide in dna fragmentation insertion back of coded polypeptide can covalently bound 6 histidine residues (i.e. " 6 * His mark ") at its C-terminal.Yet among this embodiment, the inserted mode of this polypeptid coding sequence can not be translated these six Histidine codons, thereby the polypeptide that produces does not contain 6 * His mark.

Utilize respectively can with the sequence annealed PCR Oligonucleolide primers of 3 ' side of cDNA encoding sequence in the N-terminal sequence of required AIM II albumen section and the preservation construct, the dna sequence dna of the AIM II albumen section of the required shortage hydrophobicity leader sequence of amplification coding from preservation cDNA clone.5 ' and 3 ' sequence in added the extra Nucleotide that contains the restriction site that can be convenient to be cloned into the pQE60 carrier respectively.

In order to clone protein, the sequence of used 5 ' primer is 5 ' GACGC CCATGGAG GAG GAG AGT GTC GTA CGC C3 ' (SEQ ID NO:17), contain the Nco I restriction site that marks by underscore in this sequence, be thereafter can with the N-terminal encoding sequence complementary Nucleotide of AIM II sequence among Figure 1A-C.Certainly, those of ordinary skills know very well, can change 5 ' primer initiation site in the protein coding sequence, with the dna fragmentation (shorter or longer) of any required section in the amplification coding whole protein.The sequence of 3 ' primer is 5 ' CGC AAGCTT CCTT CAC ACC ATGAAA GC3 ' (SEQ ID NO:19), contain the Hind III restriction site that marks by underscore in this sequence, be thereafter can with 3 ' terminal non-coding sequence complementary Nucleotide in the AIM II dna sequence dna among Figure 1A-C.

The AIM II dna fragmentation and the carrier pQE60 that utilize Hind III and Nco I digest amplification to obtain, the DNA that will digest links together then.AIM II DNA is inserted in the downstream that makes AIM II protein-coding region and terminator codon thereof place the IPTG inducible promoter together in the pQE60 carrier of restrictive diges-tion and consistent with initiator codon AUG frame.This terminator codon can stop the translation of 6 Histidine codons that insert the downstream, site.

Utilize standard method, as Sambrook etc., " molecular cloning: laboratory manual ", and second edition, press of cold spring harbor laboratory, the cold spring port, those methods of being put down in writing in New York (1989) will connect mixture and be converted in the competence Bacillus coli cells.The intestinal bacteria M15/rep4 bacterial strain that will contain multiple copied plasmid pREP4 is used to carry out embodiment as herein described, and wherein, described plasmid pREP4 can express the lac repressor, and gives kalamycin resistance (" Kanr ").This bacterial strain only is applicable to expressing a kind of in the proteic multiple bacterial strain of AIM II, and it can be available from Qiagen company (address be the same).By identifying transformant at the energy for growth that contains on the LB flat board of penbritin and kantlex.From the resistance bacterium colony, extract plasmid DNA, prove conclusively the identity of cloned DNA again by restricted enzyme cutting analysis, PCR and dna sequencing.

(" the O/N ") cultivation of spending the night in the liquid LB substratum of adding penbritin (100 μ g/ml) and kantlex (25 μ g/ml) contains the clone of required construct.By about 1: 25 to 1: 250 extent of dilution, the O/N culture is seeded in a large amount of cultures again.Culturing cell to the optical density value (" OD600 ") at 600nm place is 0.4～0.6, adding isopropyl-(" IPTG ") to final concentration then is 1mM, to induce from lac repressor susceptibility promoter transcription by deactivation lac I repressor.Further subsequently culturing cell 3 to 4 hours passes through centrifugal collecting cell again.

Then, in 6M Guanidinium hydrochloride, pH8, in 4 ℃ with cell homogenates 3-4 hour.By centrifugal removal cell debris, dialysis contains the supernatant liquor of AIM II in being added with the 50mM sodium acetate buffer pH6 of 200mM NaCl.Perhaps, by the supernatant liquor of in containing the 500mM NaCl of proteinase inhibitor, 20% glycerine, 25mM TrisHCl pH7.4, dialysing, can successfully carry out again folding to protein.After the renaturation, protein can carry out purifying by ion-exchange, hydrophobic interaction and size exclusion chromatography.Perhaps, can pass through the affinity chromatography step, as utilize antibody column to obtain pure AIM II albumen.The protein of purifying is stored in 4 ℃, or freeze in-80 ℃.Embodiment 2: clone and expression AIM II albumen in baculovirus expression system

Utilization corresponding to AIM II gene 5 ' and the PCR Oligonucleolide primers of 3 ' sequence amplification preservation clone in the proteic cDNA sequence of coding total length AIM II:

The sequence of 5 ' primer is 5 ' GCT CCA GGA TCC GCC ATC ATG GAGGAG AGT GTC GTA CGG C3 ' (SEQ ID NO:1), and it contains 22 bases in the AIM II protein sequence among the BamH I restriction enzyme site that marked by underscore and Figure 1A-C subsequently.As described below, be inserted into expression vector after, 5 ' end of the amplified fragments of coding AIM II provides a kind of effective signal peptide.As KozakM., the molecular biology magazine, the useful signal that is used for translation initiation in eukaryotic cell that 196:947-950 (1987) is put down in writing is placed in the appropriate location in the construct carrier section;

The sequence of 3 ' primer is 5 ' GA CGC GGT ACC GTC CAA TGC ACCACG CTC CTT CCT TC3 ' (SEQ ID NO:12), it contain Asp 718 restriction sites that mark by underscore and subsequently with Figure 1A-C in 769-795 position Nucleotide complementary Nucleotide in the AIM II.

(La Jolla Ca.), separates amplified fragments from 1% sepharose for " Geneclean ", BIO 101 Inc. to utilize commercially available test kit.Utilize BamH I and Asp 718 these fragments of digestion then, on 1% sepharose, it is carried out purifying again.Herein with this fragment called after F2.

As Summers etc., baculovirus vector method and insect cell culture technique handbook, Texas Agricultural Experimental Station Bulletin No.1555 (1987) is described, by standard method, utilize carrier pA2-GP in rhabdovirus expression vector, to express AIM II albumen.The strong polyhedrin gene promoter that contains autographa california (Autoarapha californica) nuclear polyhedrosis virus (AcMNPV) in this expression vector also contains restriction site easily thereafter.The signal peptide that comprises the AcMNPVgp67 of the terminal methionine(Met) of N-is positioned at upstream, BamH I site just.The polyadenylation site of also having used simian virus 40 (" SV40 ") in this carrier is effectively to finish polyadenylation.For simply carrying out the screening of recombinant virus, also as one man inserted the beta-galactosidase gene in intestinal bacteria sources in this carrier with the polyhedrin gene promoter direction, follow polyadenylation signal by polyhedron gene.Virus sequence is all contained in the both sides of polyhedron gene sequence, so that carry out cell-mediated homologous recombination with wild-type virus DNA, thereby produces the challenge virus that can express these clone's polynucleotide.

As is known to the person skilled in the art, as long as building process can provide the signal that is used for transcription and translation, transportation etc. of required appropriate arrangement,, then can utilize other multiple baculovirus vector to replace pA2-GP as the AUG and the signal peptide of frame unanimity.This class carrier is recorded in Luckow etc. with other carrier, virusology, 170:31-39.

By this area routine techniques, utilize Restriction Enzyme BamH I and Asp 718 these plasmids of digestion, utilize calf enteron aisle phosphoesterase that it is carried out dephosphorylation again.(" Geneclean " BIO 101 Inc., La Jolla Ca), separates this DNA from 1% sepharose then to utilize commercially available test kit.Herein with this carrier DNA called after " V ".

By the T4 dna ligase fragment F2 and dephosphorylized plasmid V2 are linked together.Utilize to connect mixture transformed into escherichia coli HB101 cell, be tiled on the culture plate again.Digest the DNA in each bacterium colony source through the Xba I,, identify the bacterium of the plasmid that contains carrier AIM II gene again through the gel electrophoresis analysis digestion product.Sequence by dna sequencing conclusive evidence cloned sequence.Herein with this plasmid called after pBac AIM II.

Utilize Felgner etc., institute of NAS newspaper, the described lipofection of 84:7413-7417 (1987) is with 5 μ g plasmid pBac AIM II and commercially available linearizing baculovirus DNA (" the Baculo Gold of 1.0 μ g ^TMBaculovirusDNA ", Pharmingen, San Diego CA.) carries out cotransfection together.(Life Technologies Inc., Gaithersburg in aseptic hole MD), mix 1 μ g BaculoGold to contain Grace ' the s substratum of 50 μ l serum-frees on titer plate ^TMViral DNA and 5 μ g plasmid pBac AIM II add 10 μ l Lipofectin and 90 μ lGrace ' s substratum then, mix the back and place 15 minutes in room temperature.Then transfection mixture dropwise is added to and is inoculated in the Sf9 insect cell (ATCC CRL 1711) that contains in the 35mm tissue culturing plate of Grace ' s substratum that 1ml do not contain serum.Rock back and forth this plate to mix initiate solution, then plate was cultivated 5 hours at 27 ℃.After 5 hours, remove transfection solution in the slave plate, add Grace ' the s insect substratum that 1ml is supplemented with 10% foetal calf serum again.Plate is returned in the incubator, continues to cultivate 4 days in 27 ℃.

After 4 days, collect supernatant, and carry out plaque measurement according to Summers that above enumerates and the described method of Smith.Utilization contains " Blue Gal " (Life technologiesInc., Gaithersburg) sepharose is so that carry out easy evaluation and separate the clone who expresses tilactase, wherein the clone of this expression tilactase can produce and dye blue plaque (at Life Technologies Inc., the insect cell that Gaithersburg provided is cultivated and baculovirus is learned the detailed description that also can see this type of " plaque measurement " in the operation instruction 9-10 page or leaf).

After the serial dilution 4 days, virus is added in the cell.After suitably cultivating, utilize the suction nozzle of Eppendorf liquid getting device to choose the plaque of dying blueness, the agar that will contain recombinant virus then is suspended in the Eppendorf pipe that contains 200 μ l Grace ' s substratum again.By slight centrifugal removal agar wherein, utilize the supernatant liquor that contains recombinant baculovirus to infect the Sf9 cell that is inoculated in the 35mm plate again.After 4 days, collect the supernatant liquor of these culture plates, they are stored in 4 ℃.Identify the clone of the hESSB I, II and the III that contain correct insertion by DNA analysis methods such as restricted zymogram mensuration and order-checkings.Herein with this clone's called after V-AIM II.

In being supplemented with Grace ' the s substratum of 10% heat inactivation FBS, cultivate the Sf9 cell.Utilize recombinant baculovirus V-AIM II, the infection multiplicity (" MOI ") of (about 1～about 3) infects this cell with about 2.After 6 hours, remove substratum, change to the SF900 II substratum (can be from LifeTechnologies Inc., Gaithersburg obtains) of no methionine(Met) and halfcystine again.After 42 hours, add 5 μ Ci ³⁵S-methionine(Met) and 5 μ Ci ³⁵S-halfcystine (can obtain) from Amersham.Continued culturing cell 16 hours, and, carried out lysis then through centrifugal collecting cell, and the protein that has been labeled by SDS-PAGE and autoradiography observation.Embodiment 3: clone in the mammalian cell and expression

Be used for that the proteic most carriers of transient expression AIM II all should carry the SV40 replication origin in mammalian cell.This helps to guarantee that carrier is copied to high copy number in expressing the synthetic antigenic cell of initial required T (as the COS cell) of viral DNA.For reaching this purpose, also can use other any mammal cell line.

A typical mammalian expression vector contains promoter element, the protein coding sequence that can mediate the mRNA transcription initiation, and Transcription Termination, the required signal of transcript polyadenylation.Other element comprises that enhanser, Kozak sequence and flank contain the intervening sequence of required donor of RNA montage and acceptor site.Utilize early stage, late promoter, retrovirus such as RS V, HTL VI, the terminal repetition district of length (LTRs) of HI VI and the early promoter of cytomegalovirus (CMV) of SV40, can obtain efficiently to transcribe.Yet, also can use cell signal (as the human actin promotor).Can be used for finishing suitable expression vector of the present invention comprise pSVL, pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC37146) and pBC12MI carriers such as (ATCC 67109).The available mammalian cell comprises people Hela cell, 283 cells, H9 cell and Jurkart cell, mouse NIH 3T3 cell and C127 cell, the Cosl cell, Cos7 cell and CV1 cell, cercopithecus aethiops cell, quail QC1-3 cell, mouse Lcell and Chinese hamster ovary cell.

Perhaps, also can be at the dyeing interbody fusion express this gene in the stable cell lines of this gene.By identifying and isolate cells transfected with selected marker such as dhfr, gpt, Xin Meisu, hygromycin gene cotransfection.

Also can be by the amplification rotaring redyeing gene with its coded protein of great expression.Exploitation carry hundreds of or even during the clone of the gene of interest of thousands of copies, DHFR (Tetrahydrofolate dehydrogenase) is a mark of great use.Another kind of effective as selective mark is glutamine synthetase (GS) (Murphy etc., journal of biological chemistry, 227:277-279 (1991); Bebbington etc., Bio/Technology 10:169-175 (1992)).Utilize these marks, in selective medium, cultivate these mammalian cells, filter out and have the cell of high resistance.Contain in these clones and be integrated into intrachromosomal amplification gene.Chinese hamster ovary (CHO) cell often is used to produce protein.

Expression vector pC1 and pC4 contain the Rous sarcoma virus strong promoter (LTR) (Cullen etc., molecule and cytobiology, 438-447 (in March, 1985)) that has added cmv enhancer fragment (Boshart etc., cell, 41:521-530 (1985)).Multiple clone site, as contain BamH I, Xba I and Asp 718 restriction enzyme sites etc., can be convenient to clone gene of interest.Also contain 3 ' intron in the carrier, the polyadenylic acidization and the termination signal of rat proinsulin protogene.Embodiment 3 (a): intracellular clone of COS and expression

CNDA by the AIM II of will encoding is cloned into expression vector pcDNA I/Amp (can obtain from Invitrogen Inc.) and can be made into expression plasmid pAIM II HA.

This expression vector pcDNA I/amp contains: (1) can be effective to the intestinal bacteria replication orgin of amplification in intestinal bacteria and other prokaryotic cell prokaryocyte; (2) can be used for containing the ampicillin resistance gene of the prokaryotic cell prokaryocyte screening of plasmid; (3) can be used for the interior SV40 replication orgin that increases of eukaryotic cell; (4) CMV promotor, polylinker, SV40 intron and polyadenylation signal, the arrangement mode of these sequences can guarantee cDNA to be placed under the expression regulation of CMV promotor expediently by the restriction site in the polylinker, and effectively links to each other with polyadenylation signal with the SV40 intron.

Clone polylinker district with coding AIM II albumen and at the dna fragmentation that its 3 ' terminal frame has as one man merged the HA mark, so that under the guidance of CMV promotor, carry out recombinant protein expression in carrier.This HA mark is corresponding to Wilson etc., cell, the described epi-position that derives from influenza hemagglutinin protein of 37:767 (1984).The fusion of HA mark can be convenient to detect recombinant protein easily by the antibody of identification HA epi-position in the target protein.

Plasmid construction tactful as follows.With the above-mentioned similar process that is structured in the expression vector of e. coli expression AIM II, utilize and contain the primer of restriction site easily, amplify the AIM II cDNA in the preservation clone.For ease of the AIM II of expressing is detected, purifying and evaluation, one of primer contains above-mentioned hemagglutinin mark (" HA mark ").

Suitable primer has employed following primer among this embodiment: contain BamH I site that underscore marks and 5 ' primer of AUG initiator codon, its sequence is as follows:

5′G?CTC?GGA?TCC?GCC?ATC?ATG3′(SEQ?ID?NO:13)；

Contain Xba I site, terminator codon that underscore marks, can form 3 ' primer of 3 ' encoding sequence (at its 3 ' end) of 9 codons of hemagglutinin HA mark and 31bp, its sequence is as follows:

5′GAT?GTT?CTA?GAA?AGC?GTA?GTC?TGG?GAC?GTC?GTATGG?GTA?CAC?CAT?GAA?AGC?CCC?GAA?GTA?AGA?CCG?GGTAC3′(SEQ?ID?NO:14)。

By Hind III and Xho I digestion pcr amplified dna fragment and carrier pcDNA I/Amp, again they are coupled together.To connect mixture be converted into intestinal bacteria SURE bacterial strain (can be from Stratagene Cloning Systems, 11099 North Torrey PinesRoad, La Jolla, CA92037 obtains) in, the culture that has transformed is plated on the flat board that contains ampicillin medium, cultivates these plates again to guarantee the growth of amicillin resistance bacterium colony.Isolated plasmid dna from the resistance bacterium colony, and the existence by AIM II encode fragment in restriction analysis and the detected through gel electrophoresis plasmid DNA.

For express recombinant AIM II, can utilize as Sambrook etc., " molecular cloning: laboratory manual ", and press of cold spring harbor laboratory, the cold spring port, the described DEAE-DEXTRAN in New York (1989) is by above-mentioned expression vector rotaring redyeing COS cell.Culturing cell under the condition that is suitable for vector expression AIM II.

Utilize as Harlow etc., " antibody: laboratory manual ", second edition, press of cold spring harbor laboratory, the cold spring port, the method for being put down in writing in New York (1988) is by radio-labeling and immune precipitation determination AIM II HA Expression of Fusion Protein.For reaching this purpose, transfection was carried out mark by culturing cell in the substratum that contains the 35S-halfcystine to it after 2 days.Collecting cell and substratum, washed cell again according to (source is the same) described methods such as Wilson, utilizes the RIPA damping fluid that contains stain remover: 150mM NaCl, 1%NP-40,0.1%SDS, 1%NP-40,0.5%DOC, 50mM Tris, pH7.5 lysing cell.Utilize the HA monoclonal antibody specific, precipitating proteins from cell lysate and tissue culture medium (TCM).Analyze settled protein by SDS-PAGE gel and radiography again.Can be observed the expression product of expection size in cell lysate, this is non-existent in negative contrast.Embodiment 3 (b): clone and expression in the Chinese hamster ovary celI

Utilize carrier pC4 to express AIM II albumen.Plasmid pC1 is a plasmid pSV2-dhfr[ATCC preserving number 37146] derivative.Two kinds of plasmids all contain the mouse DHFR gene under the control of SV40 early promoter.Can filter out the active Chinese hamster ovary cell of no dihydrofolic acid or other cell that transfection has these plasmids by culturing cell in the selective medium that is supplemented with the chemotherapeutics methotrexate (alpyha minus MEM, Life Technologies).The existing well record of the amplification of DHFR gene in the cell of anti-methotrexate (MTX) purine (referring to as Alt F.W., Kellems R.M., Bertino J.R. and Schimke R.T., 1978, journal of biological chemistry, 253:1357-1370; Hamlin J.L. and Ma C., 1990, Biochem et Biophys.Acta, 1097:107-143; Page M.J. and Sydenham M.A., 1991, biotechnology, the 9th volume: 64-68).The cell that grows in the MTX of greater concn can strengthen its resistance to this medicine by amplification, the overexpression target enzyme DHFR of DHFR gene.If the DHFR gene has connected another gene, it is also by coamplification and overexpression usually.The clone of cultivating the gene that contains more than 1000 copy is the important process of this area.Therefore, remove methotrexate after, still contain the amplification gene that has been integrated in the karyomit(e) in the clone.

Contain the strong promoter (Cullen etc. that are useful on the long terminal repetition district of Rous sarcoma virus (LTR) of expressing goal gene among the plasmid pC4, molecule and cytobiology, in March, 1985: an isolated fragment (Boshart etc. 438-447) and from the enhanser of human cytomegalic inclusion disease virus (CMV) immediate early gene, cell, 41:521-530 (1985)).BamH I, Xba I and Asp 718 restriction enzyme sites that can allow gene to insert are contained in this promotor downstream.This plasmid also contains the 3 ' intron and the polyadenylation site of rat proinsulin protogene behind these cloning sites.Also can use other efficient promoter to express, as the early stage or late promoter of people's beta-actin gene promoter, SV40, or the terminal repetition district of length of other retrovirus such as HIV and HTLVI.Can utilize the Tet-Off of Clontech company and Tet-On gene expression system in mammalian cell with control methods express the AIM II (Gossen M. and BujardH., 1992, institute of NAS newspaper, 89:5547-5551).As for the polyadenylation of this mRNA, also can use other signal, as derive from the signal of human growth hormone or globin gene.By with selected marker such as gpt, G418 or Totomycin cotransformation, also can filter out and carry the stable cell lines that is integrated into intrachromosomal goal gene.Use a plurality of selected markers when preferably beginning, as using G418 and methotrexate simultaneously.

Utilize Restriction Enzyme BamH I and Asp 718 digested plasmid pC4,, utilize calf enteron aisle Phosphoric acid esterase that it is carried out dephosphorylation and handle then by means known in the art.Separate this carrier by 1% sepharose again.

Utilization corresponds respectively to 5 of this gene ' and the PCR Oligonucleolide primers amplification coding complete AIM II albumen of 3 ' sequence and dna sequence dna of leader sequence thereof.The sequence of this 5 ' primer is: 5 ' GCT CCA GGA TCC GCC ATC ATG GAG GAG AGTGTC GTA CGG C3 ' (SEQ ID NO:15), wherein contain BamH I restriction enzyme site that underscore represents and thereafter as Kozak M., the molecular biology magazine, the useful signal that is used for translation initiation in the described eukaryote of 196:947-950 (1987), and 22 bases in the AIM II encoding sequence shown in Figure 1A-C (SEQ ID NO:1).The sequence of 3 ' primer is: 5 ' GA CGC GGTACC GTC CAA TGC ACC ACG CTC CTT CCT TC3 ' (SEQ IDNO:16), wherein contain Asp 718 restriction sites that underscore represents and subsequent with the Nucleotide complementary Nucleotide of AIM II gene 769-795 position shown in Figure 1A-C (SEQ ID NO:1).

This amplified fragments after endonuclease BamH I and Asp 718 digestion, purifying again on 1% sepharose again.By the T4 dna ligase this isolated fragment and dephosphorylation carrier are coupled together then, transformed into escherichia coli HB101 or XL1-Blue cell again, and contain this segmental bacterium that is inserted into plasmid pC4 by identifying as restricted enzyme cutting analysis.

Use the Chinese hamster ovary cell that lacks active DHFR gene to transform.Utilize Lipofectin (Felgner etc., the source is the same), 5 μ g expression plasmid pC4 are carried out cotransformation with 0.5 μ g plasmid pSV2-neo.Plasmid pSV2 neo contains a dominance selected marker, i.e. the neo gene in Tn5 source, and this neo genes encoding can be given the enzyme to the one group of antibiotic resistance that comprises G418.With this cell inoculation in the alpha minus MEM substratum of having added 1mg/ml G418.After 2 days, by this cell of tryptic digestion, and with its be inoculated in contain added simultaneously 10.25 or the hybridoma clone plate of the alpha minus MEM substratum of 50ng/ml methotrexate and 1mg/ml G418 (Greiner, Germany) in.Approximately after 10-14 days,, they are inoculated in 6-hole culture dish or the 10ml Erlenmeyer flask then, and use the methotrexate (50nM, 100nM, 200nm, 400nM, 800nM) of different concns through the single clone of tryptic digestion.The clone that will grow in the maximum concentration methotrexate is transferred on the new 6-orifice plate that contains greater concn methotrexate (1 μ M, 2 μ M, 5 μ M, 10mM, 20mM).Repeat this step until the clone who obtains under 100～200 μ M concentration, to grow.By as methods such as SDS-PAGE, Western hybridization or reversed-phase HPLC analyses, the expression of goal gene product is analyzed.The tissue distribution of embodiment 4:AIM II protein expression

The method of utilizing people such as Sambrook (source is the same) and other document to put down in writing is carried out the Northern engram analysis, with AIM II expression of gene in the research people tissue.According to manufacturer's explanation, utilize rediprime ^TMDna marker system (Amersham LifeScience) carries out the cDNA probe that contains AIM II albumen complete nucleotide sequence (SEQ ID NO:1) ³²The P mark.Behind the mark,, utilize CHROMA SPIN-100 according to manufacturer PT 1200-1 technology ^TMPost (Clontech Laboratories company) carries out purifying to this probe.Utilize this purified label probe to analyze the level of AIM II mRNA in various people's tissues then.

Organize Northern (Multiple Tissue Northern, MTN) trace, and, utilize ExpressHyb from what Clontech obtained to contain various human tissue (H) or human immune system tissue (IM) according to manufacturer's PT 1190-1 technical scheme more ^TMHybridization solution (Clontech) is analyzed these traces by label probe.After hybridization and the washing, fixedly trace and exposure is spent the night at-70 ℃ develops to film according to standard method again.

Obviously, can be by specification sheets and the operation of the alternate manner the embodiment the present invention who is described in detail except that this paper.

Under guidance above, can carry out multiple improvement and change to the present invention, therefore, they are also in the scope of this paper accessory claim.

Whole disclosures of all publications cited herein (comprising patent, patent application, magazine article, laboratory manual, books or other file) all are incorporated herein by reference.

Sequence table (1) general information:

(ⅰ) applicant: Human Genome Sciences

941?0Key?West?Avenue

Rockville,MD?20850

The U.S.

Applicant/invention Ebner, Reinhard

People: Yu, Guo-Liang

Ru?ben,Steven?M.

(ⅱ) denomination of invention: apoptosis inducing molecule II

(ⅲ) sequence number: 19

(ⅳ) address:

(A) addressee: Sterne, Kessler, Goldstein ﹠amp; Fox, P.L.L.C

(B) street: 1100 New York Ave..Suite 600

(C) city: Washington

(D) state: DC

(E) country: the U.S.

(F) postcode: 20005-3934

(ⅴ) computer-reader form:

(A) media type: Floppy disk

(B) computer: IBM PC compatible

(C) operating system: PC-DOS/MS-DOS

(D) software: Patent In Release#1.0, Version#1.30

(ⅵ) present application information

(A) application number: TBA

(B) applying date: this paper is appended

(C) classification:

(ⅶ) application information formerly:

(A) application number: 60/013,923

(B) applying date: on March 22nd, 1996

(C) classification:

(ⅷ) proxy/agency's information:

(A) name: Goldstein, Jorge A.

(B) registration number: 29,021

(C) data/number of documents: 1488.065 PC 01/JAG/EKS/KMT

(ⅸ) communication information:

(A) phone: 202-371-2600

(B) fax: 202-371-2540 (2) SEQ ID NO:1 information: (ⅰ) sequence signature:

(A) length: 1169 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linear (ⅱ) molecule type: DNA (genome) is characteristic (ⅸ):

(A) title/keyword: CDS

(B) position: 49..768 (ⅹ ⅰ) sequence description: SEQ ID NO:1:GAGGTTGAAG GACCCAGGCG TGTCAGCCCT GCTCCAGAGA CCTTGGGC ATG GAG GAG 57

Met?Glu?Glu

1AGT?GTC?GTA?CGG?CCC?TCA?GTG?TTT?GTG?GTG?GAT?GGA?CAG?ACC?GAC?ATC??105Ser?Val?Val?Arg?Pro?Ser?Val?Phe?Val?Val?Asp?Gly?Gln?Thr?Asp?Ile

5??????????????????10??????????????????15CCA?TTC?ACG?AGG?CTG?GGA?CGA?AGC?CAC?CGG?AGA?CAG?TCG?TGC?AGT?GTG??153Pro?Phe?Thr?Arg?Leu?Gly?Arg?Ser?His?Arg?Arg?Gln?Ser?Cys?Ser?Val?20??????????????????25??????????????????30??????????????????35GCC?CGG?GTG?GGT?CTG?GGT?CTC?TTG?CTG?TTG?CTG?ATG?GGG?GCT?GGG?CTG??201Ala?Arg?Val?Gly?Leu?Gly?Leu?Leu?Leu?Leu?Leu?Met?Gly?Ala?Gly?Leu

40??????????????????45??????????????????50GCC?GTC?CAA?GGC?TGG?TTC?CTC?CTG?CAG?CTG?CAC?TGG?CGT?CTA?GGA?GAG??249Ala?Val?Gln?Gly?Trp?Phe?Leu?Leu?Gln?Leu?His?Trp?Arg?Leu?Gly?Glu

55??????????????????60??????????????????65ATG?GTC?ACC?CGC?CTG?CCT?GAC?GGA?CCT?GCA?GGC?TCC?TGG?GAG?CAG?CTG??297Met?Val?Thr?Arg?Leu?Pro?Asp?Gly?Pro?Ala?Gly?Ser?Trp?Glu?Gln?Leu

70??????????????????75??????????????????80ATA?CAA?GAG?CGA?AGG?TCT?CAC?GAG?GTC?AAC?CCA?GCA?GCG?CAT?CTC?ACA?????????345Ile?Gln?Glu?Arg?Arg?Ser?His?Glu?Val?Asn?Pro?Ala?Ala?His?Leu?Thr

85??????????????????90??????????????????95GGG?GCC?AAC?TCC?AGC?TTG?ACC?GGC?AGC?GGG?GGG?CCG?CTG?TTA?TGG?GAG?????????393Gly?Ala?Asn?Ser?Ser?Leu?Thr?Gly?Ser?Gly?Gly?Pro?Leu?Leu?Trp?Glu100?????????????????105?????????????????110?????????????????115ACT?CAG?CTG?GGC?CTG?GCC?TTC?CTG?AGG?GGC?CTC?AGC?TAC?CAC?GAT?GGG?????????441Thr?Gln?Leu?Gly?Leu?Ala?Phe?Leu?Arg?Gly?Leu?Ser?Tyr?His?Asp?Gly

120?????????????????125?????????????????130GCC?CTT?GTG?GTC?ACC?AAA?GCT?GGC?TAC?TAC?TAC?ATC?TAC?TCC?AAG?GTG?????????489Ala?Leu?Val?Val?Thr?Lys?Ala?Gly?Tyr?Tyr?Tyr?Ile?Tyr?Ser?Lys?Val

135?????????????????140?????????????????145CAG?CTG?GGC?GGT?GTG?GGC?TGC?CCG?CTG?GGC?CTG?GCC?AGC?ACC?ATC?ACC?????????537Gln?Leu?Gly?Gly?Val?Gly?Cys?Pro?Leu?Gly?Leu?Ala?Ser?Thr?Ile?Thr

150?????????????????155?????????????????160CAC?GGC?CTC?TAC?AAG?CGC?ACA?CCC?CGC?TAC?CCC?GAG?GAG?CTG?GAG?CTG?????????585His?Gly?Leu?Tyr?Lys?Arg?Thr?Pro?Arg?Tyr?Pro?Glu?Glu?Leu?Glu?Leu

165?????????????????170?????????????????175TTG?GTC?AGC?CAG?CAG?TCA?CCC?TGC?GGA?CGG?GCC?ACC?AGC?AGC?TCC?CGG?????????633Leu?Val?Ser?Gln?Gln?Ser?Pro?Cys?Gly?Arg?Ala?Thr?Ser?Ser?Ser?Arg180?????????????????185?????????????????190?????????????????195GTC?TGG?TGG?GAC?AGC?AGC?TTC?CTG?GGT?GGT?GTG?GTA?CAC?CTG?GAG?GCT?????????681Val?Trp?Trp?Asp?Ser?Ser?Phe?Leu?Gly?Gly?Val?Val?His?Leu?Glu?Ala

200?????????????????205?????????????????210GGG?GAG?GAG?GTG?GTC?GTC?CGT?GTG?CTG?GAT?GAA?CGC?CTG?GTT?CGA?CTG?????????729Gly?Glu?Glu?Val?Val?Val?Arg?Val?Leu?Asp?Glu?Arg?Leu?Val?Arg?Leu

215?????????????????220?????????????????225CGT?GAT?GGT?ACC?CGG?TCT?TAC?TTC?GGG?GCT?TTC?ATG?GTG?TGAAGGAAGG??????????778Arg?Asp?Gly?Thr?Arg?Ser?Tyr?Phe?Gly?Ala?Phe?Met?Val

230 235 240AGCGTGGTGC ATTGGACATG GGTCTGACAC GTGGAGAACT CAGAGGGTGC CTCAGGGGAA 838AGAAAACTCA CGAAGCAGAG GCTGGGCGTG GTGGCTCTCG CCTGTAATCC CAGCACTTTG 898GGAGGCCAAG GCAGGCGGAT CACCTGAGGT CAGGAGTTCG AGACCAGCCT GGCTAACATG 958GCAAAACCCC ATCTCTACTA AAAATACAAA AATTAGCCGG ACGTGGTGGT GCCTGCCTGT 1018AATCCAGCTA CTCAGGAGGC TGAGGCAGGA TAATTTTGCT TAAACCCGGG AGGCGGAGGT 1078TGCAGTGAGC CGAGATCACA CCACTGCACT CCAACCTGGG AAACGCAGTG AGACTGTGCC 1138TCAAAAAAAA AAAAAAAAAA AAAAAAAAAA A 1169 ( 2 ) SEQ ID NO:2： ( ⅰ ) ： ( A ) ：240 ( B ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO:2:Met Glu Glu Ser Val Val Arg Pro Ser Val Phe Val Val Asp Gly Gln 1 5 10 15Thr Asp Ile Pro Phe Thr Arg Leu Gly Arg Ser His Arg Arg Gln Ser

20??????????????????25??????????????????30Cys?Ser?Val?Ala?Arg?Val?Gly?Leu?Gly?Leu?Leu?Leu?Leu?Leu?Met?Gly

35??????????????????40??????????????????45Ala?Gly?Leu?Ala?Val?Gln?Gly?Trp?Phe?Leu?Leu?Gln?Leu?His?Trp?Arg

50??????????????????55??????????????????60Leu?Gly?Glu?Met?Val?Thr?Arg?Leu?Pro?Asp?Gly?Pro?Ala?Gly?Ser?Trp?65??????????????????70??????????????????75??????????????????80Glu?Gln?Leu?Ile?Gln?Glu?Arg?Arg?Ser?His?Glu?Val?Asn?Pro?Ala?Ala

85??????????????????90??????????????????95His?Leu?Thr?Gly?Ala?ASn?Ser?Ser?Leu?Thr?Gly?Ser?Gly?Gly?Pro?Leu

100?????????????????105?????????????????110Leu?Trp?Glu?Thr?Gln?Leu?Gly?Leu?Ala?Phe?Leu?Arg?Gly?Leu?Ser?Tyr

115?????????????????120?????????????????125His?Asp?Gly?Ala?Leu?Val?Val?Thr?Lys?Ala?Gly?Tyr?Tyr?Tyr?Ile?Tyr

130?????????????????135?????????????????140Ser?Lys?Val?Gln?Leu?Gly?Gly?Val?Gly?Cys?Pro?Leu?Gly?Leu?Ala?Ser145?????????????????150?????????????????155?????????????????160Thr?Ile?Thr?His?Gly?Leu?Tyr?Lys?Arg?Thr?Pro?Arg?Tyr?Pro?Glu?Glu

165?????????????????170?????????????????175Leu?Glu?Leu?Leu?Val?Ser?Gln?Gln?Ser?Pro?Cys?Gly?Arg?Ala?Thr?Ser

180?????????????????185?????????????????190Ser?Ser?Arg?Val?Trp?Trp?Asp?Ser?Ser?Phe?Leu?Gly?Gly?Val?Val?His

195?????????????????200?????????????????205Leu?Glu?Ala?Gly?Glu?Glu?Val?Val?Val?Arg?Val?Leu?Asp?Glu?Arg?Leu

210 215 220Val Arg Leu Arg Asp Gly Thr Arg Ser Tyr Phe Gly Ala Phe Met Val225,230 235 240 (2) SEQ ID NO:3 information:

(ⅰ) sequence signature:, (A) length: 455 amino acid, (B) type: amino acid, (C) chain: uncorrelated, (D) topological structure: uncorrelated, (ⅱ) molecule type: protein, (ⅹ ⅰ) sequence description: SEQ ID NO:3:Met Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu1 5 10 15Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val Pro

20??????????????????25??????????????????30His?Leu?Gly?Asp?Arg?Glu?Lys?Arg?Asp?Ser?Val?Cys?Pro?Gln?Gly?Lys

35??????????????????40??????????????????45Tyr?Ile?His?Pro?Gln?Asn?Asn?Ser?Ile?Cys?Cys?Thr?Lys?Cys?His?Lys

50??????????????????55??????????????????60Gly?Thr?Tyr?Leu?Tyr?Asn?Asp?Cys?Pro?Gly?Pro?Gly?Gln?Asp?Thr?Asp65??????????????????70??????????????????75??????????????????80Cys?Arg?Glu?Cys?Glu?Ser?Gly?Ser?Phe?Thr?Ala?Ser?Glu?Asn?His?Leu

85??????????????????90??????????????????95Arg?His?Cys?Leu?Ser?Cys?Ser?Lys?Cys?Arg?Lys?Glu?Met?Gly?Gln?Val

100?????????????????105?????????????????110Glu?Ile?Ser?Ser?Cys?Thr?Val?Asp?Arg?Asp?Thr?Val?Cys?Gly?Cys?Arg

115?????????????????120?????????????????125Lys?Asn?Gln?Tyr?Arg?His?Tyr?Trp?Ser?Glu?Asn?Leu?Phe?Gln?Cys?Phe

130?????????????????135?????????????????140ASn?Cys?Ser?Leu?Cys?Leu?Asn?Gly?Thr?Val?His?Leu?Ser?Cys?Gln?Glu145?????????????????150?????????????????155?????????????????160Lys?Gln?Asn?Thr?Val?Cys?Thr?Cys?His?Ala?Gly?Phe?Phe?Leu?Arg?Glu

165?????????????????170?????????????????175Asn?Glu?Cys?Val?Ser?Cys?Ser?Asn?Cys?Lys?Lys?Ser?Leu?Glu?Cys?Thr

180?????????????????185?????????????????190Lys?Leu?Cys?Leu?Pro?Gln?Ile?Glu?Asn?Val?Lys?Gly?Thr?Glu?Asp?Ser

195?????????????????200?????????????????205Gly?Thr?Thr?Val?Leu?Leu?Pro?Leu?Val?Ile?Phe?Phe?Gly?Leu?Cys?Leu

210?????????????????215?????????????????220Leu?Ser?Leu?Leu?Phe?Ile?Gly?Leu?Met?Tyr?Arg?Tyr?Gln?Arg?Trp?Lys225?????????????????230?????????????????235?????????????????240Sar?Lys?Leu?Tyr?Ser?Ile?Val?Cys?Gly?Lys?Ser?Thr?Pro?Glu?Lys?Glu

245?????????????????250?????????????????255Gly?Glu?Leu?Glu?Gly?Thr?Thr?Thr?Lys?Pro?Leu?Ala?Pro?Asn?Pro?Ser

260?????????????????265?????????????????270Phe?Ser?Pro?Thr?Pro?Gly?Phe?Thr?Pro?Thr?Leu?Gly?Phe?Ser?Pro?Val

275?????????????????280?????????????????285Pro?Ser?Ser?Thr?Phe?Thr?Ser?Ser?Ser?Thr?Tyr?Thr?Pro?Gly?Asp?Cys

290?????????????????295?????????????????300Pro?Asn?Phe?Ala?Ala?Pro?Arg?Arg?Glu?Val?Ala?Pro?Pro?Tyr?Gln?Gly305?????????????????310?????????????????315?????????????????320Ala?Asp?Pro?Ile?Leu?Ala?Thr?Ala?Leu?Ala?Ser?Asp?Pro?Ile?Pro?ASn

325?????????????????330?????????????????335Pro?Leu?Gln?Lys?Trp?Glu?Asp?Ser?Ala?His?Lys?Pro?Gln?Ser?Leu?Asp

340?????????????????345?????????????????350Thr?Asp?Asp?Pro?Ala?Thr?Leu?Tyr?Ala?Val?Val?Glu?Asn?Val?Pro?Pro

355?????????????????360?????????????????365Leu?Arg?Trp?Lys?Glu?Phe?Val?Arg?Arg?Leu?Gly?Leu?Ser?Asp?His?Glu

370?????????????????375?????????????????380Ile?Asp?Arg?Leu?Glu?Leu?Gln?Asn?Gly?Arg?Cys?Leu?Arg?Glu?Ala?Gln385?????????????????390?????????????????395?????????????????400Tyr?Ser?Met?Leu?Ala?Thr?Trp?Arg?Arg?Arg?Thr?Pro?Arg?Arg?Glu?Ala

405?????????????????410?????????????????415Thr?Leu?Glu?Leu?Leu?Gly?Arg?Val?Leu?Arg?Asp?Met?Asp?Leu?Leu?Gly

420?????????????????425?????????????????430Cys?Leu?Glu?Asp?Ile?Glu?Glu?Ala?Leu?Cys?Gly?Pro?Ala?Ala?Leu?Pro

435?????????????????440?????????????????445Pro?Ala?Pro?Ser?Leu?Leu?Arg

450 455, (2) SEQ ID NO:4 information:, (ⅰ) sequence signature:, (A) length: 205 amino acid, (B) type: amino acid, (C) chain: uncorrelated, (D) topological structure: uncorrelated, (ⅱ) molecule type: protein, (ⅹ ⅰ) sequence description: SEQ ID NO:4:Met Thr Pro Pro Glu Arg Leu Phe Leu Pro Arg Val Cys Gly Thr Thr1 5 10 15Leu His Leu Leu Leu Leu Gly Leu Leu Leu Val Leu Leu Pro Gly Ala

20??????????????????25??????????????????30Gln?Gly?Leu?Pro?Gly?Val?Gly?Leu?Thr?Pro?Ser?Ala?Ala?Gln?Thr?Ala

35??????????????????40??????????????????45Arg?Gln?His?Pro?Lys?Met?His?Leu?Ala?His?Ser?Thr?Leu?Lys?Pro?Ala

50??????????????????55??????????????????60Ala?His?Leu?Ile?Gly?Asp?Pro?Ser?Lys?Gln?Asn?Ser?Leu?Leu?Trp?Arg65??????????????????70??????????????????75??????????????????80Ala?Asn?Thr?Asp?Arg?Ala?Phe?Leu?Gln?Asp?Gly?Phe?Ser?Leu?Ser?Asn

85??????????????????90??????????????????95Asn?Ser?Leu?Leu?Val?Pro?Thr?Ser?Gly?Ile?Tyr?Phe?Val?Tyr?Ser?Gln

100?????????????????105?????????????????110Val?Val?Phe?Ser?Gly?Lys?Ala?Tyr?Ser?Pro?Lys?Ala?Thr?Ser?Ser?Pro

115?????????????????120?????????????????125Leu?Tyr?Leu?Ala?His?Glu?Val?Gln?Leu?Phe?Ser?Ser?Gln?Tyr?Pro?Phe

130?????????????????135?????????????????140His?Val?Pro?Leu?Leu?Ser?Ser?Gln?Lys?Met?Val?Tyr?Pro?Gly?Leu?Gln145?????????????????150?????????????????155?????????????????160Glu?Pro?Trp?Leu?His?Ser?Met?Tyr?His?Gly?Ala?Ala?Phe?Gln?Leu?Thr

165?????????????????170?????????????????175Gln?Gly?Asp?Gln?Leu?Ser?Thr?His?Thr?Asp?Gly?Ile?Pro?His?Leu?Val

180?????????????????185?????????????????190Leu?Ser?Pro?Ser?Thr?Val?Phe?Phe?Gly?Ala?Phe?Ala?Leu

195 200 205 (2) SEQ ID NO:5 information:

(ⅰ) sequence signature:, (A) length: 205 amino acid, (B) type: amino acid, (C) chain: uncorrelated, (D) topological structure: uncorrelated, (ⅱ) molecule type: protein, (ⅹ ⅰ) sequence description: SEQ ID NO:5:Met Thr Pro Pro Glu Arg Leu Phe Leu Pro Arg Val Cys Gly Thr Thr1 5 10 15Leu His Leu Leu Leu Leu Gly Leu Leu Leu Val Leu Leu Pro Gly Ala

20??????????????????25??????????????????30Gln?Gly?Leu?Pro?Gly?Val?Gly?Leu?Thr?Pro?Ser?Ala?Ala?Gln?Thr?Ala

35??????????????????40??????????????????45Arg?Gln?His?Pro?Lys?Met?His?Leu?Ala?His?Ser?Thr?Leu?Lys?Pro?Ala

50??????????????????55??????????????????60Ala?His?Leu?Ile?Gly?Asp?Pro?Ser?Lys?Gln?Asn?Ser?Leu?Leu?Trp?Arg65??????????????????70??????????????????75??????????????????80Ala?Asn?Thr?Asp?Arg?Ala?Phe?Leu?Gln?Asp?Gly?Phe?Ser?Leu?Ser?Asn

85??????????????????90??????????????????95Asn?Ser?Leu?Leu?Val?Pro?Thr?Ser?Gly?Ile?Tyr?Phe?Val?Tyr?Ser?Gln

100?????????????????105?????????????????110Val?Val?Phe?Ser?Gly?Lys?Ala?Tyr?Ser?Pro?Lys?Ala?Thr?Ser?Ser?Pro

115?????????????????120?????????????????125Leu?Tyr?Leu?Ala?His?Glu?Val?Gln?Leu?Phe?Ser?Ser?Gln?Tyr?Pro?Phe

130?????????????????135?????????????????140His?Val?Pro?Leu?Leu?Ser?Ser?Gln?Lys?Met?Val?Tyr?Pro?Gly?Leu?Gln145?????????????????150?????????????????155?????????????????160Glu?Pro?Trp?Leu?His?Ser?Met?Tyr?His?Gly?Ala?Ala?Phe?Gln?Leu?Thr

165?????????????????170?????????????????175Gln?Gly?Asp?Gln?Leu?Ser?Thr?His?Thr?Asp?Gly?Ile?Pro?His?Leu?Val

180?????????????????185?????????????????190Leu?Ser?Pro?Ser?Thr?Val?Phe?Phe?Gly?Ala?Phe?Ala?Leu

195 200 205, (2) SEQ ID NO:6 information:, (ⅰ) sequence signature:, (A) length: 281 amino acid, (B) type: amino acid, (C) chain: uncorrelated, (D) topological structure: uncorrelated, (ⅱ) molecule type: protein, (ⅹ ⅰ) sequence description: SEQ ID NO:6:Met Gln Gln Pro Phe Asn Tyr Pro Tyr Pro Gln Ile Tyr Trp Val Asp1 5 10 15Ser Ser Ala Ser Ser Pro Trp Ala Pro Pro Gly Thr Val Leu Pro Cys

20??????????????????25??????????????????30Pro?Thr?Ser?Val?Pro?Arg?Arg?Pro?Gly?Gln?Arg?Arg?Pro?Pro?Pro?Pro

35??????????????????40??????????????????45Pro?Pro?Pro?Pro?Pro?Leu?Pro?Pro?Pro?Pro?Pro?Pro?Pro?Pro?Leu?Pro

50??????????????????55??????????????????60Pro?Leu?Pro?Leu?Pro?Pro?Leu?Lys?Lys?Arg?Gly?ASn?His?Ser?Thr?Gly65??????????????????70??????????????????75??????????????????80Leu?Cys?Leu?Leu?Val?Met?Phe?Phe?Met?Val?Leu?Val?Ala?Leu?Val?Gly

85??????????????????90??????????????????95Leu?Gly?Leu?Gly?Met?Phe?Gln?Leu?Phe?His?Leu?Gln?Lys?Glu?Leu?Ala

100?????????????????105?????????????????110Glu?Leu?Arg?Glu?Ser?Thr?Ser?Gln?Met?His?Thr?Ala?Ser?Ser?Leu?Glu

115?????????????????120?????????????????125Lys?Gln?Ile?Gly?His?Pro?Ser?Pro?Pro?Pro?Glu?Lys?Lys?Glu?Leu?Arg

130?????????????????135?????????????????140Lys?Val?Ala?His?Leu?Thr?Gly?Lys?Ser?Asn?Ser?Arg?Ser?Met?Pro?Leu145?????????????????150?????????????????155?????????????????160Glu?Trp?Glu?Asp?Thr?Tyr?Gly?Ile?Val?Leu?Leu?Ser?Gly?Val?Lys?Tyr

165?????????????????170?????????????????175Lys?Lys?Gly?Gly?Leu?Val?Ile?Asn?Glu?Thr?Gly?Leu?Tyr?Phe?Val?Tyr

180?????????????????185?????????????????190Ser?Lys?Val?Tyr?Phe?Arg?Gly?Gln?Ser?Cys?Asn?Asn?Leu?Pro?Leu?Ser

195?????????????????200?????????????????205His?Lys?Val?Tyr?Met?Arg?Asn?Ser?Lys?Tyr?Pro?Gln?Asp?Leu?Val?Met

210?????????????????215?????????????????220Met?Glu?Gly?Lys?Met?Met?Ser?Tyr?Cys?Thr?Thr?Gly?Gln?Met?Trp?Ala225?????????????????230?????????????????235?????????????????240Arg?Ser?Ser?Tyr?Leu?Gly?Ala?Val?Phe?Asn?Leu?Thr?Ser?Ala?Asp?His

245?????????????????250?????????????????255Leu?Tyr?Val?Asn?Val?Ser?Glu?Leu?Ser?Leu?Val?Asn?Phe?Glu?Glu?Ser

260?????????????????265?????????????????270Gln?Thr?Phe?Phe?Gly?Leu?Tyr?Lys?Leu

275 280 (2) SEQ ID NO:7 information: (ⅰ) sequence signature: (A) length: 24 base pairs (B) type: nucleic acid (C) chain: strand (D) topological framework: linear (ⅱ) molecule type: cDNA (ⅹ ⅰ) sequence description: SEQ ID NO:7:

GCGGGATCCG GAGAGATGGT CACC 24 (2) SEQ ID NO:8 information: (ⅰ) sequence signature: (A) length: 27 base pairs (B) type: nucleic acid (C) chain: strand (D) topological framework: linear (ⅱ) molecule type: cDNA (ⅹ ⅰ) sequence description: SEQ ID NO:8:

CGCAAGCTTC CTTCACACCA TGAAAGC 27 (2) SEQ ID NO:9 information: (ⅰ) sequence signature: (A) length: 32 base pairs (B) type: nucleic acid (C) chain: strand (D) topological framework: linearity

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:9:

GACCGGATCC ATGGAGGAGA GTGTCGTACG GC 32 (2) SEQ ID NO:10 information: (ⅰ) sequence signature: (A) length: 27 base pairs (B) type: nucleic acid (C) chain: strand (D) topological framework: linear (ⅱ) molecule type: cDNA (ⅹ ⅰ) sequence description: SEQ ID NO:10:

CGCAAGCTTC CTTCACACCA TGAAAGC 27 (2) SEQ ID NO:11 information: (ⅰ) sequence signature: (A) length: 40 base pairs (B) type: nucleic acid

( C ) ： ( D ) ： ( ⅱ ) ：cDNA ( ⅹⅰ ) ：SEQ ID NO:11:GCTCCAGGAT CCGCCATCAT GGAGGAGAGTGTCGTACGGC 40 ( 2 ) SEQ ID NO:12： ( ⅰ ) ： ( A ) ：37 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ：cDNA ( ⅹⅰ ) ：SEQ ID NO:12:GACGCGGTAC CGTCCAATGC ACCACGCTCC TTCCTTC 37 ( 2 ) SEQ ID NO:13： ( ⅰ ) ： ( A ) ：19 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ：cDNA ( ⅹⅰ ) ：SEQ ID NO:13:

GCTCGGATCC GCCATCATG 19 (2) SEQ ID NO:14 information: (ⅰ) sequence signature: (A) length: 71 base pairs (B) type: nucleic acid (C) chain: strand

(D) topological structure: linear (ⅱ) molecule type: cDNA (ⅹ ⅰ) sequence description: SEQ ID NO:14:GATGTTCTAG AAAGCGTAGT CTGGGACGTC GTATGGGTAC ACCATGAAAG CCCCGAAGTA 60AGACCGGGTA C 71 (2) SEQ ID NO:15 information: (ⅰ) sequence signature: (A) length: 40 base-pairs (B) type: nucleic acid (C) chain: strand (D) topological structure: linear (ⅱ) molecule type: cDNA (ⅹ ⅰ) sequence description: SEQ ID NO:15:GCTCCAGGAT CCGCCATCAT GGAGGAGAGTGTCGTACGGC 40 (2) SEQ ID NO:16 information: (ⅰ) sequence signature: (A) length: 37 base-pairs (B) type: nucleic acid

(C) chain: strand (D) topological framework: linearity

(ⅱ) molecule type: cDNA

(ⅹ ⅰ) sequence description: SEQ ID NO:16:GACGCGGTAC CGTCCAATGC ACCACGCTCC TTCCTTC 37 (2) SEQ ID NO:17 information: (ⅰ) sequence signature: (A) length: 32 base pairs (B) type: nucleic acid (C) chain: strand (D) topological framework: linearity

(ⅱ) molecule type: cDNA (ⅹ ⅰ) sequence description: SEQ ID NO:17:

GACGCCCATG GAGGAGGAGA GTGTCGTACG GC 32 (2) SEQ ID NO:18 information: (ⅰ) sequence signature:

(A) length: 33 base pairs

(B) type: nucleic acid (C) chain: strand (D) topological framework: linear (ⅱ) molecule type: cDNA (ⅹ ⅰ) sequence description: SEQ ID NO:18:

GACCGGATCC CACCATGAAA GCCCCGAAGT AAG 33 (2) SEQ ID NO:19 information: (ⅰ) sequence signature: (A) length: 27 base pairs (B) type: nucleic acid (C) chain: strand (D) topological framework: linear (ⅱ) molecule type: cDNA (ⅹ ⅰ) sequence description: SEQ ID NO:19:

CGCAAGCTTC?CTTCACACCA?TGAAAGC?27

Claims (19)

1. isolated nucleic acid molecule, it contains and is selected from down the polynucleotide that the sequence of organizing has the nucleotide sequence of at least 95% identity, and described group contains:

(a) coding has the nucleotide sequence of the AIM II polypeptide of whole aminoacid sequences (SEQ ID NO:2) among Figure 1A-C;

(b) nucleotide sequence of coding AIM II polypeptide, described polypeptide has whole aminoacid sequences of the contained cDNA clones coding of ATCC preserving number NO.97689;

(c) nucleotide sequence of coding AIM II polypeptide ectodomain;

(d) nucleotide sequence of coding AIM II polypeptide membrane spaning domain;

(e) nucleotide sequence of coding AIM II polypeptide born of the same parents intracellular domain;

(f) nucleotide sequence of coding solubility AIM II polypeptide, described solubility AIM II polypeptide contains the outer and born of the same parents' intracellular domain of born of the same parents, but lacks membrane spaning domain; With

(g) any nucleotide sequence complementary nucleotide sequence with above-mentioned (a) and (b), (c), (d), (e) or (f).

2. the nucleic acid molecule of claim 1, wherein said polynucleotide have nucleotide sequence whole among Figure 1A-C (SEQ ID NO:1).

3. the nucleic acid molecule of claim 1, wherein said polynucleotide have the nucleotide sequence of coding AIM II polypeptide among Figure 1A-C (SEQ ID NO:1), and described AIM II polypeptide has among Figure 1A-C all aminoacid sequences (SEQ ID NO:2).

4. the nucleic acid molecule of claim 1, wherein said polynucleotide have the complete nucleotide sequence of contained cDNA clone in the ATCC preserving number 97689.

5. the nucleic acid molecule of claim 1, wherein said polynucleotide have the nucleotide sequence of coding AIM II polypeptide, and this AIM II polypeptide has whole aminoacid sequences of contained cDNA clones coding in the ATCC preserving number 97689.

6. isolated nucleic acid molecule, its one section polynucleotide that contains can be with containing with the (a) and (b) of claim 1, (c), (d), (e), (f) or the multi-nucleotide hybrid of the nucleotide sequence that nucleotide sequence is identical (g) under stringent hybridization condition, and wherein said polynucleotide can not be hybridized with the nucleotide sequence that only contains the A residue or only contain the T residue under stringent hybridization condition.

7. isolated nucleic acid molecule, it contains the polynucleotide of the aminoacid sequence of the section that has epi-position in the coding AIM II polypeptide, and the (a) and (b), (c), (d) that described AIM II polypeptide has a claim 1 are (e) or the aminoacid sequence (f).

8. the isolated nucleic acid molecule of claim 7, section that its coding AIM II polypeptide has epi-position, described section is selected from the following group: contain about the 13rd polypeptide to about the 20th amino acids residue among Figure 1A-C (SEQ ID NO:2); Contain about the 23rd polypeptide among Figure 1A-C (SEQ IDNO:2) to about the 36th amino acids residue; Contain about the 69th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 79th amino acids residue; Contain about the 85th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 94th amino acids residue; Contain about the 167th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 178th amino acids residue; Contain about the 184th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 196th amino acids residue; Contain the about the 221st polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 233rd amino acids residue.

9. method for preparing recombinant vectors, described method comprises that the isolated nucleic acid molecule with claim 1 is inserted in the carrier.

10. press the recombinant vectors of the method preparation of claim 9.

11. a method for preparing recombinant host cell, described method comprise that the recombinant vectors with claim 10 imports in the host cell.

12. press the recombinant host cell of the method preparation of claim 11.

13. the method for a recombinant production AIM II polypeptide, described method are included in the recombinant host cell of cultivating claim 12 under the condition that described polypeptide can express; And reclaim described polypeptide.

14. an isolating AIM II polypeptide, it contains and is selected from an aminoacid sequence that sequence has at least 95% identity of following group, and this group contains:

(a) have among Figure 1A-C (SEQ ID NO:2) all AIM II amino acid sequence of polypeptide of aminoacid sequences;

(b) has the AIM II amino acid sequence of polypeptide that the contained cDNA of ATCC preserving number NO.97689 clones coded whole aminoacid sequences;

(c) aminoacid sequence of the ectodomain of AIM II polypeptide;

(d) aminoacid sequence of the membrane spaning domain of AIM II peptide;

(e) aminoacid sequence of born of the same parents' intracellular domain of AIM II polypeptide;

(f) solubility AIM II amino acid sequence of polypeptide, described solubility AIM II polypeptide have the outer and born of the same parents' intracellular domain of all or part of born of the same parents, but lack membrane spaning domain; With

(g) (a) and (b), (c), (d), (e) or (f) in the aminoacid sequence of the section that contains epi-position of any polypeptide.

15. one kind contains the isolated polypeptide that has the section of epi-position in the AIM II albumen, wherein said section is selected from the group of being made up of following: contain about the 13rd polypeptide to about the 20th amino acids residue among Figure 1A-C (SEQ ID NO:2); Contain about the 23rd polypeptide among Figure 1A-C (SEQ IDNO:2) to about the 36th amino acids residue; Contain about the 69th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 79th amino acids residue; Contain about the 85th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 94th amino acids residue; Contain about the 167th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 178th amino acids residue; Contain about the 184th polypeptide among Figure 1A-C (SEQ ID NO:2) to about the 196th amino acids residue; And contain about the 221st polypeptide to about the 233rd amino acids residue among Figure 1A-C (SEQ ID NO:2).

16. an isolated antibody, its energy specificity is in conjunction with the AIM II polypeptide of claim 14.

17. a treatment is selected from by the state of the following group of forming or the method for disease: lymphadenopathy, autoimmune disease and graft versus host disease, described method comprise to the patient of need corresponding treatment take the (a) and (b), (c), (d), (e) of the claim 14 of significant quantity or (f) in polypeptide.

18. a method that presses down knurl, its comprise to the patient of need corresponding treatment take the (a) and (b), (c), (d), (e) of the claim 14 of significant quantity or (f) in polypeptide.

19. a prevention is selected from by the state of the following group of forming or the method for disease: septic shock, infection, cerebral malaria, the activation of HIV-virus, bone resorption, rheumatoid arthritis and emaciation, described method comprise that the patient to the need corresponding treatment takes the antagonist of polypeptide of the claim 14 of significant quantity.

Images