CN1319137A

CN1319137A - Keratinocyte derived interferon

Info

Publication number: CN1319137A
Application number: CN99811157A
Authority: CN
Inventors: 史蒂文·M·鲁宾; 保罗·A·穆尔; 戴维·W·拉弗勒
Original assignee: Human Genome Sciences Inc
Current assignee: Human Genome Sciences Inc
Priority date: 1998-07-21
Filing date: 1999-07-21
Publication date: 2001-10-24
Also published as: AU765890B2; NZ509402A; EP1100902A1; WO2000005371A1; CA2335655A1; EP1100902A4; JP2002522021A; AU5116199A; KR20010083132A; KR100688051B1

Abstract

The present invention relates to a novel KDI protein which is a member of the interferon family. In particular, isolated nucleic acid molecules are provided encoding a human interferon polypeptide, called ''KDI''. KDI polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of KDI activity. Also provided are therapeutic methods for treating immune system-related disorders.

Description

Keratinocyte deutero-Interferon, rabbit

Invention field

The present invention relates to a kind of coding is the new people's gene of Interferon, rabbit family member's polypeptide, more specifically the invention provides the isolated nucleic acid molecule that coding is called the human polypeptides of " keratinocyte deutero-Interferon, rabbit " or " KDI ".The KDI polypeptide also is provided, has produced carrier, host cell and the recombination method of this material.The present invention also provides the diagnostic method of detection and immunity system relative disease, and the method for treatment disease of immune system.The invention still further relates to the stimulant of discriminating KDI and the screening method of antagonist.

Background of invention

Interferon, rabbit (IFN) is by a large amount of eukaryotic cells excretory cytokine family under various stimulations.Interferon, rabbit is divided into four classes: α-IFN (white corpuscle), β-IFN (inoblast) γ-IFN (lymphocyte), Ω-IFN (white corpuscle) by its chemistry and biological nature.α and β-IFN are known to be interferon type, and gamma-interferon is known to be II type or type II interferon.(Ω-IFN), it is a kind of monomer glycoprotein to a kind of single functional gene coding Ω Interferon, rabbit, and is structurally relevant with β-IFN edge far away with α-IFN, but uncorrelated with γ-IFN in the people's gene group.IFN present have antiviral, immunomodulatory and antiproliferative activity.The clinical potential of Interferon, rabbit is proved, and will sum up hereinafter.

Antiviral: IFN has been used for clinical antiviral therapy, for example be used for the treatment of AIDS (Lane.Semin.Oncol.18:46-52 (Ocl.1991)), viral hepatitis comprises chronic viral hepatitis B, third liver (the Woo, M.H.and Brunakis, T.G., Ann.Parmacother.31:330-337 (in March, 1997); Gibas.A.L.Gastroenterologist, 1:129-142 (1993.6)), the fourth liver, papilloma virus (Levine, L.A. etc., Urology 47:553-557 (1996.4)), simplexvirus (Ho, M., Annu.Rev.Med.38:51-59 (1987)), encephalitis (Wintergerst etc., infect 20:207-212 (1992,7)), and be used to prevent rhinitis and respiratory tract infection (Ho.M., Annu.Rev.Med.38:51-59 (1987)).

Parasiticide: IFN has been proposed to be used in the parasiticide treatment, and for example γ-IFN can be used for treating Cryptosporidium parvum infection (Rehg, J.E., J.Infect.Des.174:229-232 (1996.7)).

The clinical antibacterial therapy that is used for of antibacterium: IFN.For example: γ-IFN has been used for the treatment of multidrug resistance pulmonary tuberculosis (Condos, R. etc., Lancet.349:1513-1515 (1997)).

Anticancer: interferon therapy (for example has been used for the treatment of various cancers, hairy cell leukemia (Hofmann etc., the cancer therapy summary, 12 (supplementary issue .B): 33-37 (1985,12)) acute marrow sample leukemia (Stone, R.M. etc., Am.J.Clin.Oncol.16:159-163 (1993,4)), osteosarcoma (Strander, H. etc., Acta Oncol, 34:877-880 (1995)), basaloma (Dogan, B. etc., cancer information 91:215-219 (1995,5)), neurospongioma (Fetell, M.R. etc., cancer 65:78-83 (1990.1), renal cell carcinoma (Aso.Y. etc., Prof.Clin.Biol.Res.303:653～659 (1989)), boniness myeloma (Peest.D. etc., Br.J.Haematol.94:425-432 (Sept.1996)), melanoma (Ikic.D. etc., Int.J.Dermatol.34:872-874 (1995.12)) and Hodgkin ' s disease (Rybak, M.E. etc., J.Biol.Response Mod.9:1-41 (1990.2)).The synergy therapeutic advance of interferon-alpha and Temozolomide treatment of cancer with combinations report (patent disclosure WO9712630, Dugan, M.H.).

Immunotherapy: IFN is clinical to be used for immunotherapy or for example to prevent the repulsion of transplant to the host more specifically to (1), or shortens the progressive as sacroiliitis, multiple sclerosis, (2) diabetes of autoimmunization systemic disease.β-IFN sells the multiple sclerosis of treatment (promptly as immunosuppressor) in U.S.'s approval.Recently there is the generation of report multiple sclerosis patient's interferon type and interleukin II to reduce (Wandinger, K.P. etc., J.Neurol.Sci.149:87-93 (1997)).In addition, recombinant alpha-IFN immunotherapy (with recombinant human il-2's combination) successfully is used for the lymphatic cancer patient after autologous bone marrow or the hematopoietic stem cell transplantation, and it can promote after translation, and sb.'s illness took a favorable turn (Nagler, A. etc., Blood 89:3951-3959 (1997.7)).

Anti-allergic: take γ-IFN and be used for the treatment of the Mammals transformation reactions (referring to patent disclosure WO8701288, Parkin, J.M. and Pinching, A.J.) the existing interior IL-12 of transformation reactions asthmatic patient body and IL-12 dependent form gamma-IFN of also having confirmed discharges minimizing (van der Pouw kraan, T.C. etc., immune magazine 158:5560-5565 (1997)).Therefore, IFN can be used for treating transformation reactions by suppressing humoral response.

Vaccine adjuvant: Interferon, rabbit can be used as adjuvant or co-adjuvant to strengthen or to stimulate the immunne response under prevention or the treatment inoculation situation.(Heath, A.W and Playfair, J.H.L. vaccine 10:427-434) 1992)).

Apparently, need to disclose the various application of new interferon protein in this area, for example immunotherapy, and antiviral, parasiticide, antibacterium, or in the anticancer therapy, maybe need to improve the symptom of interferon activity.

Summary of the invention

The invention provides isolated nucleic acid molecule, it comprises that coding has complete amino acid sequence shown in the SEQ ID NO:2, or by being deposited in ATCC, the polynucleotide of at least a portion of the KDI polypeptide of the complete amino acid sequence of the cDNA clones coding of preserving number 203500 on December 1st, 1998 with plasmid DNA.The nucleotide sequence that the KDI clone (HKAPI 15) who passes through the order-checking preservation shown in Fig. 1 (SEQ ID NO:1) measures, the open reading frame that contains the complete polypeptide of 207 amino-acid residues of encoding is included in the initiator codon of the terminal methionine(Met) of coding N-of 35-37 position Nucleotide.Nucleic acid molecule of the present invention comprises the nucleic acid of the complete amino acid sequences except that the N-terminal methionine(Met) shown in those codings SEQ ID NO:2, these molecules additional amino acid of fusion at KDI aminoacid sequence N-terminal of also encoding.

Encoded polypeptides has 27 amino acid whose leader sequences of derivation, underscore place in Fig. 1; The proteinic aminoacid sequence of ripe KDI of deriving among Fig. 1 shown in 28～207 amino acids, among the SEQ ID NO:2 shown in 1～207 residue.

The 165-183 position residue of Fig. 1 (SEQ ID NO:2) comprises the especially characteristic sequence of KDI polypeptide of interferon polypeptides.Therefore, preferably comprise the polypeptide of 165-183 position residue of Fig. 1 and the polynucleotide of this peptide species of encoding.

Therefore, one aspect of the present invention provides isolated nucleic acid molecule, and it comprises and contains the polynucleotide that are selected from next group nucleotide sequence: (a) coding has the nucleotide sequence of the KDI polypeptide of complete amino acid sequence among the SEQ ID NO:2; (b) coding has the Nucleotide of the KDI polypeptide of complete S EQ ID NO:2 aminoacid sequence except that the N-terminal methionine(Met) (being 2～207 residues of SEQ ID NO:2); (c) nucleotide sequence of ripe KDI polypeptide shown in 28～207 residues among the coding SEQ ID NO:2; (d) nucleotide sequence of 165～183 residues of coding SEQ ID NO:2; (e) coding is by the nucleotide sequence of the complete polypeptide of contained people cDNA coding among the clone HKAPI15; (f) coding is by the nucleotide sequence of complete polypeptide except that the N-terminal methionine(Met) of clone's contained people cDNA coding among the HKAPI15; (g) coding is by the nucleotide sequence of the mature polypeptide of people cDNA coding contained among the clone HKAPI15; (h) with above (a), (b), (c), (d), (e), (f) or arbitrary nucleotide sequence complementary nucleotide sequence (g).

Another embodiment of the present invention comprises isolated nucleic acid molecule, and it comprises having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% is same as above-mentioned (a), (b), (c), (d), (e), (f), (g) or (h) polynucleotide of the nucleotide sequence of arbitrary nucleotide sequence, or have under stringent hybridization condition with (a), (b), (c), (d), (e), (f), (g) or (h) in the polynucleotide of multi-nucleotide hybrid.The polynucleotide of this hybridization or not with the polynucleotide that only have the nucleotide sequence of being made up of A or T residue under stringent hybridization condition.Another nucleic acid embodiment of the present invention relates to isolated nucleic acid molecule, and it comprises that coding has above-mentioned (a), (b), and (c), (d), (e), (f) or (g) polynucleotide of the aminoacid sequence that carries the epi-position part of the KDI polypeptide of aminoacid sequence.

The invention still further relates to recombinant vectors, it comprises isolated nucleic acid molecule of the present invention, also relates to the host cell that contains recombinant vectors, and produces this carrier and host cell and produce the method for KDI polypeptide or peptide by recombinant technology with them.

The present invention also provides isolating KDI polypeptide, and it comprises the aminoacid sequence that is selected from next group aminoacid sequence: the total length KDI amino acid sequence of polypeptide that (a) has complete amino acid sequence shown in the SEQ ID NO:2; (b) has the total length KDI amino acid sequence of polypeptide (being 2～207 residues of SEQID NO:2) of complete amino acid sequence shown in the SEQID NO:2 except that the N-terminal methionine(Met); (c) ripe KDI amino acid sequence of polypeptide shown in 28～207 residues among the SEQ ID NO:2; (d) aminoacid sequence shown in 165～183 of SEQ ID NO:2 residues; (e) by the total length KDI polypeptide that contains somebody cDNA coding among the clone HKAPI15; (f) by the total length KDI polypeptide except that the terminal methionine(Met) of N-that contains somebody cDNA coding among the clone HKAPI15; (g) contain the ripe KDI polypeptide that somebody cDNA encodes by clone HKAPI15.Polypeptide of the present invention also comprises having at least 80%, preferably at least 90%, more preferably 95%, 96%, 97%, 98% or 99% is same as above-mentioned (a), (b), (c), (d), (e), (f) or the polypeptide of the aminoacid sequence of aminoacid sequence (g), and have at least 90% with above-mentioned those sequences, the polypeptide of the aminoacid sequence of preferred at least 95% similarity.

Another embodiment of the present invention relates to peptide or polypeptide, and it comprises having above (a), (b), and (c), (d), (e), (f) or (g) aminoacid sequence that carries the epi-position part of the KDI polypeptide of described aminoacid sequence.Peptide that carries the epi-position partial amino-acid series or polypeptide with KDI polypeptide of the present invention comprise having at least 6 or 7, preferably at least 9, the more preferably part of at least 30～50 amino acid whose these peptide species, certainly until and comprise that the polypeptide that carries epi-position of any length of the complete amino acid sequence of polypeptide of the present invention is also included within the present invention.

In another embodiment, the invention provides isolated antibody, its specifically with have (a), (b), (c), (d), (e), (f) or (g) the KDI polypeptide combination of described aminoacid sequence.The present invention also provides the method for separation with the antibody of the KDI polypeptide specific combination with aminoacid sequence described herein.This antibody is effective in the following stated treatment.

The present invention also provides the pharmaceutical composition that contains the KDI polypeptide, and it can be used for treating immunity system relative disease such as virus infection, parasitic infection, infectation of bacteria, cancer, autoimmunization systemic disease, multiple sclerosis, lymphatic cancer and allergic disease.The present invention also provides the various methods that need the individuality of interferon polypeptides for the treatment of.

The present invention also provides the composition that contains KDI polypeptide or KDI polynucleotide to be applied to cell in vitro, the cell of ex vivo and cells in vivo, or multicellular organisms.In some particularly preferred embodiment of the present invention, composition contains the KDI polynucleotide, is used at host expression in vivo KDI polypeptide with the treatment disease.Particularly preferably at patient's expression in vivo with treatment and the Interferon, rabbit relevant dysfunction of endogenous activity that distorts.

The present invention also provides and has differentiated the sieve method that can strengthen or suppress the bioactive compound of KDI polypeptide, it comprises and will be contacted with candidate compound when having the KDI polypeptide by KDI polypeptide enhanced acceptor, for example analyze the antiviral activity when candidate compound and KDI polypeptide exist, and this active is compared with the standard activity level, standard level is not have to contact under the situation of candidate compound between acceptor and KDI to analyze and get.In this analyzed, activity was higher than standard level and shows that candidate compound is the active stimulant of KDI, and activity is lower than standard level and shows that candidate compound is the active antagonist of KDI.

Now having disclosed KDI expresses in keratinocyte.Thereby nucleic acid of the present invention is differentiated tissue or the cell type that exists in the biological specimen as hybridization probe with differential.Similarly, polypeptide and antibody thereof are used to provide immunological probe to differentiate tissue or cell type with differential.In addition, for above-mentioned tissue or the especially immune disease of cell, can detect with " standard " KDI gene expression dose in taking from some tissue with relevant disease patient (for example cancer and creation tissue) or body fluid (for example serum, blood plasma, urine, synovia or cerebrospinal fluid) and compare obvious higher or lower level KDI genetic expression, standard K DI gene expression dose i.e. the expression level of KDI in the health tissues of no disease of immune system.Therefore, the invention provides the efficient diagnosis method in this disease of diagnosis, it comprises: (a) analyze KDI gene expression dose in individual cells or body fluid; (b) contrast this KDI gene expression dose and standard K DI gene expression dose, indicate disease of immune system thereby be higher or lower than standard level according to comparing result.

The present invention relates to the method that a kind of treatment needs the patient that the plain activity level of body internal interference increases on the other hand, comprises that giving this patient contains the isolating KDI polypeptide of the present invention who treats significant quantity or its anti-depressant composition.

The present invention also relates to the method that a kind of treatment needs the patient of the plain activity level reduction of body internal interference on the other hand, comprises giving the composition that this patient is contained the KDI antagonist for the treatment of significant quantity.The preferred antagonist that uses among the present invention is the KDI specific antibody.

Accompanying drawing is described

Fig. 1 illustrates nucleotide sequence (SEQ ID NO:1) and the aminoacid sequence (SEQID NO:2) of KDI.

Fig. 2 illustrates the same area between the aminoacid sequence of translation product (SEQ IDNO:3) of KDI protein and people Ω Interferon, rabbit mRNA, this determines (Wisconsin Sequence Analysis Package by the Bestfit computer program, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711).

Fig. 3 illustrates the KDI amino acid sequence analysis.Show α, β, the corner and the district of curling, wetting ability and hydrophobicity; Amphipathic district; Flex region; Antigenic index and surperficial probability.In " antigenic index-Jameson-Wolf " figure, positive peak shows the position of the proteic high antigenic region of KDI, promptly therefrom can obtain the peptide that the present invention carries epi-position.

Fig. 4 illustrates KDI polypeptide of the present invention and some other members' of interferon polypeptides family sequence contrast.That shown is human interferon beta-1 (SEQ ID NO:4), people's placenta Interferon, rabbit (SEQ ID NO:5), people Ω Interferon, rabbit (SEQ ID NO:6), people α-c Interferon, rabbit (SEQ ID NO:7), people α-F Interferon, rabbit (SEQ ID NO:8), human interferon II-1 (SEQ ID NO:9), human alpha interferon-N (SEQ ID NO:10), ox TP-1 (SEQ ID NO:11), ovi TP-1 (SEQ ID NO:12); Pig TP (SEQ IDNO:13); Human interferon beta-2a (IL-6) (SEQ ID NO:14), Bov IFN β-2 (SEQ ID NO:15), Bov IFN β-1 (SEQ ID NO:20), synthetic interferon beta-1 (SEQ ID NO:21).This sequence contrast produces with PAM250 residue weight table by the conventional Clustal method of Megalign.Megalign is included in the DNAstar suite program.

The detailed description of invention

The invention provides isolated nucleic acid molecule, it comprises that coding has the polynucleotide of the keratinocyte deutero-interferon polypeptides (KDI) of aminoacid sequence shown in the SEQ ID NO:2.Nucleotide sequence shown in Figure 1 (SEQ ID NO:1) is by to being deposited in American type culture collection (ATCC) on December 1st, 1998,10801 Boulevard universities, Manassas, Virgina 20110-2209, the people HKAPI15 cDNA of preserving number ATCC 203500 checks order and obtains.The cDNA of this preservation is included in (Life Technologies, Gaithersburg MD) among the plasmid pCMVSport 2.0, and can be by the Sal I/Not I Restriction Enzyme site excision that is positioned at people cDNA flank.

Some members of KDI protein of the present invention and Interferon, rabbit family are sequence homology, particularly the translation product (Fig. 2) of people Ω Interferon, rabbit mRNA (SEQ ID NO:3).The Ω Interferon, rabbit has illustrated and has suppressed various tumour cell in-vitro multiplications, stimulates natural killer cell activity, strengthens main histocompatibility I class (non-II class) antigen presentation, and suppresses the lymphopoiesis with mitogen or allogenic cells stimulation.Referring to Adolf, G.R. people Ω Interferon, rabbit summary, Mult Scler 1995; 1 Suppl 1:S44-S47.Measured the KDI expression and mainly in keratinocyte, dendritic cell and monocyte, found, but especially strong in keratinocyte.Stimulate keratinocyte special and promptly stimulate crossing of KDI transcript to express with TNF-α or PolyIC (stimulation virus infection).And in the virus infection that stimulate replied the expression increase similar based on its structure to Ω-IFN, confirm that KDI presents many biological activitys of Ω-IFN and other interferon protein, comprise the inhibition tumor proliferation, antiviral activity, NK cell function and immunity system enhancement.Nucleic acid molecule

Unless show especially, all nucleotide sequences of measuring by this paper dna molecular is checked order all use automated DNA sequenator (as Model 373 from Applied Biosystems.Inc.Foster City.CA) to measure, and all aminoacid sequences of the polypeptide of the dna molecule encode of being measured by this paper are derived by the dna sequence dna translation of as above measuring.Thereby any dna sequence dna of measuring by automated method as known in the art is the same, and the nucleotide sequence that this paper measures can have some errors.Automatically the real nucleotide sequence of nucleotide sequence of measuring and sequenced dna molecule is typically about at least 90%, and more typically about at least 95%～99.9% is identical.True sequence can be passed through the more accurate mensuration of other method, comprises artificial DNA sequencing well known in the art.The nucleotide sequence of mensuration also known in the art and true sequence have compared one and have inserted or disappearance will cause reading frame shift in the nucleotide sequence translation, begin to be different from fully the true amino acid sequence coded of dna molecular by order-checking by the nucleotide sequence coded deduced amino acid of measuring from this insertion or disappearance point thus.

" nucleotide sequence " of nucleic acid molecule or polynucleotide is meant the sequence of deoxyribonucleotide for dna molecular or polynucleotide, RNA molecule or polynucleotide are meant corresponding ribonucleotide (A, G, C and U) sequence, wherein each Thymine deoxyriboside (T) in special deoxyribonucleotide sequence is replaced by uridine (U).

Use information provided herein,, as make initiator clone cDNA with mRNA, can obtain the nucleic acid molecule of the present invention of encoded K DI polypeptide with the standard molecular biology method as the nucleotide sequence among Fig. 1.Illustration of the present invention nucleic acid molecule shown in Figure 1 (SEQ ID NO:1) in cDNA library, find derived from isolating keratinocyte.

The nucleotide sequence of the KDI DNA of Fig. 1 (SEQ ID NO:1) comprises a proteinic open reading frame of 207 amino-acid residues of encoding, and initiator codon is at 35～37 Nucleotide of nucleotide sequence shown in Figure 1 (SEQ ID NO:1).The proteinic aminoacid sequence of KDI about 35% shown in the SEQ ID NO:2 is same as Ω-IFN (Fig. 2).The sequence of Ω-IFN can obtain at GenBank, and registration number No.gb1A 12140.

Those of skill in the art know owing to may there be above-mentioned sequence error, sometimes can be long or shorter by about 207 amino acid whose real complete KDI polypeptide that comprise of the cDNA coding of preservation.Usually, real open reading frame can derive from (SEQ ID NO:1) shown in Figure 1 N-terminal methionine(Met) codon ± 20, especially ± 10 in the amino acid scope.Leading and mature sequence

The proteic aminoacid sequence of complete KDI comprises leader sequence and mature protein, shown in SEQID NO:2.The present invention especially provides encoding mature form KDI proteinic nucleic acid molecule.Therefore according to signal hypothesis,, have signal or secretion property leader sequence by mammalian cell excretory protein in case the growth protein chain begins output through rough surfaced endoplasmic reticulum, its cracking from complete polypeptide to produce excretory " maturation " formal protein.Most of mammalian cells even insect cell are with phase homospecificity cracking excretory protein.Yet in some cases, the cracking of secretory protein is not fully uniformly, produces two or multiple mature protein.In addition, the cracking specificity of known secretory protein determines finally that by the primary structure of whole protein promptly it is an inherent in amino acid sequence of polypeptide for a long time.Thereby the invention provides coding and have the nucleotide sequence of cloning the ripe KDI polypeptide of cDNA amino acid sequence coded among the HKAPI15 (ATCC. preserving number No.203500) by the people." have the ripe KDI polypeptide of cloning the cDNA amino acid sequence coded among the HKAPI15 by the people " and be meant by the complete open reading frame (as following COS cell) in mammalian cell of the human DNA sequence's coding that is included in the clone in the preservation carrier and express and the KDI protein of the mature form that produces.

In addition, the invention provides supposition protein and whether have the method for secretion leader sequence and leader sequence cracking point.For example the method for McGeoch (virus research 3:271-286 (1995)) is used the information from terminal charging area of complete (not cracking) proteinic short N-and non-charging area subsequently.The method of Heinje (nucleic acids research 14:4683～4690 (1986)) is used from centering on cracking site, typically-13～+ 2 the residue information of residue, wherein+the 1 ripe proteinic N-terminal of expression.The cracking site accuracy of the derivation of known Mammals secretory protein in these methods is 75-80% (Heinje, aforementioned).Yet these two kinds of methods always do not draw the cut point of identical derivation for a given protein.

In the present invention, the deduced amino acid of complete KDI polypeptide " PSORT " computer program analysis, this program derives from Kenta doctor Nakai of Kyoto University's chemistry institute (referring to K.Nakai and M.Kanehisa, Genomics 14:897-911 (1992)), it is based on the specialized system that aminoacid sequence is inferred proteinic cellular localization.Infer a localized part as this computer, the method for McGeoch and Heinje can be mixed.Above Computer Analysis infers that the potential cleavage site in complete amino acid sequence is shown in SEQ IDNO:2; Promptly in Fig. 1 (SEQ ID NO:2) between 27 and 28 residues.Certainly, the cleavage site of the accurate position of the cleavage site that is used by the enzyme of natural generation and supposition can have slight variation and can change between species.A mature polypeptide from about 20～34 residues is provided thus.In particular, the invention provides polypeptide: 20～207 residues among the SEQ ID NO:2 with following SEQ ID NO:2 part, 21～207 residues among the SEQ ID NO:2,22～207 residues among the SEQ ID NO:2,23～207 residues among the SEQ ID NO:2,24～207 residues among the SEQ ID NO:2,25～207 residues among the SEQ ID NO:2,26～207 residues among the SEQ ID NO:2,27～207 residues among the SEQ IDNO:2,28～207 residues among the SEQ ID NO:2,29～207 residues among the SEQ ID NO:2,30～207 residues among the SEQ ID NO:2,31～207 residues among the SEQ ID NO:2,32～207 residues among the SEQ ID NO:2,33～207 residues among the SEQ ID NO:2,34～207 residues among the SEQ ID NO:2.The present invention also provides the polynucleotide of this peptide species of encoding.

Nucleic acid molecule of the present invention can be rna form or dna form.This DNA can be two strands or strand.Single stranded DNA or RNA can be coding strands, also refer to do sense strand, or it can be noncoding strand, also refer to do antisense strand.

In special embodiment, polynucleotide length of the present invention is less than 300kb, 200kb, 100kb, 50kb, 15kb, 10kb or 7.5kb.In another embodiment, polynucleotide of the present invention comprise at least 15 continuous nucleotides of KDI encoding sequence, but do not comprise all or part of of any KDI intron.In another embodiment, comprise that the nucleic acid of KDI encoding sequence does not contain the encoding sequence of genomic flanking gene (be in the genome KDI encoding sequence 5 ' or 3 ').

" isolating " nucleic acid molecule is meant the nucleic acid molecule that has shifted out from its natural surroundings, DNA or RNA.For example, to be contained in the recombinant DNA molecules in the carrier be isolating in the present invention.Isolated DNA molecule for example comprises the recombinant DNA molecules that is kept in the heterologous host cell, or (part or basic purifying) dna molecular of purifying in the solution.Isolating RNA molecule comprises the interior or external rna transcription thing of the body of dna molecular of the present invention.Yet as also not with the isolating library member's of other member in library (as genome or cDNA library) (as contain clone and other member of library homogeneous solution form) clone in the nucleic acid that contains be not isolating, or separation or the karyomit(e) (as " karyomit(e) smear " in the karyotype) of taking from cell or cell lysate are not isolating.As described herein, can be natural, reorganization or synthetic the generation according to isolated nucleic acid molecule of the present invention.

Isolated nucleic acid molecule of the present invention comprises the have open reading frame dna molecular of (ORF), and this frame initiator codon is 35～37 of nucleotide sequences shown in Fig. 1 (SEQ ID NO:1).

Isolated nucleic acid molecule of the present invention also comprises the dna molecular of KDI albumen coded sequence shown in 2～207 of SEQID NO:2 with disappearance N-terminal methionine(Met).

In addition, isolated nucleic acid molecule of the present invention is different from above-mentioned those sequences substantially because the degeneracy of genetic code comprises containing, but still the dna molecular of the proteic sequence of encoded K DI.The priority of certain well known genetic code and the special password of species.Therefore, those skilled in the art produce above-mentioned degeneracy variant, and for example making special host's codon express optimizing (for example utilize host bacterium such as E.coli password among the people mRNA is changed into it is preferred) is routine techniques.

The present invention provides coding to have by the isolated nucleic acid molecule of cloning the KDI polypeptide of people cDNA amino acid sequence coded among the HKAPI15 (ATCC preserving number No.203500) on the other hand.Preferably, this nucleic acid molecule will be encoded by the mature polypeptide of the people cDNA of above-mentioned preservation coding.

The present invention also provides the nucleotide sequence shown in (SEQ ID NO:1) that has Fig. 1, or has the isolated nucleic acid molecule of the nucleotide sequence of the KDI cDNA among the clone who is contained in above-mentioned preservation, or the nucleic acid molecule with the sequence that is complementary to one of above-mentioned sequence.This isolating molecule, especially dna molecular is used to produce KDI polypeptide of the present invention, and as the mRNA in the cell of probe in detecting usefulness carrier transfection production KDI, promptly serves as a mark and measure expression of heterologous genes in the host cell.

The invention still further relates to the nucleic acid molecule of a coding nucleotide sequence part described herein, and the fragment of described isolated nucleic acid molecule.The present invention especially provides the polynucleotide with nucleotide sequence of representing a SEQ IDNO:1 part, and it is made up of 35～655 of SEQ ID NO:1.Other particularly preferred polynucleotide passage of the present invention comprises or is made up of the following nucleotide residue of SEQ IDNO:1: 38-655,41-655,44-655,47-655,50-655,53-655,56-655,59-655,62-655,65-655,68-655,71-655,74-655,77-655,80-655,83-655,86-655,89-655,92-655,95-655,98-655,101-655,104-655,107-655,110-655,113-655,116-655,119-655,122-655,125-655,128-655,131-655,134-655,137-655,140-655,143-655,146-655,149-655,152-655,155-655,158-655,161-655,164-655,167-655,170-655,173-655,176-655,179-655,182-655,185-655,188-655,191-655,194-655,197-655,200-655,203-655,206-655,209-655,212-655,215-655,218-655,221-655,224-655,227-655,230-655,233-655,236-655,239-655,242-655,245-655,248-655,251-655,254-655,257-655,260-655,263-655,266-655,269-655,272-655,275-655,278-655,281-655,284-655,287-655,290-655,293-655,296-655,299-655,302-655,305-655,308-655,311-655,314-655,317-655,320-655,323-655,326-655,329-655,332-655,335-655,338-655,341-655,344-655,347-655,350-655,353-655,356-655,359-655,362-655,365-655,368-655,371-655,374-655,377-655,380-655,383-655,386-655,389-655,392-655,395-655,398-655,401-655,404-655,407-655,410-655,413-655,416-655,419-655,422-655,425-655,428-655,431-655,434-655,437-655,440-655,443-655,446-655,449-655,452-655,455-655,458-655,461-655,464-655,467-655,470-655,473-655,476-655,479-655,482-655,485-655,488-655,491-655,494-655,497-655,500-655,503-655,506-655,509-655,512-655,515-655,518-655,521-655,524-655,527-655,530-655,533-655,536-655,539-655,542-655,545-655,548-655,551-655,554-655,557-655,560-655,563-655,566-655,569-655,572-655,575-655,578-655,581-655,584-655,587-655,590-655,593-655,596-655,599-655,602-655,605-655,608-655,611-655,614-655,617-655,620-655,623-655,626-655, the particularly preferred polynucleotide passage of 629-655,632-655 and 635-655 the present invention comprises or is made up of the following nucleotide residue of SEQ ID NO:1:

38-68,38-71,38-74,38-77,38-80,38-83,38-86,38-89,38-92,38-95,38-98,38-101,38-104,38-107,38-110,38-113,38-116,38-119,38-122,38-125,38-128,38-131,38-134,38-137,38-140,38-143,38-146,38-149,38-152,38-155,38-158,38-161,38-164,38-167,38-170,38-173,38-176,38-179,38-182,38-185,38-188,38-191,38-194,38-197,38-200,38-203,38-206,38-209,38-212,38-215,38-218,38-221,38-224,38-227,38-230,38-233,38-236,38-239,38-242,38-245,38-248,38-251,38-254,38-257,38-260,38-263,38-266,38-269,38-272,38-275,38-278,38-281,38-284,38-287,38-290,38-293,38-296,38-299,38-302,38-305,38-308,38-311,38-314,38-317,38-320,38-323,38-326,38-329,38-335,38-338,38-341,38-344,38-347,38-350,38-353,38-356,38-359,38-362,38-365,38-368,38-371,38-374,38-377,38-380,38-383,38-386,38-389,38-392,38-395,38-398,38-401,38-404,38-407,38-410,38-413,38-416,38-419,38-422,38-425,38-428,38-431,38-434,38-437,38-440,38-443,38-446,38-449,38-452,38-455,38-458,38-461,38-464,38-467,38-470,38-473,38-476,38-479,38-482,38-485,38-488,38-491,38-494,38-497,38-500,38-503,38-506,38-509,38-512,38-515,38-518,38-521,38-524,38-527,38-530,38-533,38-536,38-539,38-542,38-545,38-548,38-551,38-554,38-557,38-560,38-563,38-566,38-569,38-572,38-575,38-578,38-581,38-584,38-587,38-590,38-593,38-596,38-599,38-602,38-605,38-608,38-611,38-614,38-617,38-620,38-623,38-626,38-629,38-632, and 38-635

In addition, the present invention includes about at least 30 that contain SEQ ID NO:1, the polynucleotide of any part of preferred about at least 50 continuous nucleotides.

Normally, fragment with isolated nucleic acid molecule of nucleotide sequence shown in the nucleotide sequence of cDNA of preservation or Fig. 1 (SEQ ID NO:1) is meant as at least about 15nt of the length of described diagnostic probe and primer, preferably about at least 20nt, more preferably about at least 30nt, the most preferably fragment of about at least 40nt.Certainly length is that (length is 400nt for the big fragment of 50～600nt, 450nt, 500nt, the fragment of 550nt and 600nt also belong to all length 15 and 600nt between fragment, but the consideration spatial character is not enumerated especially) also be useful according to the present invention, it also is useful being equivalent to the cDNA of preservation or the fragment of the major part shown in Fig. 1 (SEQ ID NO:1) (if not all) nucleotide sequence.For example, length is for the fragment of 20nt at least is meant the fragment of 20 or more a plurality of continuous bases of nucleotide sequence shown in the nucleotide sequence of the cDNA that comprises preservation or Fig. 1 (SEQ ID NO:1), can comprise the extra nucleotide sequence of non-fusion derived from SEQ ID NO:1 (or cDNA of preservation) at any end of the continuous base of the 20+ of the cDNA of SEQ ID NO:1 or preservation certainly.The preferred nucleic acid fragment of the present invention comprises that coding carries the nucleic acid molecule of epi-position part as the KDI polypeptide of differentiating among Fig. 3, and as detailed below.

The present invention provides isolated nucleic acid molecule on the other hand, its be included under the stringent hybridization condition with the invention described above nucleic acid molecule in a part of polynucleotide for example clone the polynucleotide of people cDNA hybridization among the HKAPI15 (ATCC preserving number 203500)." stringent hybridization condition " is meant in containing the solution of following composition 42 ℃ of overnight incubation: 50% methane amide, 5 * SSC (150mM NaCl, the 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5 * Denhardt ' s solution, the shearing salmon sperm DNA of 10% T 500 and 20 μ g/ml sex change, subsequently about 65 ℃ with 0.1 * SSC with filter membrane washing 2 times.

Be meant about at least 15 Nucleotide (nt) with related polynucleotides with the polynucleotide of polynucleotide " part " hybridization, preferably about at least 20nt, more preferably about at least 30 nt, the most preferably polynucleotide (DNA or RNA) of about at least 30-70 nt (for example 50) hybridization.These polynucleotide such as above-mentioned as diagnostic probe and primer and describe in detail hereinafter.

For example a part of polynucleotide of " length is at least 20 nt " are meant 20 or more a plurality of continuous nucleotide (nucleotide sequence shown in the cDNA of preservation or Fig. 1 (SEQ ID NO:1)) of the nucleotide sequence of related polynucleotides.Certainly, only be not included in the present invention and be used to hybridize in the polynucleotide of the present invention's part nucleic acid with the polynucleotide of the complementary sequence hybridization of poly-A sequence (for example 3 ' of KDI cDNA terminal poly-(A) shown in Fig. 1 (SEQ ID NO:1) section sequence) or T (or U) residue because this polynucleotide will with any nucleic acid molecule that contains poly-(A) sequence or its complementary sequence (for example in fact any double-stranded cDNA clone) hybridization.

In special embodiment, polynucleotide length of the present invention is less than 100000kb, 50000kb, 10000kb, 1000kb, 500kb, 400kb, 350kb, 300kb, 250kb, 200kb, 175kb, 150kb, 125kb, 100kb, 75kb, 50kb, 40kb, 30kb, 25kb, 20kb, 15kb, 7.5kb, or 5kb.

The nucleic acid molecule of encoded K DI polypeptide of the present invention can comprise but the non-nucleic acid that is limited to those by the complete amino acid sequence of polypeptide of self encoding, and encoding sequence and other sequence of complete polypeptide, as leading secretion sequence such as the preceding albumen that those codings add, the sequence of proteinogen or preproprotein sequence.

Nucleic acid of the present invention also encode have extra, the above-mentioned protein sequence of non-coding sequence, for example comprise but non-intron and non-coding 5 ' and the 3 ' sequence of being limited to, as transcribe, untranslated transcribing, mRNA processing comprises montage and polyadenylation signal, for example the sequence that works in the stability of rrna combination and mRNA; Coding additional amino acid such as those provide the amino acid whose extra encoding sequence of other function.

Therefore, the sequence of coded polypeptide can with flag sequence, promote the sequence of the peptide of fusion polypeptide purifying to merge as coding.In the present invention's some preferred embodiment in this respect, marker amino acid sequence is a 6-Histidine peptide, and is as the mark (QIAGEN, Inc.9259 Eton Avenue, Chatsworth, CA, 91311) that provides in the pQE carrier, wherein many commercially available.Described in the Proc.Natl.Acad.Sci USA 86:821-824 (1989), the 6-Histidine makes fusion rotein be convenient to purifying as Gentz etc." HA " mark is the another kind of peptide that is used for purifying, and it is equivalent to the epi-position derived from influenza hemagglutinin protein, and this is by Wilson etc., described in the cell 37:767 (1984).As described below, other this fusion rotein is included in the KDI of N-or the terminal Fc of fusion of C-.The polynucleotide of variant and sudden change

The invention still further relates to the variant of nucleic acid molecule of the present invention, its encoded K DI a proteinic part, analogue or derivative.Variant can natural generation such as natural allele variant." allele variant " is meant one of several versions that occupy the gene of a locus on the body karyomit(e).Referring to, gene II, Lewin, B., ed., John Wiley ﹠amp; Sons, New York (1985).The variant that non-natural takes place can produce with induced-mutation technique known in the art.

This variant comprises by Nucleotide and replacing, those variants that disappearance or adding produce.Replace, disappearance or adding can comprise one or more Nucleotide.Variant can be in the coding region, and non-coding region or two districts all change.In the coding region, change and to produce conservative or non-conserved amino acid replacement, disappearance or adding.Wherein particularly preferably be reticent and replace, add and disappearance, it does not change the character and the activity of KDI albumen or its part.Conservative replacement also is particularly preferred.

Other embodiment comprises an isolated nucleic acid molecule, it comprises having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% is same as the polynucleotide that are selected from the nucleotide sequence of the polynucleotide of next group: (a) coding has the nucleotide sequence of the KDI polypeptide of complete amino acid sequence among the SEQ ID NO:2; (b) coding has except that the terminal methionine(Met) of N-, the nucleotide sequence of the KDI polypeptide of SEQ ID NO:2 complete amino acid sequence (being the 2-161 residue of SEQ ID NO:2); (c) coding has the nucleotide sequence of the ripe KDI polypeptide of sequence shown in 28～207 residues of SEQ ID NO:2; (d) nucleotide sequence of 165～183 residues of coding SEQ ID NO:2; (e) coding is by the nucleotide sequence that is included in the complete amino acid sequence of people cDNA coding among the clone HKAPI15; (f) coding is by the nucleotide sequence of complete amino acid sequence except that the terminal methionine(Met) of N-that is included in people cDNA coding among the clone HKAPI15; (g) coding is by the nucleotide sequence that is included in the aminoacid sequence of the mature polypeptide of people cDNA coding among the clone HKAPI15; (h) be complementary to above (a), (b), (c), (d), (e), (f), the nucleotide sequence of any nucleotide sequence (g) and (h).

Other embodiment of the present invention comprises isolated nucleic acid molecule, and it comprises having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% be same as above (a) (b) (c) (d) (e) (f) (g) or (h) in the polynucleotide of nucleotide sequence of any nucleotide sequence, or under stringent hybridization condition with above (a), (b), (c), (d), (e), (f), (g) or the polynucleotide of the multi-nucleotide hybrid (h).The polynucleotide of hybridization or not with the polynucleotide that only have the nucleotide sequence of being made up of A or T residue under stringent hybridization condition.Other nucleic acid embodiment of the present invention relates to an isolated nucleic acid molecule, and it comprises that coding has above (a), (b), (c), (d), (e), (f) or (g) in the polynucleotide of the aminoacid sequence that carries the epi-position part of KDI polypeptide of aminoacid sequence.

The invention still further relates to the recombinant vectors that contains isolated nucleic acid molecule of the present invention, contain the host cell of recombinant vectors, produce the method for this carrier and host cell, and utilize them to produce the method for KDI polypeptide or peptide by recombinant technology.

At least for example have the polynucleotide of the nucleotide sequence of the related nucleotide sequences of 95% " being same as " encoded K DI polypeptide and be meant that the nucleotide sequence of these polynucleotide is same as correlated series except this polynucleotide sequence comprises at the most 5 point mutation in per 100 Nucleotide of the related nucleotide sequences of encoded K DI polypeptide.In other words, for obtaining to have at least 95% polynucleotide that are same as the nucleotide sequence of related nucleotide sequences, in the related nucleotide sequences at the most 5% Nucleotide can lack or replace with other Nucleotide, or 5% the Nucleotide that accounts for complete nucleotide number in the correlated series can insert in the correlated series.These sudden changes of correlated series can occur in 5 ' or 3 ' terminal position of relevant nucleotide sequences, or betide between the terminal position Anywhere, independently be dispersed between the Nucleotide of correlated series or in correlated series one or more during base is organized continuously.

In fact, any specific nucleic acid molecule whether at least 90%, 95%, 96%, 97%, 98% or 99% is same as the cDNA clone's of nucleotide sequence shown in Figure 1 or preservation nucleotide sequence, can conventionally use known computer program such as Bestfit program (WisconsinSequence Analysis Package, Version 8 for Unix, Genetics ComputerGroup, University Research Park, 575 Science Drive, Madison, WI 53711) measure.Bestfit utilizes local homology's algorithm of Smith and Waterman to find the best homology segment (Advances in Applied Mathematics2:482-489 (1981)) between two sequences.When using Bestfit or any other sequence contrast program to measure a special sequence whether for example 95% when being same as according to correlated series of the present invention, set up parameter, thereby can on the total length related nucleotide sequences, calculate the homogeny percentage, and allow in the correlated series homology breach of complete nucleotide several 5% at the most.The best is mated fully between mensuration search sequence (sequence of the present invention) and the sample sequence, be also referred to as the correlated a kind of preferred method of overall sequence, availablely measure (Comp.App.Biosci. (1990) 6:237-245) as the FASTDB computer program of the formula of Brutlag etc. basically.In sequence contrast, inquiry and sample sequence all are dna sequence dnas.The RNA sequence can change T into by U and be contrasted.Described overall sequence comparing result is represented with the homogeny percentage.The FASTDB sequence contrast that is used for dna sequence dna to calculate percentile preferred parameter is: Matrix=Unitary, k-tuple=4, Mismatch Penalty=1, Joining Penalty=30, Randomization Group Length=0, Cutoff Score=l, Gap Penalty=5, GapSize Penalty=0.05, Window Size=500, or the length of sample nucleotide sequence, it is short to get both.

If sample sequence than the search sequence weak point, must carry out manual correction because of 5 ' or 3 ' disappearance but not because the inherence lacks to the result.This is because the FASTDB program reckons without the brachymemma of sample sequence 5 ' and 3 ' when calculating the homogeny percentage.For with respect to the sample sequence of search sequence in 5 ' or 3 ' terminal brachymemma, the homogeny percentage is proofreaied and correct by the percentage that the base number that calculates sample sequence 5 ' and the 3 ' not coupling/correlated search sequence of holding accounts for search sequence total alkali radix.Whether Nucleotide mates/contrast can be determined by FASTDB sequence comparing result.Then with this percentage ratio from by through the homogeny percentage that the FASTDB program is calculated, deducting, to obtain final homogeny percentage with special parameter.This proofreaies and correct the result and is used for the present invention.Only calculate by FASTDB sequence contrast displaying not with search sequence coupling/correlated base outside sample sequence 5 ' and 3 ' base to be used for artificially regulating the homogeny percentage.

For example, the search sequence of the sample sequence of 90 bases and 100 bases compares and measures the homogeny percentage.Disappearance occurs in 5 ' end of sample sequence, thereby the contrast of FASTDB sequence can not illustrate the coupling/contrast of 10 bases in 5 ' termination.These 10 unpaired bases are represented 10% (at 5 ' and 3 ' end base sum in the base number/search sequence of coupling not) of sequence, so this is 10% from deducting through the homogeny percentage that the FASTDB program is calculated.Final homogeny percentage is 90% if last 90 bases are mated fully.In another embodiment, the search sequence of the sample sequence of one 90 bases and 100 bases compares.Current disappearance is inner disappearance, thus sample sequence 5 ' or 3 ' terminal not with search sequence coupling/correlated base.Do not proofread and correct by hand at the homogeny percentage that in situation, calculates through FASTDB.Equally, when sample sequence has only 5 ' and 3 ' base not with search sequence coupling/contrast, proofread and correct by hand.The present invention does not need to carry out other manual correction.

The present invention relates at least 90%, 95%, 96%, 97%, 98% or 99% nucleic acid molecule that is same as the nucleotide sequence of DNA nucleotide sequence or preservation shown in Fig. 1 (SEQ ID NO:1), no matter whether they encode and have the active polypeptide of KDI.Even this is because special nucleic acid molecule is not encoded and had the active polypeptide of KDI, those skilled in the art still know how to use this nucleic acid molecule as for example hybridization probe or polymerase chain reaction (PCR) primer.The present invention uses nucleic acid molecule with the KDI active polypeptide isolating allele variant in the cDNA library of not encoding.

Yet preferably have at least 90%, 95%, 96%, 97%, 98% or 99% is same as the nucleic acid molecule of sequence of nucleotide sequence of the DNA of nucleotide sequence shown in Fig. 1 (SEQ ID NO:1) or preservation, and this molecule encoding has the polypeptide of KDI protein active." have the active polypeptide of KDI " and be meant that activity is similar to but the nonessential polypeptide that is same as KDI protein-active of the present invention in particular biological is analyzed.KDI protein for example of the present invention suppresses that external marrow colony forms and can be according to method (Interferon Cytokine Res, 1997, the Jun of Tiefenthaler M. etc.; 17 (6): 327-329, incorporate reference in full into) analyze.In addition, according to analytical method (immunological method magazine 1996.4.9 by reports such as Mire-Sluis A.R.; 195 (1-2): 55-61 incorporate reference into), it is the propagation of TF-1 that KDI can suppress GM-CSF inductive erythroleukemia cell.Perhaps, by analytical procedures more known in the art, for example by Sugiyama, (YakugakuZasshi 1,995 5 for the analytical method of report such as K; 115 (5): 390-393) can analyze the classical antiviral activity of KDI.

In above-mentioned analysis, KDI albumen of the present invention suppresses bone marrow proliferation and dosage is shown to rely on the mode antiviral activity.Therefore, " polypeptide with KDI protein-active " is included in and also is the identical active polypeptide of dosage dependence mode in the above-mentioned analysis.Although relying on level of activity, dosage need not be same as the proteic dosage degree of dependence of KDI, but preferably, " polypeptide " with KDI protein-active compare with KDI albumen given activity be similar substantially dose-dependently (be candidate's polypeptide will than relevant KDI albumen be greater activity or its active reduce be no more than about 25 times and preferably be no more than 10 times).

Certainly, because the degeneracy of genetic code, those skilled in the art will recognize in a large number to have at least 90% immediately, 95%, 96%, to the encode polypeptide of " having the KDI protein-active " of 97%, 98% or 99% nucleic acid molecule that is same as the sequence of nucleotide sequence shown in the nucleotide sequence of cDNA of preservation or Fig. 1 (SEQ ID NO:1).In fact, the phase homopolypeptide because the degeneracy variant of these nucleotide sequences is all encoded, even do not carry out above-mentioned comparative analysis, those skilled in the art also know this result.Those skilled in the art know also in addition that to have in right amount be not that this nucleic acid molecule of degeneracy variant is also encoded and had the polypeptide of KDI protein-active.This is because those skilled in the art fully know the less or not obvious protein function (for example with aliphatic amino acid of another aliphatic amino acid displacement) that influences of the aminoacid replacement that has.Carrier and host cell

The invention still further relates to the carrier that comprises isolated DNA molecule of the present invention, with the genetically engineered host cell of recombinant vectors, and by recombinant technology production KDI polypeptide or its fragment.Carrier for example can be phage, plasmid, virus or retroviral vector.Retrovirus can be replication-competent vector or replication-defective vector.Under the kind situation of back, virus multiplication only takes place in complementary host cell usually.

These polynucleotide can be connected to breed in the host with the carrier that contains selection marker.Usually, plasmid vector with throw out such as calcium phosphate precipitation thing or with the compound importing of charged lipid.If carrier is a virus, its available suitable packing cell ties up to external packing, and transduction is gone in the host cell then.

DNA inserts fragment and should be connected with suitable promotor effectively, as lambda particles phage PL promotor, and E.coli lac, trp, phoA and tac promotor, SV40 is in early days and the promotor of late promoter and retrovirus LTRs.The technician also knows other suitable promotor.Expression construct also comprises transcription initiation site, termination site and the translation ribosome bind site in transcriptional domain.The encoding part of the transcript of being expressed by construct preferably includes the translation initiation codon that is positioned at the polypeptide initiating terminal that is translated rightly and the terminator codon (UAA, UGA or UAG) of the terminal correct position of polypeptide.

Expression vector preferably includes at least one selective marker.This mark comprises the Tetrahydrofolate dehydrogenase for eukaryotic cell culture, and G418 or neomycin resistance are for tsiklomitsin, kantlex or the ampicillin resistance gene of E.coli and other bacterial cultures.Suitable host's representative example comprises but non-bacterial cell such as the E.coli of being limited to, streptomycete and salmonella typhimurium cell; Fungal cell such as yeast cell; Insect cell such as fruit bat S2 and Spodoptera St9 cell; Zooblast such as CHO, COS, 293 and the Bowes melanoma cells; And vegetable cell.The substratum of above-mentioned host cell known in the art and culture condition.

Preferred bacteria carrier comprises the pQE70 available from QIAGEN company, pQE60 and pQE09; Available from the PBS carrier of Stratagene, Phagescript carrier, Bluescript vector, pNH8A, pNH16a, pNH18A, pNH46A; With the ptrc99a available from Pharmacia, pKK223-3, pKK233-3, pDR540, pRIT5.Preferred eukaryotic vector is the pWLNEO available from Stratagene, pSV2CAT, pOG44, pXT1 and pSG; Reach pSVK3, pBPV, pMSG and pSVL available from Pharmacia.Those skilled in the art also know other suitable carrier.

Construct imports host cell can pass through calcium phosphate transfection, the transfection of DEAE-dextran mediation, and the transfection of cation lipid mediation, electroporation, transduction is infected or other method is carried out.These methods all are described in many standard test handbooks, as Davis etc., molecular biology basic skills (1986).

Polypeptide can be expressed by modified forms, as fusion rotein, and not only can comprise secretion signal, also can comprise other allos functional zone.For example, the especially charged amino acid of additional amino acid district can add the N-terminal of polypeptide, to improve it in purifying or operation subsequently and stability and the persistence of lay up period in host cell.Peptide motif also can add in the polypeptide to promote purifying.Remove before can in the end preparing polypeptide in this zone.Peptide motif is added polypeptide to realize secretion or to drain that improved stability and promotion purifying etc. are well known and routine techniques.One preferred fusion protein comprises the allos district from immunoglobulin (Ig), and it is used for stable and protein purification.For example, EP-A-0 464 533 (Canadian corresponding patent 2045869) has disclosed the fusion rotein that comprises various immunoglobulin (Ig) C district part and human body protein or its part.In many cases, the Fc of fusion rotein partly is used for diagnosis and treatment is very favorable, therefore for example produces the pharmacokinetic property (EP-A023262) of improvement.On the other hand, expressing with above-mentioned advantageous manner at fusion rotein, detect and purifying after, using for some needs disappearance Fc part, this is when partly confirming to hinder diagnosis as Fc and treating, in the situation when for example fusion rotein is used as immunoreactive antigen.Aspect drug development, human body protein for example hIL-5 with the Fc meromixis to differentiate the antagonist of hIL-5 by the high flux screening analysis.Referring to D.Bennett etc., molecular recognition magazine 8:52-58 (1995) and K.Johanson etc.Journal of biological chemistry 270:9459-9471 (1995).

KDI albumen notice well-known process comprises ammonium sulfate or ethanol sedimentation, acid extraction, positively charged ion or anion-exchange chromatography, the phosphorylated cotton chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite and lectin chromatography can reclaim from the reconstitution cell culture and purifying.More preferably use high performance liquid chromatography (HPLC) to carry out purifying.Polypeptide of the present invention comprises: purifying comprises body fluid from natural origin, the product of tissue and cell, and it can be directly isolating or cultivate; And originate from protokaryon or eucaryon host such as bacterium, yeast, higher plant, the product of insect and mammalian cell by recombinant technology.According to the host who is used for the recombinant production process, polypeptide of the present invention can be glycosylated or nonglycosylated.In addition, polypeptide of the present invention also can comprise the methionine residues of initial modification.Therefore, the terminal methionine(Met) of well known N-by the translation initiation codon coding generally after the translation, is removed from any protein in all eukaryotic cells efficiently.Although the terminal methionine(Met) of the N-on the most protein also can be removed in most of prokaryotic cell prokaryocytes effectively,, be invalid for this prokaryotic cell prokaryocyte process of removing of some protein according to the amino acid whose character that the terminal methionine(Met) covalent linkage of N-connects.Polypeptide and fragment

The present invention also provides the aminoacid sequence that has by the dna encoding of preservation, or the isolating KDI polypeptide of aminoacid sequence among the SEQID NO:2, or contains the peptide or the polypeptide of an aforementioned polypeptides part.Variant and mutant polypeptide

For the characteristic of improvement or change KDI polypeptide, can use protein engineering.Recombinant DNA technology well known by persons skilled in the art can be used for producing new mutant protein or " mutain ", comprises single or a plurality of aminoacid replacement, and disappearance adds or fusion rotein.The albumen of this modification can illustrate the stability that enhanced for example is active or improve.In addition, they can the high yield purifying and are presenting better solvability at least under certain purifying and storage requirement than corresponding natural polypeptides.Terminal and the C-terminal deletion mutant of N-

For example, some protein are comprised the extracellular region of embrane-associated protein or the mature form of secretory protein, one or more amino acid known in the art can be from N-end or C-terminal deletion and is not lost biological function substantially.For example, Ron etc. lack 3,8 or 27 aminoterminal amino-acid residues in journal of biological chemistry 268:2984～2988 (1993) even reported the KGF albumen of modifying, and still have heparin binding activity.In this article, because protein of the present invention is the interferon polypeptides family member, SEQ ID NO:2N end amino acid still can keep some biological activitys such as antiviral activity or suppress bone marrow proliferation until the disappearance of 59 halfcystines shown in the SEQ ID NO:2.Have the polypeptide that comprises the further N-terminal disappearance of Cys-59 residue among the SEQ ID NO:2 and can not keep this biological function, because this residue in the Interferon, rabbit related polypeptide is guarded in some (non-whole) family members, the leucine residue (60 residues) that is close to it also is like this.Being considered to form the required of disulfide linkage at 59 cysteine residues, is the required structural stability of receptors bind and signal transduction with the assurance.

Yet even one or more amino acid causes one or more biological function forfeiture of protein to change from the protein N terminal deletion, other biological activity still can keep.Therefore, the ability of the antibody of the protein induce of shortening and/or combination identification whole protein is when the whole protein residue that is less than half generally still is retained when N-terminal is removed.Whether the specific polypeptide of disappearance whole protein N-terminal residue keeps this immunocompetence can be measured by ordinary method described herein and other method known in the art.

Therefore the present invention also provides and has had one or more disappearance from the polypeptide of KDI aminoacid sequence N-terminal shown in the SEQ ID NO:2 until the residue of Cys-59, and the polynucleotide of this peptide species of coding.The present invention especially provides the polypeptide of the aminoacid sequence of the n-207 position residue that comprises SEQ ID NO:2, wherein n is the integer in 1～59 scope, and Cys-59 be sure of to be required first residue from complete KDI polypeptide (shown in SEQ ID NO:2) N-end of KDI protein-active.

The present invention especially provides the polypeptide of the aminoacid sequence of the following residue with SEQ ID NO:2: 1～207,2～207,3～207,4～207,5～207,6～207,7～207,8～207,9～207,10～207,11～207,12～207,13～207,14～207,15～207,16～207,17～207,18～207,19～207,20～207,21～207,22～207,23～207,24～207,25～207,26～207,27～207,28～207,29～207,30～207,31～207,32～207,33～207,34～207,35～207,36～207,37～207,38～207,39～207,40～207,41～207,42～207,43～207,44～207,45～207,46～207,47～207,48～207,49～207,50～207,51～207,52～207,53～207,54～207,55～207,56～207,57～207,58～207 and 59～207, the polynucleotide of these polypeptide of encoding also are provided.

Similarly, the example of the proteic biological function of known many C-terminal deletion mutantions.For example, gamma-interferon presents active the raising near 10 times (Dobeli etc., biotechnics magazine 7:199-216 (1988)) by 8～10 amino-acid residues of disappearance protein C-terminal.In the present invention, because protein of the present invention is the interferon polypeptides family member, the C-terminal amino acid of SEQ IDNO:2 still can keep some biological activitys such as antiviral activity or suppress bone marrow proliferation until 183 tryptophan residue disappearance.Polypeptide with further C-terminal deletion of the Ile-183 that comprises SEQ ID NO:2 presents can not keep this biological activity, because this residue is guarded in many members in the plain related polypeptide of known disturbances, and to be considered to receptors bind and signal transduction be important.In addition, 181 halfcystines be high conservative and known be that Interferon, rabbit family member antiviral activity is required.

Yet,, but still can keep other biological activity even one or more aminoacid deletion of c-terminal of protein causes one or more loss of bioactivity.Therefore the ability of the antibody of whole protein is discerned in protein induce that shortens and/or combination.When the residue of the whole protein that is less than half generally is retained when C-terminal is removed.Whether the specific polypeptide of disappearance whole protein C-terminal residue keeps this immunocompetence can be easy to measure by ordinary method described herein and other method known in the art.

Therefore the present invention also provide have disappearance from the C-terminal of KDI aminoacid sequence shown in the SEQ ID NO:2 until one or more the amino acid whose polypeptide of Trp-183 and the polynucleotide of this peptide species of encoding.The invention provides the polypeptide of aminoacid sequence in particular with SEQ ID NO:2 aminoacid sequence 1～m residue, wherein m is any integer in 183～207 scopes, and residue Trp-183 is first residue position of be sure oing for the required complete KDI polypeptide of KDI protein-active (shown in SEQ ID NO:2) C-terminal.

More specifically, the invention provides the polypeptide of the aminoacid sequence of following residue: 1-183,1-184,1-185,1-186 with SEQ ID NO:2,1-187,1-188,1-189,1-190,1-191,1-192,1-193,1-194,1-195,1-196,1-197,1-198,1-199,1-200,1-201,1-202,1-203,1-204,1-205,1-206 and 1-207.The polynucleotide of these polypeptide of encoding also are provided.

The present invention also provides has the amino acid whose polypeptide of one or more disappearance from amino and C-terminal, and it is described to have the n-m residue of SEQ ID NO:2 usually, and wherein n and m are aforesaid integers.In addition, the invention provides these mutant polypeptides that randomly have the N-terminal methionine(Met).This polypeptide thereby also available formula X-n-m representative, wherein X is NH2 or Met, n and m are as above-mentioned integer.The polynucleotide of these polypeptide of encoding also are provided certainly.

More specifically, the present invention is preferably provided having SEQ ID NO: 2 of the following residues Polypeptide amino acid sequence: 20-183,21-183,22-183,23-183,24-183,25-183,26-183,27-183, 28-183,29-183,30-183,31-183,32-183,33-183,34-183,35-183,36-183,37-183,38-183, 39-183,40-183,41-183,42-183,43-183,44-183,45-183,46-183,47-183,48-183,49-183, 50-183,51-183,52-183,53-183,54-183,55-183,56-183,57-183,58-183,59-183,20-184, 21-184,22-184,23-184,24-184,25-184,26-184,27-184,28-184,29-184,30-184,31-184, 32-184,33-184,34-184,35-184,36-184,37-184,38-184,39-184,40-184,41-184,42-184, 43-184,44-184,45-184,46-184,47-184,48-184,49-184,50-184,51-184,52-184,53-184, 54-184,55-184,56-184,57-184,58-184,59-184,20-185,21-185,22-185,23-185,24-185, 25-185,26-185,27-185,28-185,29-185,30-185,31-185,32-185,33-185,34-185,35-185, 36-185,37-185,38-185,39-185,40-185,41-185,42-185,43-185,44-185,45-185,46-185, 47-185,48-185,49-185,50-185,51-185,52-185,53-185,54-185,55-185,56-185,57-185, 58-185,59-185,20-186,21-186,22-186,23-186,24-186,25-186,26-186,27-186,28-186, 29-186,30-186,31-186,32-186,33-186,34-186,35-186,36-186,37-186,38-186,39-186, 40-186,41-186,42-186,43-186,44-186,45-186,46-186,47-186,48-186,49-186,50-186, 51-186,52-186,53-186,54-186,55-186,56-186,57-186,58-186,59-186,20-187,21-187, 22-187,23-187,24-187,25-187,26-187,27-187,28-187,29-187,30-187,31-187,32-187, 33-187,34-187,35-187,36-187,37-187,38-187,39-187,40-187,41-187,42-187,43-187, 44-187,45-187,46-187,47-187,48-187,49-187,50-187,51-187,52-187,53-187,54-187, 55-187,56-187,57-187,58-187,59-187,20-188,21-188,22-188,23-188,24-188,25-188, 26-188,27-188,28-188,29-188,30-188,31-188,32-188,33-188,34-188,35-188,36-188, 37-188,38-188,39-188,40-188,41-188,42-188,43-188,44-188,45-188 46-188,47-188, 48-188,49-188,50-188,51-188,52-188,53-188,54-188,55-188,56-188,57-188,58-188, 59-188,20-189,21-189,22-189,23-189,24-189,25-189,26-189,27-189,28-189,29-189, 30-189,31-189,32-189,33-189,34-189,35-189,36-189,37-189,38-189,39-189,40-189, 41-189,42-189,43-189,44-189,45-189,46-189,47-189,48-189,49-189,50-189,51-189, 52-189,53-189,54-189,55-189,56-189,57-189,58-189,59-189,20-190,21-190,22-190, 23-190,24-190,25-190,26-190,27-190,28-190,29-190,30-190,31-190,32-190,33-190, 34-190,35-190,36-190,37-190,38-190,39-190,40-190,41-190,42-190,43-190,44-190, 45-190,46-190,47-190,48-190,49-190,50-190,51-190,52-190,53-190,54-190,55-190, 56-190,57-190,58-190,59-190,20-191,21-191,22-191,23-191,24-191,25-191,26-191, 27-191,28-191,29-191,30-191,31-191,32-191,33-191,34-191,35-191,36-191,37-191, 38-191,39-191,40-191,41-191,42-191,43-191,44-191,45-191,46-191,47-191,48-191, 49-191,50-191,51-191,52-191,53-191,54-191,55-191,56-191,57-191,58-191,59-191, 20-192,21-192,22-192,23-192,24-192,25-192,26-192,27-192,28-192,29-192,30-192, 31-192,32-192,33-192,34-192,35-192,36-192,37-192,38-192,39-192,40-192,41-192, 42-192,43-192,44-192,45-192,46-192,47-192,48-192,49-192,50-192,51-192,52-192, 53-192,54-192,55-192,56-192,57-192,58-192,59-192,20-193,21-193,22-193,23-193, 24-193,25-193,26-193,27-193,28-193,29-193,30-193,31-193,32-193,33-193,34-193, 35-193,36-193,37-193,38-193,39-193,40-193,41-193,42-193,43-193,44-193,45-193, 46-193,47-193,48-193,49-193,50-193,51-193,52-193,53-193,54-193,55-193,56-193, 57-193,58-193,59-193,20-194,21-194,22-194,23-194,24-194,25-194,26-194,27-194, 28-194,29-194,30-194,31-194,32-194,33-194,34-194,35-194,36-194,37-194,38-194, 39-194,40-194,41-194,42-194,43-194,44-194,45-194,46-194,47-194,48-194,49-194, 50-194,51-194,52-194,53-194,54-194,55-194,56-194,57-194,58-194,59-194,20-195, 21-195,22-195,23-195,24-195,25-195,26-195,27-195,28-195,29-195,30-195,31-195, 32-195,33-195,34-195,35-195,36-195,37-195,38-195,39-195,40-195,41-195,42-195, 43-195,44-195,45-195,46-195,47-195,48-195,49-195,50-195,51-195,52-195,53-195, 54-195,55-195,56-195,57-195,58-195,59-195,20-196,21-196,22-196,23-196,24-196, 25-196,26-196,27-196,28-196,29-196,30-196,31-196,32-196,33-196,34-196,35-196, 36-196,37-196,38-196,39-196,40-196,41-196,42-196,43-196,44-196,45-196,46-196, 47-196,48-196,49-196,50-196,51-196,52-196,53-196,54-196,55-196,56-196,57-196, 58-196,59-196,20-197,21-197,22-197,23-197,24-197,25-197,26-197,27-197,28-197, 29-197,30-197,31-197,32-197,33-197,34-197,35-197,36-197,37-197,38-197,39-197, 40-197,41-197,42-197,43-197,44-197,45-197,46-197,47-197,48-197,49-197,50-197, 51-197,52-197,53-197,54-197,55-197,56-197,57-197,58-197,59-197,20-198,21-198, 22-198,23-198,24-198,25-198,26-198,27-198,28-198,29-198,30-198,31-198,32-198, 33-198,34-198,35-198,36-198,37-198,38-198,39-198,40-198,41-198,42-198,43-198, 44-198,45-198,46-198,47-198,48-198,49-198,50-198,51-198,52-198,53-198,54-198, 55-198,56-198,57-198,58-198,59-198,20-199,21-199,22-199,23-199,24-199,25-199, 26-199,27-199,28-199,29-199,30-199,31-199,32-199,33-199,34-199,35-199,36-199, 37-199,38-199,39-199,40-199,41-199,42-199,43-199,44-199,45-199,46-199,47-199, 48-199,49-199,50-199,51-199,52-199,53-199,54-199,55-199,56-199,57-199,58-199, 59-199,20-200,21-200,22-200,23-200,24-200,25-200,26-200,27-200,28-200,29-200, 30-200,31-200,32-200,33-200,34-200,35-200,36-200,37-200,38-200,39-200,40-200, 41-200,42-200,43-200,44-200,45-200,46-200,47-200,48-200,49-200,50-200,51-200, 52-200,53-200,54-200,55-200,56-200,57-200,58-200,59-200,20-201,21-201,22-201, 23-201,24-201,25-201,26-201,27-201,28-201,29-201,30-201,31-201,32-201,33-201, 34-201,35-201,36-201,37-201,38-201,39-201,40-201,41-201,42-201,43-201,44-201, 45-201,46-201,47-201,48-201,49-201,50-201,51-201,52-201,53-201,54-201,55-201, 56-201,57-201,58-201,59-201,20-202,21-202,22-202,23-202,24-202,25-202,26-202, 27-202,28-202,29-202,30-202,31-202,32-202,33-202,34-202,35-202,36-202,37-202, 38-202,39-202,40-202,41-202,42-202,43-202,44-202,45-202,46-202,47-202,48-202, 49-202,50-202,51-202,52-202,53-202,54-202,55-202,56-202,57-202,58-202,59-202, 20-203,21-203,22-203,23-203,24-203,25-203,26-203,27-203,28-203,29-203,30-203, 31-203,32-203,33-203,34-203,35-203,36-203,37-203,38-203,39-203,40-203,41-203, 42-203,43-203,44-203,45-203,46-203,47-203,48-203,49-203,50-203,51-203,52-203, 53-203,54-203,55-203,56-203,57-203,58-203,59-203,20-204,21-204,22-204,23-204, 24-204,25-204,26-204,27-204,28-204,29-204,30-204,31-204,32-204,33-204,34-204, 35-204,36-204,37-204,38-204,39-204,40-204,41-204,42-204,43-204,44-204,45-204, 46-204,47-204,48-204,49-204,50-204,51-204,52-204,53-204,54-204,55-204,56-204, 57-204,58-204,59-204,20-205,21-205,22-205,23-205,24-205,25-205,26-205,27-205, 28-205,29-205,30-205,31-205,32-205,33-205,34-205,35-205,36-205,37-205,38-205, 39-205,40-205,41-205,42-205,43-205,44-205,45-205,46-205,47-205,48-205,49-205, 50-205,51-205,52-205,53-205,54-205,55-205,56-205,57-205,58-205,59-205,20-206, 21-206,22-206,23-206,24-206,25-206,26-206,27-206,28-206,29-206,30-206,31-206, 32-206,33-206,34-206,35-206,36-206,37-206,38-206,39-206,40-206,41-206,42-206, 43-206,44-206,45-206,46-206,47-206,48-206,49-206,50-206,51-206,52-206,53-206, 54-206,55-206,56-206,57-206,58-206 and 59-206 ...

Aforementioned each polypeptide can comprise the terminal methionine residues of N-in addition.Also provide and encoded that each has or do not have the polynucleotide of these polypeptide of the terminal methionine residues of N-.

The present invention also comprises the polypeptide of being made up of the part of the complete KDI aminoacid sequence of people cDNA coding among the clone HKAPI15, wherein this part does not comprise complete amino acid sequence N-terminal 1～about 58 amino acids of people cDNA coding among the clone HKAPI15, or C-terminal 1～about 23 amino acids, or the above-mentioned amino-terminal end of the complete amino acid sequence that people cDNA encodes among the clone HKAPI15 and any combination of carboxyl-terminal deletion.The present invention also provides the polynucleotide of all above-mentioned deletion mutant polypeptide of encoding.Other mutant

Except that above-mentioned protein terminal disappearance form, art technology will recognize that also some aminoacid sequences of KDI polypeptide can not obviously influence protein structure or function and change.If relate to the difference in this sequence, should remember on protein, to have definite active key area.

Therefore, the present invention also comprises the KDI variant polypeptides, and it presents the activity of KDI polypeptide, or it comprises the zone of the proteinic part as described below of KDI.This mutant comprises disappearance, inserts, and inversion repeats and according to the replacement type that general rule known in the art is selected, activity had only minimal effect.For example, Bowie, J.V. wait " deciphering information in the protein sequence: " to the tolerance of aminoacid replacement, provide among the science 247:1306-1310 (1990) about how to produce the guidance that the phenotype silent amino acid replaces, wherein the author indicates the tolerance of two kinds of main method research aminoacid sequences to changing.First method depends on evolutionary process, wherein admits by natural selection or the repulsion sudden change.Second method is carried out the amino acid transposing with genetic engineering at the specific position of cloned genes, and selects or screen to differentiate the sequence of reservation function.

As the author said, these research announcement protein tolerate aminoacid replacement very much.As if the author also indicate the amino acid transposing and allow at proteinic certain position.For example, most of hidden amino-acid residues require non-polar sidechain, and the feature of surface side chains is generally seldom guarded.The reticent replacement of other this phenotype sees Bowie, and J.U. etc. are described, and incorporate reference at this.Typical conservative the replacement is aliphatic amino acid Ala, Val, the displacement each other between Leu and the Ile; The exchange of hydroxyl residue Ser and Thr, the displacement of acidic residues Asp and Glu, the replacement between amide residues Asn and Gln, the displacement of alkaline residue Lys and Arg, and aromatic residue Phe, the displacement between Tyr.

Therefore, the polypeptide of SEQ ID NO:2 or by the analogue of the cDNA encoded polypeptides of preservation or derivative or fragment can be (ⅰ) wherein one or more amino-acid residue be to replace with conservative or nonconservative amino-acid residue (preferred conservative amino-acid residue), and the amino-acid residue of this replacement can yes or no by the genetic code coding, or (ⅱ) wherein one or more amino-acid residue comprise substituted radical, or (ⅲ) wherein the KDI polypeptide be to merge as the compound (for example polyoxyethylene glycol) that improves the polypeptide transformation period with other compound, or (ⅳ) wherein the polypeptide of additional amino acid and above form merge, as IgG Fc corresponding circle of sensation peptide or leading or secretion sequence or be used for the sequence or the proteinogen sequence of the above form polypeptide of purifying.This fragment, derivative and analogue are thought by those skilled in the art according to this paper instruction and are included in the present invention.

Therefore, polypeptide of the present invention can comprise one or more aminoacid replacement by spontaneous mutation or manual operation, disappearance or adding.As mentioned above, amino acid change is preferably less, replaces as not obvious protein folding or the active conserved amino acid of influencing.

Can differentiate by means known in the art for the necessary amino acid of function in the KDI protein of the present invention, as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, science 244:1081～1085 (1989).A kind of method in back each residue in molecule is introduced the single alanine sudden change.Test the biological activity of gained mutant molecule then, as receptors bind or in-vitro multiplication activity.

Interested especially is to replace polare Aminosaeren with producing other polarity or neutral amino acids with required obvious improved characteristics such as less aggregation.Aggregation not only reduces activity when accumulating in the preparation formula of medicine and also can have problems, because can be immunogenic.(Pinckard etc., Clin.Exp.Immunol, 2:331-340 (1967); Robbins etc., Diabetes 36:838-845 (1987); Cleland etc., Crit.Rev.Therapeutic DrugCarrier Systems 10:307-377 (1993).

Amino acid whose displacement also can change part pair cell surface receptor bonded selectivity.For example, Ostade etc. in natural 361:266-268 (1993), set forth cause TNF-α only with some sudden changes of one of two kinds of known TNF acceptors selective binding.The critical site of ligand-receptor bonded also can be definite by structural analysis, as crystallization, and nucleus magnetic resonance or photoaffinity labeling.(Smith etc., molecular biology magazine 224:899-904 (1992) and Vos etc., science 255:306-312 (1992)).

The particularly preferred replacement of each KDI polypeptide as herein described is to replace (hereinafter being sometimes referred to as " R192K ") 192 arginine residues with Methionin, and replaces (hereinafter being sometimes referred to as " C193S ") at 193 cysteine residues with Serine.These replacements can find in independent KDI polypeptide that perhaps they can take place in identical KDI polypeptide.The polynucleotide of all aforementioned KDI polypeptide of encoding all contain replacement.

Preferably unpack format and the preferably basic purifying of polypeptide of the present invention.The KDI polypeptide that reorganization produces can be by in the single stage method described in the gene 67:31-40 (1988) and the basic purifying of Smith and Johnson.Polypeptide of the present invention also can pass through method of purifying protein well known in the art, with anti-KDI antibody of the present invention purifying from natural or recombinant sources.

The present invention also provides and has contained the isolating KDI polypeptide that is selected from by with next aminoacid sequence of forming: the total length KDI amino acid sequence of polypeptide that (a) has complete amino acid sequence shown in the SEQ ID NO:2; (b) have the total length KDI amino acid sequence of polypeptide (be 2～207 residues of SEQ ID NO:2) of complete amino acid sequence shown in the SEQ ID NO:2 except that the terminal methionine(Met) of N-; (c) ripe KDI amino acid sequence of polypeptide shown in 28～207 residues shown in the SEQ ID NO:2; (d) aminoacid sequence shown in 165～183 residues among the SEQ ID NO:2; (e) the total length KDI polypeptide of encoding by the people cDNA that comprises among the clone HKAPI15; (f) the total length KDI polypeptide except that the N-terminal methionine(Met) of encoding by the people cDNA that comprises among the clone HKAPI15; And the ripe KDI polypeptide of (g) encoding by the people cDNA that comprises among the clone HKAPI15.

Polypeptide of the present invention also comprises and above-mentioned those polypeptides 90% at least, preferably at least 95%, and more preferably at least 96%, 97%, 98% or 99% similar polypeptide.Polypeptide of the present invention also comprise with by the polypeptide of the dna encoding of preservation or the polypeptide at least 80% of SEQ ID NO:2, preferably at least 90% or 95%, more preferably at least 96%, 97%, 98% or 99% identical polypeptide, and also comprise and have this peptide species at least 10,20 or 30 amino acid and more preferably at least 50 amino acid whose parts.

Another embodiment of the present invention relates to a kind of peptide or polypeptide, it comprises having and contains at least one conserved amino acid and replace, but be no more than 50, preferably be no more than 40, more preferably no more than 30, especially preferably be no more than the KDI amino acid sequence of polypeptide of the aminoacid sequence of 20 conserved amino acids replacements.Certainly, this peptide or polypeptide most preferably comprise the aminoacid sequence of KDI polypeptid acid sequence, and it contains at least one, but are no more than 10,9,8,7,6,5,4,3,2 or 1 conserved amino acid sequences.

" the similar percentage " of two peptide species is meant with Bestfit program (Wisconsin SequenceAnalysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575, Science Drive, Madison, WI 53711) reach the default setting of determining similarity, contrast the similarity of the aminoacid sequence generation of two peptide species.Bestfit is with local homology's algorithm (Advances inApplied Mathematics 2:482-489,1981) of Smith and Waterman, to find best section similar between two sequences.

At least for example have the polypeptide of the aminoacid sequence of the IL-20 amino acid sequence of polypeptide of 95% " being same as " reference and be meant except this peptide sequence and in per 100 amino acid of the IL-20 of reference amino acid sequence of polypeptide, comprise 5 amino acid changes at the most that this amino acid sequence of polypeptide is same as search sequence.In other words, for obtaining to have at least 95% polypeptide that is same as the aminoacid sequence of inquiry aminoacid sequence, in the search sequence at the most 5% amino-acid residue can lack or use other aminoacid replacement, or the amino acid that accounts for total amino acid residue several 5% can insert canonical sequence.These variations of canonical sequence can occur between the amino of canonical sequence or C-terminal position or these terminal positions Anywhere, independently are dispersed between the residue of canonical sequence or between canonical sequence one or more continuously in the group.

In fact, any special peptides whether at least 90%, 95%, 96%, 97%, 98% or 99% is same as aminoacid sequence shown in the SEQ ID NO:2 for example or by the aminoacid sequence of the cDNA clones coding of preservation, common available known computer program such as Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Prive, Madison W153711) determines.When determining that with Bestfit or other sequence contrast program a special sequence is whether for example 95% when being same as canonical sequence of the present invention, certainly to set up parameter, so on the total length canonical sequence, calculate the homogeny percentage, and allow in the canonical sequence homology breach that accounts for total amino acid residue several 5% is at the most arranged.A kind of preferred best overall method of matching between search sequence (sequence of the present invention) and sample sequence of determining, be also referred to as overall sequence contrast, can with basically as the FASTDB computer program of the algorithm of Brutlay etc. definite (Comp.App.Biosci (1990) 6; 237-245).In the sequence contrast, inquiry and sample sequence all are nucleotide sequences or all are aminoacid sequences.Described overall sequence is correlated result represent with the homogeny percentage.The preferred parameter that is used for the contrast of FASTDB aminoacid sequence is: Matrix=PAM, k-tuple=2, Mismatch Penalty=1, JoiningPenalty=20, Randomization Group Length=0, Cutoff Score=1, the WindowSize=sequence is long, Gap Penalty=5, Gap Size Penalty=0.05, the length of Window Size=500 or sample aminoacid sequence is got short.

If sample sequence is because N-or C-terminal deletion rather than shorter than search sequence because of inner disappearance, must carry out manual correction to the result, this is because the FASTDB program reckons without sample sequence N-and the terminal brachymemma of C-when calculated population homogeny percentage.To compare the sample sequence in N end and the brachymemma of C end with search sequence, the homogeny percentage accounts for the total base percentage of search sequence and is proofreaied and correct by the not coupling/correlated search sequence residue number that calculates sample sequence N and C-end.Whether residue matches/contrast can be determined by FASTDB sequence comparing result.This percentage ratio is deducted from the homogeny percentage to obtain final homogeny percentage scope then, the homogeny percentage calculates by above FASTDB program with special parameter.It is used that this final homogeny percentage is the present invention.Do not have only and need artificially regulate homogeny percentage scope with the N and the C end residue of search sequence pairing/correlated sample sequence.Promptly has only inquiry residue position outside sample sequence N and C end residue farthest.

For example, the homogeny percentage is determined in the contrast of the search sequence of the sample sequence of 90 amino-acid residues and 100 residues.Disappearance occurs in the N end of sample sequence, thereby the FASTDB sequence contrasts the pairing/contrast of 10 residues in not shown N termination.These 10 unpaired residues are represented 10% (holding total residue number in unpaired residue number/search sequence at N and C) of sequence, so this 10% deducts from the homogeny percentage that calculates by the FASTDB program.If remaining 90 residues fully match, then final homogeny percentage is 90%.In another embodiment, the search sequence of the sample sequence of 90 residues and 100 residues compares.Current disappearance is inner disappearance, thus the N of sample sequence or C end not with search sequence pairing/correlated residue.In this case, the homogeny percentage that calculates by FASTDB is not proofreaied and correct by hand.Equally, the residue position of having only sample sequence N and the C end outside needs correction by hand by FASTDB calculation result during not with search sequence pairing/contrast.The present invention does not need other manual correction.

Polypeptide of the present invention can be used as on the SDS-PAGE gel or the molecular weight marker on the molecular sieve gel filtration column with method well known to those skilled in the art.

As described below, polypeptide of the present invention also can be used for producing polyclone and monoclonal antibody, and it is used for the analysis of detection KDI protein expression as described below, or as the stimulant and the antagonist that can strengthen or suppress the KDI protein function.In addition, this peptide species can be used for the dual crossing system of yeast with " seizure " KDI protein-binding protein, and it also is according to candidate agonist of the present invention and antagonist.The dual crossing system of this yeast sees Fields and Song, described in the natural 340:245-246 (1989).Carry the epi-position part

On the other hand, the invention provides and comprise that polypeptide of the present invention carries the peptide or the polypeptide of epi-position part.The epi-position of this polypeptide portion is the immunogenicity or the antigenic epitopes of polypeptide of the present invention." immunogenicity epi-position " is meant a proteinic part that excites antibody response when whole protein is immunogen.On the other hand, " antigenic epitopes " is meant a zone of antibody capable bonded protein molecule.Protein immunogenicity epi-position number is less than the antigenic epitopes number usually.For example be illustrated in Geysen etc., Proc.Natl.Acad.Sci.USA 81:3998-4002 (1983).

For selecting to have the peptide or the polypeptide (the antibody capable bonded zone of promptly containing protein molecule) of antigenic epitopes, the short relatively synthetic peptide of well known simulated albumin matter sequence part can excite the antiserum(antisera) with the proteins react of partial simulation usually.For example see Sutcliffe, J.G.Shinnick, T.M., Green, N.and Learner, R.A. (1983) " with the pre-antibody of determining the site reaction on the protein ", science 219:660～666.Can elicitor protein the peptide of qualitative response serum usually with proteinic primary sequence representative, can be qualitative, and be restricted to neither the immunodominance district of whole protein (being the immunogenicity epi-position) by a series of easy chemical rule, neither amino or carboxyl terminal.Peptide with antigenic epitopes of the present invention and polypeptide thereby be used to produce antibody comprise the monoclonal antibody with polypeptide specific combination of the present invention.For example referring to Wilson etc., cell 37:767-778 (1984) is at 777 pages.

Peptide and the polypeptide that carries antigenic epitopes of the present invention preferably contains at least 7, and more preferably at least 9, most preferably about 15～30 amino acid whose sequences that are contained in the amino acid sequence of polypeptide of the present invention.Can be used for producing the antigenic polypeptide of KDI specific antibody or the limiting examples of peptide comprises: comprise among the SEQ ID NO:2 the approximately polypeptide of Ser49～Ser54 amino-acid residue; The polypeptide that comprises Cys59 among the SEQ ID NO:2～Ala65 amino-acid residue; The polypeptide that comprises Pro78 among the SEQ ID NO:2～Tyr88 amino-acid residue; The polypeptide that comprises Hisl01 among the SEQ ID NO:2～Gln113 amino-acid residue; The polypeptide that comprises Glnl20 among the SEQ IDNO:2～Glu123 amino-acid residue; The polypeptide that comprises Cys128 among the SEQ ID NO:2～Pro155 amino-acid residue; The polypeptide that comprises Leu160 among the SEQ ID NO:2～Arg168 amino-acid residue; The polypeptide that comprises Asn171 among the SEQ ID NO:2～Asp180 amino-acid residue; The polypeptide that comprises Val186 among the SEQ ID NO:2～Cys193 amino-acid residue; The polypeptide that comprises Phe 204～Lys207 amino-acid residue among the SEQ ID NO:2.These polypeptide fragments have determined that by Jameson-Wolf antigenicity index analysis it carries the proteinic antigenic epitopes of KDI, as shown in Figure 3.

Peptide and the polypeptide that carries epi-position of the present invention can be produced by conventional methods.For example see Houghten, RA. (1985) " common method of the quick a large amount of peptides of solid phase synthesis: " Proc.Natl.Acad.Sci.USA82:5131～5135 in the specificity of independent amino acid levels antigen-antibody interaction; This " simultaneously a large amount of peptides synthetic (SMPS) " method also sees Houghten etc. (1986) described in the U.S. Patent No. 4631211.

Peptide and the polypeptide that carries epi-position of the present invention is used to induce antibody according to well known method.For example see Sutcliffe etc.; Aforementioned, Wilson etc.; Aforementioned, Chow, Proc.Natl.Accd.Sci.USA 82:910-914 such as M; And F.J. etc., J.Gen.Virol 66:2347-2354 (1985) is described.The peptide that carries the immunogenicity epi-position of the present invention promptly when whole protein is immunogen, excites proteinic those parts of antibody response, differentiates according to means known in the art.It is described for example to see Geysen etc.In addition, the U.S. Patent No. 5194392 of Geysen (1990) has been set forth a kind of method that detects or determine monomer (amino acid or other compound) sequence that is epi-position topology Equivalent (i.e. " mimotope "), and this sequence monomer is complementary to the special paratope (antigen binding site) of corresponding antibodies.The U.S. Patent No. 443092 of Geysen (1989) has been set forth a kind of method that detects or determine the monomeric sequence that is part homeomorphic thing, and this sequence monomer is complementary to the ligand-binding site point of respective specific acceptor.Similarly, Houghten, R.A. etc. (1996) have disclosed series and the library that linear C1-C7-alkyl is crossed alkylation oligopeptides and this peptide about the U.S. Patent No. 5480971 of crossing alkylating oligo peptide, and the method for determining preferentially to cross with corresponding acceptor molecule bonded the sequence of alkylating oligopeptides with this oligopeptides series and library.Therefore, the present invention's non-peptide analogs of carrying the peptide of epi-position also can be produced by these methods are conventional.

Fused protein

Those skilled in the art will understand that KDI polypeptide of the present invention and the above-mentioned fragment that it carries epi-position can partly make up with the constant region of immunoglobulin (Ig) (IgG), produce chimeric polyeptides.These fusion roteins promote purifying, and present transformation period prolongation in the body.Fusion rotein (the EPA394827:Traunecker etc. that form by each structural domain of the weight of two structural domains of people CD4-polypeptide and mammalian immune sphaeroprotein or constant region of light chain have for example been disclosed; Nature 331:84-86 (1988)).The fusion rotein that has the disulfide linkage dimeric structure owing to IgG part in conjunction with and other molecule that neutralizes aspect than monomer KDI albumen or protein fragments more effective (Fountoulakis etc., journal of biological chemistry 270:3958-3964 (1995)).

Antibody

Being used for KDI protein specific antibody of the present invention can be at complete KDI albumen or its antigenic polypeptide fragment and produce, it can be presented with the albumin of carrier proteins such as animal (as rabbit or mouse), if perhaps its sufficiently long (about at least 25 amino acid) is then without carrier.

Term used herein " antibody " (Ab) or " monoclonal antibody " (Mab) comprise can with the complete molecule of KDI albumen specific combination and antibody fragment (for example Fab and F (ab ') 2 fragments).Fab and F (ab ') 2 fragments lack the Fc fragment of complete antibody, quicker removing from circulation, and can have the non-specific tissue associativity (Wahl etc., J.Nucl.Med 24:316-325 (1983)) that is lower than complete antibody.Therefore these fragments are preferred.

Antibody of the present invention can pass through prepared in various methods.For example, expressing K DI protein or the segmental cell of its antigenicity can be applied to animal, produce to induce the serum that contains polyclonal antibody.In a preferred method, prepare KDI protein and purifying in advance so that it does not have natural pollutant basically.Then this prepared product is imported animal to produce the polyclonal antiserum of higher specific activity.

In a preferred method, antibody of the present invention is monoclonal antibody (or its KDI protein bound fragment).This monoclonal antibody can prepare (Kohler etc., natural 256:495 (1975) with hybridoma technology; Kohler etc., European Journal of Immunology 6:511 (1976); Kohler etc., European Journal of Immunology 6:292 (1976); Hammerling etc., monoclonal antibody and T quadroma, Elsevier, N.Y., (1981) PP 563-681).Usually, this method comprises with the KDI proteantigen or preferably uses the proteinic cell inoculation animal of expressing K DI (preferred mouse).Can discern suitable cell by its ability in conjunction with anti-KDI protein antibody.This cell can be cultivated in any suitable tissue culture medium (TCM); But preferably adding 10% foetal calf serum (in about 56 ℃ of deactivations), and adding about 10g/l non-essential amino acid, culturing cell in the Eagle substratum of the Earle improvement of approximately 1000U/ml penicillin, and about 100 μ g/ml tsiklomitsins.Extract the splenocyte of this mouse and merge with suitable myeloma cell line.Can use any suitable myeloma cell line according to the present invention, however advantageous applications available from American type culture collection Rockville, the parent myeloma cell line of Maryland (SP20).After fusion, the gained hybridoma optionally remains in the HAT substratum, then as (Gastroenterology 80:225-232 (1981)) as described in the Wands etc. by restriction dilution clone.Analyze the hybridoma that obtains by this selection then to differentiate that secrete can be in conjunction with the clone of the antibody of KDI proteantigen.

Perhaps, can pass through with antiidiotypic antibody in conjunction with other antibody of KDI proteantigen with two one step process productions.It also is this fact of antigen that this method is utilized antibody itself, and thereby can obtain antibody in conjunction with second kind of antibody.According to this method, KDI protein specific antibody is used to inoculate animal, preferred mouse.Splenocyte with this animal is used to produce hybridoma then, and screens this hybridoma to differentiate the clone that can produce antibody, and its ability in conjunction with KDI protein specific antibody can be blocked by the KDI proteantigen.This antibody comprises the antiidiotypic antibody of KDI protein specific antibody, and can be used to inoculate animal to induce other KDI albumen specific antibody formation.

Should recognize that Fab of the present invention and F (ab ') 2 and other antibody fragment can use according to method shown in this paper.This fragment is typically used enzyme such as papoid (to produce the Fab fragment) or stomach en-(to produce F (ab ') 2 fragments), produces by proteolysis.Perhaps, KDI protein binding fragment can produce by using recombinant DNA technology or synthetic chemistry.

For using anti-KDI in the human body, can preferably use " peopleization " chimeric mAb.This antibody can use the genetic constructs derived from the hybridoma of above-mentioned generation monoclonal antibody to produce.The method of production chimeric antibody known in the art.Referring to Morrison, science 229:1202 (1985); Oi etc., biotechnology 4:214 (1986); Cabilly etc., U.S. Patent No. 4816567; Taniguchi etc., EP171496; Morrison etc., EP173494; Neuberger etc., WO 8601533; Robinson etc., WO8702671; Boulianne etc., natural 312:643 (1984); Neuberger etc., natural 314:268 (1985).

The immunity system relative disease

Treatment

Those skilled in the art also recognize, because KDI albumen of the present invention is a member of Interferon, rabbit family, when the individual cell of KDI adding, when tissue or body, this protein will be to the target cell performance physiological action of individuality.Thereby should recognize that because the disease that the reduction of plain active standard of individual interference or normal level causes disease of immune system especially can be by using the treatment of KDI polypeptide.Therefore, the present invention also provides treatment to need the method for the individuality of raising Interferon, rabbit level, comprises to this individuality and use the pharmaceutical composition that comprises the isolating KDI polypeptide of a certain amount of the present invention that it is plain active that described amount can effectively improve this individual interference.

Mediation α-IFN and the bioactive artificial class IFN receptor complex of β-IFN except that with also combine KDI combines with Ω-IFN.Thus, the clinical antiviral therapy that is used for of KDI energy is for example treated AIDS, and viral hepatitis comprises chronic viral hepatitis B, third liver, papilloma virus, viral encephalitis and prevention rhinitis and respiratory tract infection.

KDI also is used for the treatment of various cancers (hairy cell leukemia for example, acute myelomatosis, osteosarcoma, basaloma, neurospongioma, renal cell carcinoma, multiple myelomatosis, melanocytoma, and Hodgkin disease).

KDI is considered to stimulate natural killer cell activity.Thus, KDI can be used for treating parasite and infectation of bacteria, for example treats the pulmonary tuberculosis that Cryptosporidium parvum infects and tolerate multiple medicine.

KDI also is considered to can be used as immunity therapeutic preparation, especially as immunosuppressor.For example, it is believed that KDI suppresses with mitogen or homogeneous variant cell the lymphopoiesis that marrow sample progenitor cell and other medullary cell stimulate.Thus, KDI is used as protective agent when using before chemotherapy, and can be used for treating lymphocyte in addition, and the high proliferation excessively of marrow sample progenitor cell and bone marrow stem cell is for example treated chronic hairy cell leukemia.The KDI polypeptide also can be used for preventing graft and host's repulsion, or shortens the process such as the sacroiliitis of autoimmune disease, multiple sclerosis, (2) or diabetes (3).KDI also is used for the treatment of the Mammals transformation reactions, is for example undertaken by suppressing humoral response.

KDI can be used as adjuvant or altogether adjuvant strengthen or stimulate immunne response under preventative or the therapeutic inoculation situation.

In addition, the present invention also provides treatment patient infection's method, comprises the polypeptide of the present invention of using significant quantity to the patient who needs anti-infective therapy.In an embodiment preferred, infection is a virus, bacterium or parasitic infection.One particularly in the embodiment preferred, infection is a virus infection.

In addition, the present invention also provides treatment cancer patients's method, comprises the polypeptide of the present invention of using significant quantity to the patient who needs anticancer therapy.

In addition, the present invention also provides immunotherapy of cancer patient's method, comprises the polypeptide of the present invention of using significant quantity to the patient who needs anticancer therapy.

In addition, the present invention also provides immunotherapy patient's method, comprises the polypeptide of the present invention of using significant quantity to the patient who needs immunotherapy.

Prescription

The KDI peptide composition will be to generally acknowledge good medical practice, consider the clinical condition (especially single side effect) of individual patient with the treatment of KDI polypeptide, the release site of KDI peptide composition, application process is used program and other known clinical factor and is prepared." significant quantity " of KDI polypeptide determined by this consideration in the literary composition.

Generally speaking, the medicine effective quantity of every dose of KDI polypeptide that non-enteron aisle is used is in about 1 μ g/ per kilogram of body weight/sky～10mg/ per kilogram of body weight/sky scope, and this will carry out the therapeutic judgement as mentioned above certainly.Preferably, dosage is at least 0.01mg/ per kilogram of body weight/sky, more preferably for the people between about 0.01～10mg hormone/per kilogram of body weight/sky.If provide continuously, the KDI polypeptide typically with about 1 μ g/ per kilogram of body weight/hour～50 μ g/ pers kilogram of body weight/hour speed use, inject every day 1～4 time or continuous subcutaneous perfusion, for example use Micropump.Also can use venous pocket solution.Treatment time needs the reaction that takes place according to required effect observation treatment back and is changed.

The pharmaceutical composition that contains KDI of the present invention can be oral, rectum, and non-enteron aisle, in the brain pond, intravaginal, intraperitoneal, local (with powder, ointment, drops or skin paste), use or oral or nose spray the cheek." drug acceptable carrier " is meant non-toxicity solid, semi-solid or liquid-filled dose, and thinner, the prescription assistant agent of capsule compound or any kind.Term in the literary composition " non-enteron aisle " is meant that mode of administration comprises intravenously, intramuscular, and intraperitoneal, in the buttocks, subcutaneous and intra-articular injection and perfusion.

The KDI polypeptide also is suitable for using by sustained release system.The half penetrating polymeric matrix that suitable sustained-release composition for example comprises tangible form is film or microcapsule for example.Suitable release matrix comprises polylactide (U.S. Patent No. 3773919, EP58481), multipolymer (the Sidman of L-L-glutamic acid and γ-ethyl-L-L-glutamic acid, U. etc., biological polymer 22:547-556 (1983)), poly-(2-hydroxyethyl methacrylic acid) (R.Langer etc., J.BiomedMater Res 15:167-277 (1981), and R.Langer Chem.Tech.12:98-105 (1982)), the ethylene-vinyl acetic ester (R.Langer etc., Id.) or poly--D-3-hydroxybutyric acid (EP133988).Continue to discharge the KDI peptide composition and also comprise the KDI polypeptide that lipid is held back.The liposome that contains the KDI polypeptide prepares by currently known methods, referring to DE3218121; Epstein etc., Proc.Natl.Acad.Sci (USA) 82:3688-3692 (1985); Hwang etc., Proc.Natl.Acad.Sci (USA) 77:4030-4034 (1980); EP52322; EP36676; EP88046; EP143949; EP142641; The open 83-118008 of Japanese Patent; United States Patent (USP) 4485045 and 4544545; And EP102324.Normally, liposome is (the approximately 200-800A (dust)) of little even sheet shape, and wherein lipid content is higher than about 30mol% cholesterol, and the ratio of selecting to adjust is so that KDI polypeptide treatment optimizing.

In one embodiment, non-enteron aisle is used, the KDI polypeptide passes through usually with required purity, with unitary dose injectable forms (solution, suspension or milk sap) mix with drug acceptable carrier and prepare, this carrier in used dosage and concentration to the acceptor nontoxicity, and can with prescription in other batching compatible.For example, formula optimization does not comprise that oxygenant and other are known to the deleterious compound of polypeptide.

Normally, by being contacted with liquid vehicle or finely divided immobilization carrier or the two evenly and nearly, the KDI polypeptide prepares prescription.Then if desired, product is made desired shape.Preferably this carrier is non-enteron aisle carrier, more preferably with the isoosmotic solution of acceptor blood.This carrier for example comprises water, physiological saline, Ringer ' s liquid and Glucose Liquid.The present invention also uses nonaqueous phase carrier such as fixed oil and ethyl oleate, and liposome.

Carrier suitably contains trace mineral supplement as strengthening the material of isotonicity and chemical stability.This material is nontoxic at used dosage and concentration to acceptor, and comprises buffer reagent such as phosphoric acid, citric acid, succsinic acid, acetate, and other organic salt and salt thereof; Antioxidant such as xitix (VC); Lower molecular weight (being less than 10 residues) polypeptide, for example poly arginine or tripeptides; Protein such as serum albumin, gelatin or immunoglobulin (Ig); Hydrophobic polymer such as polyvinylpyrrolidone; Amino acid such as glycine, L-glutamic acid, aspartic acid and arginine; Monose, disaccharides and other carbohydrate comprise the Mierocrystalline cellulose or derivatives thereof, glucose, seminose, or dextrin; Sequestrant such as EDTA; Sugar alcohol such as mannitol or Sorbitol Powder; Counterion such as sodium ion; And/or nonionogenic tenside such as Polysorbates, Poloxamers, or PEG.

The KDI polypeptide is typically with about 0.1mg/ml～100mg/ml, preferred 1-10mg/ml concentration, and pH is approximately 3～8 conditions and is formulated in this carrier.Should know and use aforesaid some vehicle, carrier or stablizer will cause KDI polypeptide salt to produce.

The KDI polypeptide that is used for the treatment of must be aseptic.Be easy to reach aseptic by aseptic filter membrane (for example 0.2 micron membranes) filtration.Therapeutic KDI peptide composition places the container with portable sterile equipment usually, as the intravenous solution bag or have can be by the bottle of subcutaneous injection needle penetration stopper.

The KDI polypeptide is stored with unitary dose or multiple doses content usually, and for example sealing wax ampoule or bottle are stored with reprovision with the aqueous solution or freeze-drying prescription.The freeze-drying Formulation Example is filling 5ml filtering aseptic 1% (w/v) KDI polypeptid solution in the 10ml bottle in this way, then with the freeze-drying of gained mixture.Perfusion liquid prepares by inject freeze dried KDI polypeptide with sterile water for injection.

The present invention also provides pharmaceutical pack or test kit, it comprises one or more container of the batching filling of one or more pharmaceutical composition of the present invention, also has the production of government organs in this container to medicine or biological products, use or sell the bulletin of regulating, this bulletin has reflected these medicines that government organs use the people or the production of biological products, the approval using and sell.In addition, polypeptide of the present invention can with other therapeutic compound combined utilization.

Stimulant and antagonist-analysis and molecule

The present invention also provides the method for SCREENED COMPOUND, differentiating those enhancings or to destroy the effect of KDI pair cell, as the interactional compound of itself and KDI binding molecule such as acceptor molecule.Stimulant be a kind of raising KDI natural biological function or with the intimate compound of KDI, and antagonist reduces or eliminate its function.

This embodiment of the present invention provides part protein-bonded a kind of method of differentiating receptor protein or other and KDI polypeptide specific combination on the other hand.For example, cellular compartment can prepare from express the molecule in conjunction with KDI as cytolemma or its prepared product.KDI insulation with this prepared product and mark.According to ordinary method known in the art separate and qualitative KDI and with acceptor or other conjugated protein bonded KDI mixture.Perhaps, the KDI polypeptide can combine with solid support, and the dissolved binding molecule can combine with post from cell thus, then wash-out and qualitative according to conventional methods.

In the analysis of the present invention about stimulant and antagonist, cellular compartment such as cytolemma or its prepared product can prepare from express the cell in conjunction with the molecule of KDI, and this molecule is as the signal regulated by KDI or the molecule of the approach of adjusting.This prepared product might not be to cultivate under KDI antagonist or the anti-depressant candidate molecules situation maybe with the KDI of mark.Candidate molecules combines reduction with the binding ability of binding molecule by tagged ligand to be reflected.By the bonded molecule, promptly not inducing the keying action of KDI to the KDI binding molecule for no reason at all, is good antagonist.With KDI in conjunction with good and to excite the molecule of or close effect identical with KDI be stimulant.

The class KDI effect of measuring potential stimulant and antagonist for example can be determined the second messenger system activity by after candidate molecules and cell or suitable cellular preparations react to each other, and contrasts KDI or molecular excitation is carried out with the ability of KDI same function.The second messenger system that is used for this purpose comprises but the non-AMP of being limited to guanylate cyclase, ionic channel or inosinyl phosphate inosine hydrolysis second messenger system.

Another kind of analysis to the KDI antagonist for example is competition analysis, and it is to make up KDI and potential antagonist and membrane-bound KDI acceptor molecule or reorganization KDI acceptor molecule under proper condition, with the inhibition analysis that is at war with.KDI can be labeled as through radio-labeled, can accurately determine like this and acceptor molecule bonded KDI molecule number, to estimate the effectiveness of potential antagonist.

Potential antagonist comprises and the little organic molecule of polypeptide bonded of the present invention, peptide, and polypeptide and antibody, thus suppress or eliminate its activity.Potential antagonist can also be with binding molecule on the little organic molecule of same loci bonded, peptide, polypeptide such as closely-related protein or antibody, and do not induce KDI inductive activity, thereby by making the KDI can not be in conjunction with stoping the KDI function.

Other potential antagonist comprises antisense molecule.Antisense technology is by antisense DNA or RNA or be formed for controlling gene by triple helical and express.Antisense technology is for example by Okano, J.Neurochem.56:560 (1990) " oligodeoxynucleotide is as the Antisense Suppression thing of genetic expression " CRC press, and Boca Raton, FL (1988) discloses.Triple helical forms and for example sees Lee etc., nucleic acids research 6:3073 (1979); Coony etc., science 241:456 (1988); And Dervan etc., science 251:1360 (1991) discloses.These methods combine based on polynucleotide and complementary DNA or RNA's.For example, 5 ' coding region of the polynucleotide of code book invention mature polypeptide can be used for the antisense rna oligonucleotide that design length is approximately 10～40 base pairs.Design one and the gene regions complementary DNA oligonucleotide that participates in transcribing produce thereby stop to transcribe with KDI.Hybridization and destruction mRNA molecule are translated as the KDI polypeptide in this antisense rna oligonucleotide and the mRNA body.Above-mentioned oligonucleotide also can be imported cell, thereby sense-rna or DNA can express in vivo and suppress KDI albumen and produce like this.

Stimulant and antagonist can with drug acceptable carrier applied in any combination as mentioned above.

Antagonist for example can be used for suppressing interferon activity, for example stimulates marrow and hematopoiesis archeocyte propagation after chemotherapy, any above-mentioned antagonist all can with drug acceptable carrier applied in any combination as described later.

The present invention will be easier to understand with reference to following illustration non-restrictive example.

Embodiment 1: at E.coli clone and expressing K DI

New pHE4 series bacterial expression vector, especially the pHE4a carrier is used for bacterial expression in the present embodiment.(QIAGEN, Inc.9259 Eton Avenue, Chatsworth, CA, 91311) pHE4-5/KDI vector plasmid DNA contains the DNA that is inserted in the coding polynucleotide shown in Figure 1 between single restriction enzyme sites Nde I and the Asp 718.This construct for those skilled in the art be convenient to be preserved in ATCC on February 25th, 1998, preserving number No.209645.

The pHE4a bacterial expression vector comprises selective neomycin phosphotransferase gene, E.coli replication orgin, T5 bacteriophage promoter sequences, 2 lac operator gene sequences, Shine-Delgarno sequence, and lactose operon repressor thing gene (lacIq).The arrangement of these elements makes the insertion dna fragmentation of coded polypeptide express the polypeptide with 6 the His residues (i.e. " 6 * His mark ") that connect with polypeptide aminoterminal covalent linkage.

The proteic dna sequence dna of encoding mature KDI increases with the PCR Oligonucleolide primers, the sequence of cDNA encoding sequence 3 ' annealing in the amino terminal sequence of primer and the required part of KDI albumen and the preservation construct.The extra Nucleotide that contains the restriction site that promotion clones in the pHE4a carrier adds to respectively in 5 ' and the 3 ' primer sequence.

Be clone KDI protein-coding region, 5 ' primer sequence is 5 ' GGCCGCATATGCTGGACTGTAACTTACTG3 ' (SEQ ID NO:6), the underscore place is a Nde I restriction site, those skilled in the art will recognize that 5 ' primer starting point can change in the protein coding sequence, with the DNA section of any required part of the complete KDI albumen of amplification coding.3 ' primer sequence is 5 ' GGCCGCGGTACCTTATTTCCTCCTGAATAGAGC3 ' (SEQ ID NO:17), and line place is Asp 718 restriction sites.

The KDI dna fragmentation of amplification is cut with Nde I and Asp 718 enzymes, and will link together with linearization plasmid then.KDI DNA inserts and makes the KDI protein-coding region in the downstream of IPTG inducible promoter and in the framework of initial AUG and 6 Histidine codons in the pHE4a carrier that limits.

With standard method (molecular cloning laboratory manual, 2nd Ed as described in Sambrook etc.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)), will connect mixture and be transformed in the competence E.coli cell.That use in the embodiment of the invention is the E.coli bacterial strain M15/rep4 that contains the plasmid pREP4 of multiple copied, and it is expressed the lac repressor and gives kalamycin resistance (" Kanr ").This unique proteic bacterial strain of expressing K DI that is suitable for can be purchased (QIAGEN.Inc, aforementioned).There is being the energy for growth on the LB flat board of penbritin and kantlex to differentiate transformant by it.Isolated plasmid dna from resistance clone, and by restriction analysis, PCR and dna sequencing are determined the exactness of clone's DNA.

Contain being cloned in of required construct and add grow overnight (O/N) in the liquid LB substratum of penbritin (100 μ g/ml) and kantlex (25 μ g/ml).This O/N culture is used to inoculate big substratum with about 1: 25～1: 250 extent of dilution.It is between 0.4 and 0.6 that cell grows to 600nm optical density(OD) (OD 600).Adding isopropylthio-(IPTG) to final concentration then is 1mM, by deactivation lac I repressor, induces from the responsive promoter transcription of lac repressor.Then cell was cultivated 3～4 hours in addition.Then through centrifugal collecting cell.

Cell stirred 3～4 hours in 6M Guanidinium hydrochloride pH8 then at 4 ℃.Through the centrifugal cell debris of removing, and the supernatant application of sample that will contain the KDI polypeptide in the affine resin column of nickel-nitrile-nitrilotriacetic (" Ni-NTA ") (QIAGEN, Inc.).Protein with 6 * His mark combines with Ni-NTA resin high-affinity, and available easy single stage method purifying (see The QIAexpressionist for details, 1995, QIAGEN, Inc).In brief, supernatant is at the 6M Guanidinium hydrochloride, and application of sample is on post among the pH8, and this post is at first used the 6M Guanidinium hydrochloride of 10 volumes, and the pH8 washing with the 6M Guanidinium hydrochloride pH6 washing of 10 volumes, is used 6M Guanidinium hydrochloride pH5 wash-out KDI then at last.

By with phosphate buffered saline (PBS) (PBS) or 50mM sodium acetate buffer pH6, add the protein dialysis renaturation of 200mM NaCl then with purifying.Can be when perhaps, this protein is on being fixed on the Ni-NTA post by abundant refolding.The suggestion condition is as follows: containing the 500mM NaCl of proteinase inhibitor, 20% glycerine is among the 20mM Tris/HCl pH7.4, with linear 6M～1M urea gradient renaturation.Renaturation should be carried out 1.5 hours or longer.After the renaturation, protein can be by adding 250mM imidazoles wash-out.Imidazoles is by adding that with PBS or 50mM sodium acetate buffer pH6 200mM NaCl dialysis removes at last, and the protein of purifying is stored or freezing at-80 ℃ at 4 ℃.

When it exists with the inclusion body form, below another kind of method can be used for the KDI that purifying is expressed in E.coli, unless otherwise indicated, following steps are all carried out at 4～10 ℃.

When the E.coli fermentative production stage finished, cell culture was cooled to 4～10 ℃, and by continuing centrifugal collecting cell (Heraeus Sepatech) with 15000rpm.Weigh the proteinic desired output of cell paste and the protein mass of required purifying based on per unit, heavy in right amount cell is stuck with paste to be suspended in contain 100mM Tris, 50mM EDTA in the damping fluid of pH7.4, is separated into unit for uniform suspension with the high shear mixing instrument with cell.

Then this solution is flowed through micro-fluidisation instrument (Microfluidics, Corp or APV Gaulin.Inc.) for twice with lysis at 4000～6000psi.It is 0.5M NaCl that homogenate is mixed to final concentration with NaCl liquid then, with 7000xg centrifugal 15 minutes subsequently.The gained precipitation is used 0.5M NaCl again, 100mM Tris, 50mM EDTA, pH7.4 washing.

The inclusion body of gained washing was with 1.5M Guanidinium hydrochloride (GnHCl) dissolving 2～4 hours, and after 7000xg was centrifugal 15 minutes, the supernatant that discards precipitation and will contain the KDI polypeptide extracted with the GuHCl that carries out next step 4 ℃ of overnight incubation.

After high speed centrifugation (30000xg) is removed insoluble particles, by short mix GnHCl extract and 20 volumes contain the 50mM sodium acetate, pH4.5,150mM NaCl, the damping fluid of 2mMEDTA stirs through brute force, with GnHCl dissolved protein refolding.The diluted protein matter solution of refolding did not mix maintenance 12 hours at 4 ℃ before being further purified.

Be the KDI polypeptide solution of clarification refolding, use 0.16 μ m membrane filter, use the 40mM sodium acetate, the tangential filtration device that the pH6.0 equilibrated prepares in advance with suitable surface-area (as Filtron).Filtering sample pipetting volume is on Zeo-karb (as PorosHS-50, Perseptive Biosystems).This post 40mM sodium acetate, the pH6.0 washing, and with containing 250mM, 500mM, the same buffer stepwise elution of 1000mM and 1500mM NaCl.The continuous monitoring effluent is in the absorbancy of 280mm.Collect components at different levels and carry out further SDS-PAGE analysis.

To contain in the diversity of KDI polypeptide and and mix with the water of 4 volumes.The sample of dilution then application of sample (Poros HQ-50 is PerseptiveBiosystems) and on weak anionic (Poros CM-20, Perseptive Bio systems) the exchange resin columns in series in a series of reinforcing yin essence ions of preparation in advance.This post 40mM sodium acetate pH6.0 balance.Two posts are all used the 40mM sodium acetate, pH6.0,200mM NaCl washing.The CM-20 post is then at 0.2M NaCl, the 50mM sodium acetate, and pH6.0 to 1.0M NaCl, the 50mM sodium acetate, the pH6.5 scope is with 10 column volume linear gradient elutions.Constant monitoring effluent is collected components at different levels under A280.Concentrate the component (for example determining) that contains the KDI polypeptide then by 16%SDS-PAGE.

Gained KDI polypeptide is the purity more than 95% behind above-mentioned refolding and purification step.When the protein of application of sample 5 μ g purifying, in the blue painted 16%SDS-PAGE gel of Commassie, do not observe main pollution zone.The protein of purifying also carries out intracellular toxin/LPS and pollutes test, typically analyzes the LPS pollutent according to LAL and is less than 0.1ng/ml.

The inventor has produced a plurality of KDI expression construct, to promote the production of KDI polypeptide in all size and the various system.Construct based on E.coli is as follows: (1) pQE9:KDI.S27-K207 (expressing the 27-207 amino acids of SEQ ID NO:2); (2) pHE4:KDI.S27-K207 (expressing the 27-207 amino acids of SEQ ID NO:2); (3) pHE4:KDI.A23-K207 (expressing the 23-207 amino acids of SEQ ID NO:2); (4) pHE4.KDI.G24-K207 (expressing the 24-207 amino acids of SEQ ID NO:2); (5) pHE4.KDI.C30-K207 (expressing the 30-207 amino acids of SEQ ID NO:2).

Embodiment 2: clone and expressing K DI protein in baculovirus expression system

In this embodiment, plasmid shuttle vectors pA2GP is used for the clone's of encoded K DI DNA is inserted baculovirus, with expressing K DI protein, used baculovirus leader sequence and standard method such as Summer etc., baculovirus vector and insect cell cultural method handbook, Texas Agricultural Experimental Station Bulletin No.1555 (1987) is described.This expression vector contains the strong polyhedrin promotor of autographa california multiple nuclear polyhedrosis virus (AcMNPV), the back extension bar shape virus proteic secretion signal peptide of gp67 (leader sequence) and conventional restriction site such as BamH I, Xba I and Asp718.The polyadenylation site of simian virus 40 (SV40) is used for polyadenylation effectively.For ease of selecting the virus of reorganization, this plasmid contains the E.coli beta-galactosidase gene of equidirectional under weak fruit bat promotor control, after connect the polyadenylation signal of polyhedron gene.The gene that inserts is positioned at virus sequence two flanks through cell-mediated homologous recombination with wild-type virus DNA, with the live virus of the polynucleotide that produce cloning by expression.

Those skilled in the art recognize that fully many other baculovirus vectors can replace above carrier and use, as pAc373, and pVL941 and pAc IM1, as long as this structure provides suitable transcribing, translation, the signal for locating of secretion etc. comprises AUG in desired signal peptide and the frame.For example by Luckow etc., virusology 170:31-39 (1989) is described for this carrier.

The cDNA sequence of natural relevant leader sequence shown in disappearance AUG initiator codon of ripe KDI polypeptide among the clone of coding preservation and the SEQ ID NO:2, use PCR Oligonucleolide primers amplification corresponding to gene 5 ' and 3 ' sequence, 5 ' primer sequence is 5 ' GGCCGGGATCCGCCATCATGAGCACCAAACCTGATATG3 ' (SEQ ID NO:18), and line place is a Bam H I restriction enzyme sites.3 ' primer sequence is 5 ' GGCCGCGGTACCTTATTTCCTCCTGAATAGAGC3 ' (SEQ IDNO:19), and line place is the Asp718 restriction enzyme sites.

(" Geneclean " BIO 101 Inc., LaJolla CA) isolates from 1% sepharose the fragment of amplification with the test kit that is purchased.This fragment is cut with BamH I and Asp718 enzyme then, and purifying on 1% sepharose again.

This plasmid is cut with restriction enzyme BamH I and Asp 718 enzymes, and randomly, uses ordinary method known in the art, with Roll phosphoric acid acid dephosphorylation.(" Geneclean " BIO 101 Inc., La Jolla CA) separates from 1% sepharose this DNA with being purchased test kit then.

Fragment and dephosphorylized plasmid connect together with the T4DNA ligase enzyme.With connect mixture Transformed E .coli HB 101 or other suitable E.coli host such as XL-1 Blue (Statagene Cloning Systems, La Jolla, CA) and coat on the culture plate.Cut the DNA of each bacterium colony with BamH I and Asp 718 enzymes, cut product through the gel electrophoresis analysis enzyme then, identify that bacterium contains the plasmid with people KDI gene.Clone's fragments sequence is determined by dna sequencing.This plasmid is called pA2GPKDI at this.

With Felgner etc., the described lipofection of Proc Natl Acad Sci USA 84:7413-7417 (1987) is purchased linearizing baculovirus DNA (" Baculo Gold with 5 μ g plasmid pA2GPKDI and 1.0 μ g ^TMBaculovirus DNA ", Pharmingen, San Diego, CA) cotransfection.With 1 μ g BaculoGold ^TMViral DNA and 5 μ g plasmid pA2GPKDI are blended in (Life Technologies Inc. in the aseptic hole of the microtitre flat board that contains 50 μ l serum-free Grace ' s substratum, Gaithersburg, MD) add 10 μ l Lipofectin and 90 μ l Grace ' s substratum subsequently, mix, and incubated at room temperature 15 minutes.Transfection mixture is added dropwise to (ATCC CRL 1711) in the Sf9 insect cell then, and this cell seeding is in the 35mm tissue culture plate with 1ml serum-free Grace ' s substratum.This flat board was cultivated 5 hours at 27C, removed transfection solution then from flat board, and added Grace ' the s insect substratum that 1ml adds 10% foetal calf serum, continued to cultivate 4 days at 27 ℃.

After four days, collect supernatant, and as described in Summer and Smith (aforementioned), carry out the plaque analysis.(Life Technoligies Inc., sepharose Gaithersburg) make the blue gal cloning by expression that dyes plaque of generation be easy to differentiate and separate to have " Blue Gal ".(be found in insect cell cultivation service manual about this type of " plaque analysis " and reach by LifeTechnologies Inc., Gaithersburg, the baculovirus that P 9-10 is classified is learned).After suitably cultivating, the plaque that dyes with tip (as Eppendorf) the picking orchid of micropipet.The agar that contains recombinant virus is resuspended in the micro-centrifuge tube that contains 200 μ l Grace ' s substratum then, and the suspension that will contain recombinant baculovirus puts in the insect Sf9 cell of planting in the 35mm plate.Collect the supernatant of these culture dish after 4 days, then 4 ℃ of storages.This recombinant virus is called V-KDI.

Be calibrating KDI expression of gene, the Sf9 cell is grown in adding Grace ' the s substratum of 10% heat-inactivated FBS.Be approximately 2 usefulness recombinant baculovirus V-KDI cells infecteds with infection multiplicity (MOI), if radiolabeled protein is required, remove substratum after 6 hours, and (can be available from Life Technologies Inc. with the SF900I II substratum that deducts methionine(Met) and halfcystine, Rockvile, MD) displacement.After 42 hours, add the 35S-methionine(Met) of 5 μ Ci and 5 μ Ci35S-halfcystines (can available from Amersham).Cell was further cultivated 16 hours, then through centrifugal collection, in the supernatant protein and intracellular protein by SDS-PAGE, with after automatically radioautograph (if radiolabeled) analyze.

The micrometering preface of the aminoacid sequence of the protein amino terminal of purifying can be used for determining KDI protein amino terminal sequence.

The following structure of other baculovirus expression construct: (1) pA2:KDI (expressing the 1-207 position residue of SEQ IDNO:2); (2) pA2.KDI.M7-K207 (expressing the 7-207 position residue of SEQ IDNO:2); (3) pA2gp.KDI.L28-K207 (expressing the 28-207 position residue of SEQID NO:2); (4) pA2gp.KDI.C30-K207 (expressing the 30-207 position residue of SEQ ID NO:2); (5) pA2.KDI.M1-R192 (expressing the 1-192 position residue of SEQ ID NO:2).

Embodiment 3: clone and expressing K DI in mammalian cell

Typical mammalian expression vector comprises promoter element, and its guiding mRNA transcribes beginning, and protein coding sequence is Transcription Termination and the required signal of transcript polyadenylation.Other element comprises enhanser, and Kozak sequence and flank are in the intervening sequence of donor and acceptor-RNA shearing site.With the early stage and late promoter of SV 40, retrovirus such as RSV, HTLVI, the early promoter of the length of HIVI terminal repetition (LTRs) and cytomegalovirus (CMV) can be realized efficiently transcribing.Yet, also can use cell element (for example human actin promotor).Be applicable to expression vector of the present invention for example comprise pSVL and pMSG carrier (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109).The available mammalian host cell comprises people Hela, 293, and H9 and Jurkat cell, mouse NIH3T3 and C127 cell, Cos1, Cos7 and CV1, quail QC1-3 cell, mouse L cell and Chinese hamster ovary (CHO) cell.

Perhaps, gene can be expressed in containing the stable cell lines that is integrated into the gene in the karyomit(e).With selective marker such as dhfr, gpt, Xin Meisu, Totomycin can be differentiated cotransfection and difference cells transfected.

The gene of transfection also can increase expressing a large amount of encoded protein matter, and DHFR (Tetrahydrofolate dehydrogenase) mark is used to develop the hundreds of that carries corresponding gene or even the clone of several thousand copies.Other effective selective marker is glutamine synthase (GS) (Murphy etc., journal of biological chemistry 277:227-279 (1991); Bebbington etc., biology/technology 10:169-175 (1992)).Use these marks, mammalian cell is grown in selective medium, and select the cell of high resistance, and these clones contain the gene that is integrated into the amplification in the karyomit(e), and Chinese hamster ovary (CHO) cell and NSO cell are generally used for proteinic production.

Expression vector pC1 and pC4 contain the strong promoter (LTR) of Rous sarcoma virus (Cullen etc., molecule and cytobiology, 438-447 (1985,3)), add the fragment (Boshart etc., cell 41:521-530 (1985)) of CMV-enhanser.For example has the BamH I, the multiple clone site of Xba I and Asp 718 restriction sites, the clone of promotion corresponding gene.Except that 3 ' intron, carrier also contains the polyadenylation and the termination signal of mouse proinsulin protogene.

Clone and expression in Chinese hamster ovary celI

Carrier pC4-Sig is used for expressing K DI polypeptide, and plasmid pC4-Sig is the derivative of plasmid pSV2-dhfr (ATCC accession number No.37146).It contains the coding region of the secretion leader sequence of the chemokine beta-8 (seeing US95/09508) that is positioned at the multiple clone site upstream, and is designed in the allogeneic dna sequence DNA frame of insertion.This plasmid contains the mouse DHFR gene under the control of SV40 early promoter.With these plasmid transfections, the disappearance active CHO of dihydrofolic acid or other cell can be by being selected cell in the selective medium of adding the chemotherapeutics methotrexate (α subtracts MEM, Life Technologies) growth.The amplification of the DHFR gene in anti-methotrexate (MTX) cell fully proved (referring to as Alt, F.W., Kellems, R.M., Bertino, JR. and Schimke, R.T.1978, journal of biological chemistry 253:1357-1370, Hamlin, J.L. and Ma, C 1990, Biochem, et BiophysActa, 1097:107-143, Page, M.J. and Sydenham, M.A.1991, biotechnics 9:64-68).Cell increases growth down in MTX concentration, because DHFR gene amplification causes the excessive generation of pacemaker enzyme DHFR, causes the resistance to medicine.If second gene is connected in the DHFR gene, it is amplified simultaneously usually and crosses and express.This method known in the art can be used for developing the clone of carrying the amplification gene of copy more than 1000.Subsequently, when removing methotrexate, can obtain to contain the clone of the gene that is integrated into the amplification in host cell one or many karyomit(e).

Plasmid pC4 contains the Rouse sarcoma virus (Cullen etc. that express corresponding gene, molecule and cytobiology, 1985.3.:438-447) the strong promoter of long terminal repeat (LTR), add the fragment of separation from the immediate early gene enhanser of human cytomegalic inclusion disease virus (CMV) (Boshart etc., cell 41:521-530 (1985)).The downstream of promotor is the following single restriction site that makes gene integration: BamH I, Xba I and Asp 718.Except that these cloning sites, plasmid also contains the polyadenylation site of 3 ' intron and mouse proinsulin protogene.Other efficient promoter also can be used for expressing, people's beta-actin promotor for example, the early stage or late promoter of SV40, or other retroviral long terminal repeat, for example HIV and HTLVI.The Tet-off of Clontech and Tet-on gene expression system and similar system are used in the mammalian cell with adjustable mode expressing K DI polypeptide.(Gossen.M.,&?Bujard,H.1992,Proc.Natl?Acad?Sci?USA89:5547-5551)。Be the polyadenylation of mRNA, other for example the signal of human growth hormone or globin gene also can use.Carrying the stable cell lines that is integrated into chromosomal corresponding gene also can be with selective marker such as gpt behind cotransfection, and G418 or Totomycin are selected.When beginning use an above selective marker for example G 418 add that methotrexate is favourable.

Plasmid pC4 cuts with restriction enzyme BamH I and Asp 718 enzymes, uses the Roll Phosphoric acid esterase through the means known in the art dephosphorylation then.Carrier is isolated from 1% sepharose then.

The dna sequence dna of encoded K DI polypeptide increases with the PCR Oligonucleolide primers of 5 ' and the 3 ' sequence that is equivalent to the required part of gene.5 ' primer contains the BamH I site at underscore place, Kozak sequence and AUG initiator codon, and 5 ' primer sequence is 5 '-GGCCGGGATCCGCCATCATGAGCACCAAACCTGATATG3 ' (SEQ ID NO:18).3 ' primer contains Asp 718 restriction sites at underscore place, and its sequence is as follows: 5 ' GGCCGCGGTACCTTATTTCCTCCCTGAATAGAGC3 ' (SEQ ID NO:19).

The amplification fragment cut with endonuclease BamH I and Asp718 enzyme, and then on 1% sepharose purifying.Isolating fragment is connected with the T4 dna ligase then with dephosphorylized carrier.Transformed E .coli HB101 or XL-1 Blue cell then, and differentiate with for example restriction enzyme analysis and to contain the segmental bacterium that inserts among the plasmid pC4.

The Chinese hamster ovary celI that lacks active DHFR gene is used for transfection.With the expression plasmid pC4 of 5 μ g and plasmid pSVneo lipofection (Felgner etc., the aforementioned) cotransfection of 0.5 μ g.Plasmid pSV2-neo contains dominant selectable marker, and the neo gene of Tn5, its coding are given the enzyme of the one group of antibiotics resistance that comprises G418.Cell seeding is subtracted in the MEM substratum in the α that adds 1mg/mlG418.After 2 days, the cell tryptic digestion, and plant in add 10,25 or the 50ng/ml methotrexate add that the α of 1mg/ml G418 subtracts among the hybridoma clone dull and stereotyped (Greiner, Germany) in the MEM substratum.After 10-14 days, single clone is used tryptic digestion, and plant in have different methotrexate concentration (50nM, 100nM, 200nM, 400nM is in 800nM) the 6 hole culture dish or 10ml flask.To move on the new 6 hole flat boards that contain greater concn methotrexate (1 μ M, 2 μ M, 5 μ M, 10 μ M, 20 μ M) the clone of the highest methotrexate concentration growth then.Repeat same steps as until the clone who obtains in the growth of 100～200 μ M concentration.The expression of required gene product is analyzed by for example SDS-PAGE and Western trace or reversed-phase HPLC analysis.

Other mammalian expression vector makes up as follows: (1) pC4:KDI (expressing the 1-207 residue of SEQ IDNO:2); (2) pC4sp:KDI.C30-K207 (connecing the allos signal peptide (chemokine beta-8 (MPIF-1) signal peptide) of the 30-207 position residue of SEQID NO:2 after the expression); And (3) pC4sp:KDI.L28-K207 (connecing the allos signal peptide (chemokine beta-8 (MPIF-1) signal peptide) of 28～207 residues of SEQ ID NO:2 after the expression).

Should know that the present invention can also embodied in other except that aforementioned elaboration and embodiment.According to above instruction and in the claim scope, can make various modifications and variation to the present invention.

All publications of quoting as proof (comprising patent, patent application, magazine, laboratory manual, book or other file) are all incorporated reference into.

Explanation about microbial preservation

(PCT detailed rules and regulations 13 two)

A. to the 8th page in specification sheets, the explanation of the capable described microorganism of 1-3.
		B. the preservation item other be deposited in in the supplementary page
Depositary institution's title American type culture collection
		(comprising postcode and name of the country) No. 10801, main road of Virginia, USA Manassas university, depositary institution address (2011-2209)
Preservation date on December 1st, 1998	Deposit number 203500
Preservation date on December 1st, 1998	Deposit number 203500	C. supplementary notes (in case of necessity) this column has supplementary page

		D. this explanation is done (if explanation is not done for all designated states) for following designated state

		E. remark additionally (in case of necessity)
Following explanation will provide (writing out the classification of explanation, for example: " numbering of preservation ") to international office subsequently		E. remark additionally (in case of necessity)

PCT/RO/134 shows (in July, 1992)

Sequence table＜110〉Human Genome Sciences Inc etc.＜120〉keratinocyte deutero-Interferon, rabbit＜130〉PF482＜140〉do not provide＜141〉1999-07-21＜150〉60/093,643＜151〉1998-07-21＜160〉21＜170〉PatentIn Ver.2.0＜210 1＜211〉1170＜212〉DNA＜213〉Homo sapiens＜220＜221〉CDS＜222〉(35) .. (655)＜400〉1ccacgcgtcc gggatttttt agcttgcaaa aaaa atg agc acc aaa cct gat atg 55

Met?Ser?Thr?Lys?Pro?Asp?Met

1???????????????5att?caa?aag?tgt?ttg?tgg?ctt?gag?atc?ctt?atg?ggt?ata?ttc?att?gct???103Ile?Gln?Lys?Cys?Leu?Trp?Leu?Glu?Ile?Leu?Met?Gly?Ile?Phe?Ile?Ala

10??????????????????15??????????????????20ggc?acc?cta?tcc?ctg?gac?tgt?aac?tta?ctg?aac?gtt?cac?ctg?aga?aga???151Gly?Thr?Leu?Ser?Leu?Asp?Cys?Asn?Leu?Leu?Asn?Val?His?Leu?Arg?Arg

25??????????????????30??????????????????35gtc?acc?tgg?caa?aat?ctg?aga?cat?ctg?agt?agt?atg?agc?aat?tca?ttt???199Val?Thr?Trp?Gln?Asn?Leu?Arg?His?Leu?Ser?Ser?Met?Ser?Asn?Ser?Phe?40??????????????????45??????????????????50??????????????????55cct?gta?gaa?tgt?cta?cga?gaa?aac?ata?gct?ttt?gag?ttg?ccc?caa?gag???247Pro?Val?Glu?Cys?Leu?Arg?Glu?Asn?Ile?Ala?Phe?Glu?Leu?Pro?Gln?Glu

60??????????????????65??????????????????70ttt?ctg?caa?tac?acc?caa?cct?atg?aag?agg?gac?atc?aag?aag?gcc?ttc???295Phe?Leu?Gln?Tyr?Thr?Gln?Pro?Met?Lys?Arg?Asp?Ile?Lys?Lys?Ala?Phe

75??????????????????80??????????????????85tat?gaa?atg?tcc?cta?cag?gcc?ttc?aac?atc?ttc?agc?caa?cac?acc?ttc???343Tyr?Glu?Met?Ser?Leu?Gln?Ala?Phe?Asn?Ile?Phe?Ser?Gln?His?Thr?Phe

90??????????????????95?????????????????100aaa?tat?tgg?aaa?gag?aga?cac?ctc?aaa?caa?atc?caa?ata?gga?ctt?gat???391Lys?Tyr?Trp?Lys?Glu?Arg?His?Leu?Lys?Gln?Ile?Gln?Ile?Gly?Leu?Asp

105?????????????????110?????????????????115cag?caa?gca?gag?tac?ctg?aac?caa?tgc?ttg?gag?gaa?gac?gag?aat?gaa???439Gln?Gln?Ala?Glu?Tyr?Leu?Asn?Gln?Cys?Leu?Glu?Glu?Asp?Glu?Asn?Glu120?????????????????125?????????????????130?????????????????135aat?gaa?gac?atg?aaa?gaa?atg?aaa?gag?aat?gag?atg?aaa?ccc?tca?gaa???487Asn?Glu?Asp?Met?Lys?Glu?Met?Lys?Glu?Asn?Glu?Met?Lys?Pro?Ser?Glu

140?????????????????145?????????????????150gcc?agg?gtc?ccc?cag?ctg?agc?agc?ctg?gaa?ctg?agg?aga?tat?ttc?cac???535Ala?Arg?Val?Pro?Gln?Leu?Ser?Ser?Leu?Glu?Leu?Arg?Arg?Tyr?Phe?His

155?????????????????160?????????????????165agg?ata?gac?aat?ttc?ctg?aaa?gaa?aag?aaa?tac?agt?gac?tgt?gcc?tgg???583Arg?Ile?Asp?Asn?Phe?Leu?Lys?Glu?Lys?Lys?Tyr?Ser?Asp?Cys?Ala?Trp

170?????????????????175?????????????????180gag?att?gtc?cga?gtg?gaa?atc?aga?aga?tgt?ttg?tat?tac?ttt?tac?aaa???631Glu?Ile?Val?Arg?Val?Glu?Ile?Arg?Arg?Cys?Leu?Tyr?Tyr?Phe?Tyr?Lys

185?????????????????190?????????????????195ttt?aca?gct?cta?ttc?agg?agg?aaa?taagaatcat?ctaccttcaa?gcaagaatta??685Phe?Thr?Ala?Leu?Phe?Arg?Arg?Lys200?????????????????205acagagattg?tggctacgca?aatgcaccaa?aaaagggtga?aatatatctg?aaatgtacct?745ggttctgccc?ttggaagcca?cttcctgctc?atgccactaa?cagcatgctg?ccaaactgtt?805cagattcaag?attattccaa?gcgcagggcc?caaatgttat?agccaaagaa?agtcttatga?865taaaagtgag?gcaaatttca?gccaagaagt?tagaagagat?gtttaaaaga?acaagaacaa?925attgtggatc?atggtatatg?caggctatca?gcagaaggat?cagacaataa?aatgagttag?985tgcaaaccat?ttagtaaaaa?taactatcag?cagagttgtt?ccagattaaa?aatagtacta?1045caagcttgta?aaggagttag?gacatgcaag?ctactgagca?taaaatatat?acttgctatt?1105tttcatgact?ttctctaata?aagtctttga?ctgttctctc?taataaaaaa?aaaaaaaaaa?1165aaaaa?????????????????????????????????????????????????????????????1170<210>2<211>207<212>PRT<213>Homo?sapiens<400>2Met?Ser?Thr?Lys?Pro?Asp?Met?Ile?Gln?Lys?Cys?Leu?Trp?Leu?Glu?Ile??1???????????????5??????????????????10??????????????????15Leu?Met?Gly?Ile?Phe?Ile?Ala?Gly?Thr?Leu?Ser?Leu?Asp?Cys?Asn?Leu

20??????????????????25??????????????????30Leu?Asn?Val?His?Leu?Arg?Arg?Val?Thr?Trp?Gln?Asn?Leu?Arg?His?Leu

35??????????????????40??????????????????45Ser?Ser?Met?Ser?Asn?Ser?Phe?Pro?Val?Glu?Cys?Leu?Arg?Glu?Asn?Ile

50??????????????????55??????????????????60Ala?Phe?Glu?Leu?Pro?Gln?Glu?Phe?Leu?Gln?Tyr?Thr?Gln?Pro?Met?Lys?65??????????????????70??????????????????75??????????????????80Arg?Asp?Ile?Lys?Lys?Ala?Phe?Tyr?Glu?Met?Ser?Leu?Gln?Ala?Phe?Asn

85??????????????????90??????????????????95Ile?Phe?Ser?Gln?His?Thr?Phe?Lys?Tyr?Trp?Lys?Glu?Arg?His?Leu?Lys

100?????????????????105?????????????????110Gln?Ile?Gln?Ile?Gly?Leu?Asp?Gln?Gln?Ala?Glu?Tyr?Leu?Asn?Gln?Cys

115?????????????????120?????????????????125Leu?Glu?Glu?Asp?Glu?Asn?Glu?Asn?Glu?Asp?Met?Lys?Glu?Met?Lys?Glu

130?????????????????135?????????????????140Asn?Glu?Met?Lys?Pro?Ser?Glu?Ala?Arg?Val?Pro?Gln?Leu?Ser?Ser?Leu145?????????????????150?????????????????155?????????????????160Glu?Leu?Arg?Arg?Tyr?Phe?His?Arg?Ile?Asp?Asn?Phe?Leu?Lys?Glu?Lys

165?????????????????170?????????????????175Lys?Tyr?Ser?Asp?Cys?Ala?Trp?Glu?Ile?Val?Arg?Val?Glu?Ile?Arg?Arg

180?????????????????185?????????????????190Cys?Leu?Tyr?Tyr?Phe?Tyr?Lys?Phe?Thr?Ala?Leu?Phe?Arg?Arg?Lys

195?????????????????200?????????????????205<210>3<211>238<212>PRT<213>Homo?sapiens<400>3Met?Ala?Leu?Leu?Phe?Pro?Leu?Leu?Ala?Ala?Leu?Val?Met?Thr?Ser?Tyr??1???????????????5??????????????????10??????????????????15Ser?Pro?Val?Gly?Ser?Leu?Gly?Cys?Asp?Leu?Pro?Gln?Asn?His?Gly?Leu

20??????????????????25??????????????????30Leu?Ser?Arg?Asn?Thr?Leu?Val?Leu?Leu?His?Gln?Met?Arg?Arg?Ile?Ser

35??????????????????40??????????????????45Pro?Phe?Leu?Cys?Leu?Lys?Asp?Arg?Arg?Asp?Phe?Arg?Phe?Pro?Gln?Glu

50??????????????????55??????????????????60Met?Val?Lys?Gly?Ser?Gln?Leu?Gln?Lys?Ala?His?Val?Met?Ser?Val?Leu?65??????????????????70??????????????????75??????????????????80His?Glu?Met?Leu?Gln?Gln?Ile?Phe?Ser?Leu?Phe?His?Thr?Glu?Arg?Ser

85??????????????????90??????????????????95Ser?Ala?Ala?Trp?Asn?Met?Thr?Leu?Leu?Asp?Gln?Leu?His?Thr?Glu?Leu

100?????????????????105?????????????????110His?Gln?Gln?Leu?Gln?His?Leu?Glu?Thr?Cys?Leu?Leu?Gln?Val?Val?Gly

115?????????????????120?????????????????125Glu?Gly?Glu?Ser?Ala?Gly?Ala?Ile?Ser?Ser?Val?Pro?Gln?Leu?Ser?Ser

130?????????????????135?????????????????140Leu?Glu?Leu?Arg?Arg?Tyr?Phe?His?Arg?Ile?Asp?Asn?Phe?Leu?Lys?Glu145?????????????????150?????????????????155?????????????????160Lys?Lys?Tyr?Ser?Asp?Cys?Ala?Trp?Glu?Ile?Val?Arg?Val?Glu?Ile?Arg

165?????????????????170?????????????????175Arg?Cys?Leu?Tyr?Tyr?Phe?Tyr?Lys?Phe?Thr?Ala?Leu?Pro?Ala?Leu?Thr

180?????????????????185?????????????????190Leu?Arg?Arg?Tyr?Phe?Gln?Gly?Ile?Arg?Val?Tyr?Leu?Lys?Glu?Lys?Lys

195?????????????????200?????????????????205Tyr?Ser?Asp?Cys?Ala?Trp?Glu?Val?Val?Arg?Met?Glu?Ile?Met?Lys?Ser

210?????????????????215?????????????????220Leu?Phe?Leu?Ser?Thr?Asn?Met?Gln?Glu?Arg?Leu?Arg?Ser?Lys225?????????????????230?????????????????235<210>4<211>187<212>PRT<213>Homo?sapiens<400>4Met?Thr?Asn?Lys?Cys?Leu?Leu?Gln?Ile?Ala?Leu?Leu?Leu?Cys?Phe?Ser??1???????????????5??????????????????10??????????????????15Thr?Thr?Ala?Leu?Ser?Met?Ser?Tyr?Asn?Leu?Leu?Gly?Phe?Leu?Gln?Arg

20??????????????????25??????????????????30Ser?Ser?Asn?Phe?Gln?Cys?Gln?Lys?Leu?Leu?Trp?Gln?Leu?Ash?Gly?Arg

35??????????????????40??????????????????45Leu?Glu?Tyr?Cys?Leu?Lys?Asp?Arg?Met?Ash?Phe?Asp?Ile?Pro?Glu?Glu

50??????????????????55??????????????????60Ile?Lys?Gln?Leu?Gln?Gln?Phe?Gln?Lys?Glu?Asp?Ala?Ala?Leu?Thr?Ile?65??????????????????70??????????????????75??????????????????80Tyr?Glu?Met?Leu?Gln?Asn?Ile?Phe?Ala?Ile?Phe?Arg?Gln?Asp?Ser?Ser

85??????????????????90??????????????????95Ser?Thr?Gly?Trp?Asn?Glu?Thr?Ile?Val?Glu?Asn?Leu?Leu?Ala?Asn?Val

100?????????????????105?????????????????110Tyr?His?Gln?Ile?Asn?His?Leu?Lys?Thr?Val?Leu?Glu?Glu?Lys?Leu?Glu

115?????????????????120?????????????????125Lys?Glu?Asp?Phe?Thr?Arg?Gly?Lys?Leu?Met?Ser?Ser?Leu?His?Leu?Lys

130?????????????????135?????????????????140Arg?Tyr?Tyr?Gly?Arg?Ile?Leu?His?Tyr?Leu?Lys?Ala?Lys?Glu?Tyr?Ser145?????????????????150?????????????????155?????????????????160His?Cys?Ala?Trp?Thr?Ile?Val?Arg?Val?Glu?Ile?Leu?Arg?Asn?Phe?Tyr

165?????????????????170?????????????????175Phe?Ile?Asn?Arg?Leu?Thr?Gly?Tyr?Leu?Arg?Asn

180?????????????????185<210>5<211>194<212>PRT<213>Homo?sapiens<400>5Met?Ala?Phe?Val?Leu?Ser?Leu?Leu?Met?Ala?Leu?Val?Leu?Val?Ser?Tyr??1???????????????5??????????????????10??????????????????15Gly?Pro?Phe?Gly?Ser?Leu?Gly?Cys?Asp?Leu?Ser?Gln?Asn?His?Val?Leu

20??????????????????25??????????????????30Val?Gly?Arg?Lys?Asn?Leu?Arg?Leu?Leu?Asp?Glu?Met?Arg?Arg?Leu?Ser

35??????????????????40??????????????????45Pro?His?Phe?Cys?Leu?Gln?Asp?Arg?Lys?Asp?Phe?Ala?Leu?Pro?Gln?Glu

50??????????????????55??????????????????60Met?Val?Glu?Gly?Gly?Gln?Leu?Gln?Glu?Ala?Gln?Ala?Ile?Ser?Val?Leu?65??????????????????70??????????????????75??????????????????80His?Glu?Met?Leu?Gln?Gln?Ser?Phe?Asn?Leu?Phe?His?Thr?Glu?His?Ser

85??????????????????90??????????????????95Ser?Ala?Ala?Trp?Asp?Thr?Thr?Leu?Leu?Glu?Pro?Cys?Arg?Thr?Gly?Leu

100?????????????????105?????????????????110His?Gln?Gln?Leu?Asp?Asn?Leu?Asp?Ala?Cys?Leu?Gly?Gln?Val?Met?Gly

115?????????????????120?????????????????125Glu?Glu?Asp?Ser?Ala?Leu?Gly?Arg?Thr?Gly?Pro?Leu?Ala?Leu?Lys?Arg

130?????????????????135?????????????????140Tyr?Phe?Gln?Gly?Ile?His?Val?Tyr?Leu?Lys?Glu?Lys?Gly?Tyr?Ser?Asp145?????????????????150?????????????????155?????????????????160Cys?Ala?Trp?Glu?Thr?Val?Arg?Leu?Glu?Ile?Met?Arg?Ser?Phe?Ser?Ser

165?????????????????170?????????????????175Leu?Ile?Ser?Leu?Gln?Glu?Arg?Leu?Arg?Met?Met?Asp?Gly?Asp?Leu?Ser

180?????????????????185?????????????????190Ser?Pro<210>6<211>245<212>PRT<213>Homo?sapiens<400>6Met?Ala?Leu?Leu?Phe?Pro?Leu?Leu?Ala?Ala?Leu?Val?Met?Thr?Ser?Tyr??1???????????????5??????????????????10??????????????????15Ser?Pro?Val?Gly?Ser?Leu?Gly?Cys?Asp?Leu?Pro?Gln?Asn?His?Gly?Leu

210?????????????????215?????????????????220Leu?Phe?Leu?Ser?Thr?Asn?Met?Gln?Glu?Arg?Leu?Arg?Ser?Lys?Asp?Arg225?????????????????230?????????????????235?????????????????240Asp?Leu?Gly?Ser?Ser

245<210>7<211>189<212>PRT<213>Homo?sapiens<400>7Met?Ala?Leu?Ser?Phe?Ser?Leu?Leu?Met?Ala?Val?Leu?Val?Leu?Ser?Tyr??1???????????????5??????????????????10??????????????????15Lys?Ser?Ile?Cys?Ser?Leu?Gly?Cys?Asp?Leu?Pro?Gln?Thr?His?Ser?Leu

20??????????????????25??????????????????30Gly?Asn?Arg?Arg?Ala?Leu?Ile?Leu?Leu?Gly?Gln?Met?Gly?Arg?Ile?Ser

35??????????????????40??????????????????45Pro?Phe?Ser?Cys?Leu?Lys?Asp?Arg?His?Asp?Phe?Arg?Ile?Pro?Gln?Glu

50??????????????????55??????????????????60Glu?Phe?Asp?Gly?Asn?Gln?Phe?Gln?Asp?Ala?Gln?Ala?Ile?Ser?Val?Leu?65??????????????????70??????????????????75??????????????????80His?Glu?Met?Ile?Gln?Gln?Thr?Phe?Asn?Leu?Phe?Ser?Thr?Glu?Asp?Ser

85??????????????????90??????????????????95Ser?Ala?Ala?Trp?Glu?Gln?Ser?Leu?Leu?Glu?Lys?Phe?Ser?Thr?Glu?Leu

100?????????????????105?????????????????110Tyr?Gln?Gln?Leu?Asn?Asp?Leu?Glu?Ala?Cys?Val?Ile?Gln?Glu?Val?Gly

115?????????????????120?????????????????125Val?Glu?Glu?Thr?Pro?Leu?Met?Asn?Glu?Asp?Ser?Ile?Leu?Ala?Val?Arg

130?????????????????135?????????????????140Lys?Tyr?Phe?Gln?Arg?Ile?Thr?Leu?Tyr?Leu?Ile?Glu?Arg?Lys?Tyr?Ser145?????????????????150?????????????????155?????????????????160Pro?Cys?Ala?Trp?Glu?Val?Val?Arg?Ala?Glu?Ile?Met?Arg?Ser?Leu?Ser

165?????????????????170?????????????????175Phe?Ser?Thr?Asn?Leu?Gln?Lys?Arg?Leu?Arg?Arg?Lys?Asp

180?????????????????185<210>8<211>189<212>PRT<213>Homo?sapiens<400>8Met?Ala?Leu?Ser?Phe?Ser?Leu?Leu?Met?Ala?Val?Leu?Val?Leu?Ser?Tyr??1???????????????5??????????????????10??????????????????15Lys?Ser?Ile?Cys?Ser?Leu?Gly?Cys?Asp?Leu?Pro?Gln?Thr?His?Ser?Leu

20??????????????????25??????????????????30Gly?Asn?Arg?Arg?Ala?Leu?Ile?Leu?Leu?Ala?Gln?Met?Gly?Arg?Ile?Ser

35??????????????????40??????????????????45Pro?Phe?Ser?Cys?Leu?Lys?Asp?Arg?His?Asp?Phe?Gly?Phe?Pro?Gln?Glu

50??????????????????55??????????????????60Glu?Phe?Asp?Gly?Asn?Gln?Phe?Gln?Lys?Ala?His?Val?Met?Ser?Val?Leu?65??????????????????70??????????????????75??????????????????80His?Glu?Met?Leu?Gln?Gln?Ile?Phe?Ser?Leu?Phe?His?Thr?Glu?Arg?Ser

85??????????????????90??????????????????95Ser?Ala?Ala?Trp?Glu?Cln?Ser?Leu?Leu?Glu?Lys?Phe?Ser?Thr?Glu?Leu

100?????????????????105?????????????????110Asn?Gln?Gln?Leu?Asn?Asp?Leu?Glu?Ala?Cys?Val?Ile?Gln?Glu?Val?Gly

115?????????????????120?????????????????125Val?Glu?Glu?Thr?Pro?Leu?Met?Asn?Val?Asp?Ser?Ile?Leu?Ala?Val?Lys

130?????????????????135?????????????????140Lys?Tyr?Phe?Gln?Arg?Ile?Thr?Leu?Tyr?Leu?Thr?Glu?Lys?Lys?Tyr?Ser145?????????????????150?????????????????155?????????????????160Pro?Cys?Ala?Trp?Glu?Val?Val?Arg?Ala?Glu?Ile?Met?Arg?Ser?Phe?Ser

165?????????????????170?????????????????175Leu?Ser?Lys?Ile?Phe?Gln?Glu?Arg?Leu?Arg?Arg?Lys?Glu

180?????????????????185<210>9<211>195<212>PRT<213>Homo?sapiens<400>9Met?Ala?Leu?Leu?Phe?Pro?Leu?Leu?Ala?Ala?Leu?Val?Met?Thr?Ser?Tyr??1???????????????5??????????????????10??????????????????15Ser?Pro?Val?Gly?Ser?Leu?Gly?Cys?Asp?Leu?Pro?Gln?Asn?His?Gly?Leu

115?????????????????120?????????????????125Glu?Gly?Glu?Ser?Ala?Gly?Ala?Ile?Ser?Ser?Pro?Ala?Leu?Thr?Leu?Arg

130?????????????????135?????????????????140Arg?Tyr?Phe?Gln?Gly?Ile?Arg?Val?Tyr?Leu?Lys?Glu?Lys?Lys?Tyr?Ser145?????????????????150?????????????????155?????????????????160Asp?Cys?Ala?Trp?Glu?Val?Val?Arg?Met?Glu?Ile?Met?Lys?Ser?Leu?Phe

165?????????????????170?????????????????175Leu?Ser?Thr?Asn?Met?Gln?Glu?Arg?Leu?Arg?Ser?Lys?Asp?Arg?Asp?Leu

180?????????????????185?????????????????190Gly?Ser?Ser

195<210>10<211>378<212>PRT<213>Homo?sapiens<400>10Met?Pro?Leu?Ser?Phe?Ser?Leu?Leu?Met?Ala?Val?Leu?Val?Leu?Ser?Tyr??1???????????????5??????????????????10??????????????????15Lys?Ser?Ile?Cys?Ser?Leu?Gly?Cys?Asp?Leu?Pro?Gln?Thr?His?Ser?Leu

20??????????????????25??????????????????30Gly?Asn?Arg?Arg?Ala?Trp?Ile?Leu?Leu?Ala?Gln?Met?Gly?Arg?Ile?Ser

35??????????????????40??????????????????45His?Phe?Ser?Cys?Leu?Lys?Asp?Arg?Tyr?Asp?Phe?Gly?Phe?Pro?Gln?Glu

50??????????????????55??????????????????60Val?Phe?Asp?Gly?Asn?Gln?Phe?Gln?Lys?Ala?Gln?Ala?Ile?Ser?Ala?Phe?65??????????????????70??????????????????75??????????????????80His?Glu?Met?Ile?Gln?Gln?Thr?Phe?Asn?Leu?Phe?Ser?Thr?Lys?Asp?Ser

85??????????????????90??????????????????95Ser?Ala?Ala?Trp?Asp?Glu?Thr?Leu?Leu?Asp?Lys?Phe?Tyr?Ile?Glu?Leu

100?????????????????105?????????????????110Phe?Gln?Gln?Leu?Asn?Asp?Leu?Glu?Ala?Cys?Val?Thr?Gln?Glu?Val?Gly

115?????????????????120?????????????????125Val?Glu?Glu?Ile?Ala?Leu?Met?Asn?Glu?Asp?Ser?Ile?Leu?Ala?Val?Arg

130?????????????????135?????????????????140Lys?Tyr?Phe?Gln?Arg?Ile?Thr?Leu?Tyr?Leu?Met?Gly?Lys?Lys?Tyr?Ser145?????????????????150?????????????????155?????????????????160Pro?Cys?Ala?Trp?Glu?Val?Val?Arg?Ala?Glu?Ile?Met?Arg?Ser?Phe?Ser

165?????????????????170?????????????????175Phe?Ser?Thr?Asn?Leu?Gln?Lys?Gly?Leu?Arg?Arg?Lys?Asp?Met?Pro?Leu

180?????????????????185?????????????????190Ser?Phe?Ser?Leu?Leu?Met?Ala?Val?Leu?Val?Leu?Ser?Tyr?Lys?Ser?Ile

195?????????????????200?????????????????205Cys?Ser?Leu?Gly?Cys?Asp?Leu?Pro?Gln?Thr?His?Ser?Leu?Gly?Asn?Arg

210?????????????????215?????????????????220Arg?Ala?Trp?Ile?Leu?Leu?Ala?Gln?Met?Gly?Arg?Ile?Ser?His?Phe?Ser225?????????????????230?????????????????235?????????????????240Cys?Leu?Lys?Asp?Arg?Tyr?Asp?Phe?Gly?Phe?Pro?Gln?Glu?Val?Phe?Asp

245?????????????????250?????????????????255Gly?Asn?Gln?Phe?Gln?Lys?Ala?Gln?Ala?Ile?Ser?Ala?Phe?His?Glu?Met

260?????????????????265?????????????????270Ile?Gln?Gln?Thr?Phe?Asn?Leu?Phe?Ser?Thr?Lys?Asp?Ser?Ser?Ala?Ala

275?????????????????280?????????????????285Trp?Asp?Glu?Thr?Leu?Leu?Asp?Lys?Phe?Tyr?Ile?Glu?Leu?Phe?Gln?Gln

290?????????????????295?????????????????300Leu?Asn?Asp?Leu?Glu?Ala?Cys?Val?Thr?Gln?Glu?Val?Gly?Val?Glu?Glu305?????????????????310?????????????????315?????????????????320Ile?Ala?Leu?Met?Asn?Glu?Asp?Ser?Ile?Leu?Ala?Val?Arg?Lys?Tyr?Phe

325?????????????????330?????????????????335Gln?Arg?Ile?Thr?Leu?Tyr?Leu?Met?Gly?Lys?Lys?Tyr?Ser?Pro?Cys?Ala

340?????????????????345?????????????????350Trp?Glu?Val?Val?Arg?Ala?Glu?Ile?Met?Arg?Ser?Phe?Ser?Phe?Ser?Thr

355?????????????????360?????????????????365Asn?Leu?Gln?Lys?Gly?Leu?Arg?Arg?Lys?Asp

370?????????????????375<210>11<211>195<212>PRT<213>Homo?sapiens<400>11Met?Ala?Phe?Val?Leu?Ser?Leu?Leu?Met?Ala?Leu?Val?Leu?Val?Ser?Tyr??1???????????????5??????????????????10??????????????????15Gly?Pro?Gly?Arg?Ser?Leu?Gly?Cys?Tyr?Leu?Ser?Glu?Asp?His?Met?Leu

20??????????????????25??????????????????30Gly?Ala?Arg?Glu?Asn?Leu?Arg?Leu?Leu?Ala?Arg?Met?Asn?Arg?Leu?Ser

35??????????????????40??????????????????45Pro?His?Pro?Cys?Leu?Gln?Asp?Arg?Lys?Asp?Phe?Gly?Leu?Pro?Gln?Glu

50??????????????????55??????????????????60Met?Val?Glu?Gly?Asn?Gln?Leu?Gln?Lys?Asp?Gln?Ala?Ile?Ser?Val?Leu?65??????????????????70??????????????????75??????????????????80His?Glu?Met?Leu?Gln?Gln?Cys?Phe?Asn?Leu?Phe?Tyr?Thr?Glu?His?Ser

85??????????????????90??????????????????95Ser?Ala?Ala?Trp?Asn?Thr?Thr?Leu?Leu?Glu?Gln?Leu?Cys?Thr?Gly?Leu

100?????????????????105?????????????????110Gln?Gln?Gln?Leu?Glu?Asp?Leu?Asp?Ala?Cys?Leu?Gly?Pro?Val?Met?Gly

115?????????????????120?????????????????125Glu?Lys?Asp?Ser?Asp?Met?Gly?Arg?Met?Gly?Pro?Ile?Leu?Thr?Val?Lys

130?????????????????135?????????????????140Lys?Tyr?Phe?Gln?Gly?Ile?His?Val?Tyr?Leu?Lys?Glu?Lys?Glu?Tyr?Ser145?????????????????150?????????????????155?????????????????160Asp?Cys?Ala?Trp?Glu?Ile?Ile?Arg?Met?Glu?Met?Met?Arg?Ala?Leu?Ser

165?????????????????170?????????????????175Ser?Ser?Thr?Thr?Leu?Gln?Lys?Arg?Leu?Arg?Lys?Met?Gly?Gly?Asp?Leu

180?????????????????185?????????????????190Asn?Ser?Leu

195<210>12<211>196<212>PRT<213>Homo?sapiens<400>12Met?Ala?Phe?Val?Leu?Ser?Leu?Leu?Met?Ala?Leu?Val?Leu?Val?Ser?Tyr??1???????????????5??????????????????10??????????????????15Gly?Pro?Gly?Gly?Ser?Leu?Gly?Cys?Tyr?Leu?Ser?Gln?Arg?Leu?Met?Leu

20??????????????????25??????????????????30Asp?Ala?Arg?Glu?Asn?Leu?Lys?Leu?Leu?Glu?Pro?Met?Asn?Arg?Leu?Ser

35??????????????????40??????????????????45Pro?His?Ser?Cys?Leu?Gln?Asp?Arg?Lys?Asp?Phe?Gly?Leu?Pro?Gln?Glu

50??????????????????55??????????????????60Met?Val?Glu?Gly?Asp?Gln?Leu?Gln?Lys?Asp?Gln?Ala?Phe?Pro?Val?Leu?65??????????????????70??????????????????75??????????????????80Tyr?Glu?Met?Leu?Gln?Gln?Thr?Phe?Asn?Leu?Phe?His?Thr?Glu?His?Ser

85??????????????????90??????????????????95Ser?Ala?Ala?Trp?Asp?Thr?Thr?Leu?Leu?Glu?Gln?Leu?Cys?Thr?Gly?Leu

100?????????????????105?????????????????110Gln?Gln?Gln?Leu?Glu?Asp?Leu?Asp?Thr?Cys?Cys?Arg?Gly?Gln?Val?Met

115?????????????????120?????????????????125Gly?Glu?Glu?Asp?Ser?Glu?Leu?Gly?Asn?Met?Asp?Pro?Ile?Val?Thr?Val

130?????????????????135?????????????????140Lys?Lys?Tyr?Phe?Gln?Gly?Ile?Tyr?Asp?Tyr?Leu?Gln?Glu?Lys?Gly?Tyr145?????????????????150?????????????????155?????????????????160Ser?Asp?Cys?Ala?Trp?Glu?Ile?Val?Arg?Val?Glu?Met?Met?Arg?Ala?Leu

165?????????????????170?????????????????175Thr?Val?Ser?Thr?Thr?Leu?Gln?Lys?Arg?Leu?Thr?Lys?Met?Gly?Gly?Asp

180?????????????????185?????????????????190Leu?Asn?Ser?Pro

195<210>13<211>170<212>PRT<213>Homo?sapiens<400>13Met?Ala?Gln?Ile?Tyr?Leu?Val?Met?Ala?Gly?Val?Met?Leu?Cys?Ser?Ile??1???????????????5??????????????????10??????????????????15Ser?Val?Cys?Phe?Leu?Asp?Gln?Asn?Leu?Ser?Ala?Val?His?Cys?Val?Glu

20??????????????????25??????????????????30Lys?Arg?Glu?Ile?Phe?Lys?His?Leu?Gln?Glu?Ile?Lys?Lys?Ile?Pro?Ser

35??????????????????40??????????????????45Gln?Leu?Cys?Leu?Lys?Asp?Arg?Ile?Asp?Phe?Lys?Phe?Pro?Trp?Lys?Arg

50??????????????????55??????????????????60Glu?Ser?Ile?Thr?Gln?Leu?Gln?Lys?Asp?Gln?Ala?Phe?Pro?Val?Leu?Tyr?65??????????????????70??????????????????75??????????????????80Glu?Met?Leu?Gln?Gln?Thr?Phe?Asn?Leu?Phe?His?Thr?Glu?His?Ser?Ser

85??????????????????90??????????????????95Ala?Ala?Trp?Asn?Thr?Thr?Leu?Leu?Asp?Gln?Leu?Leu?Ser?Ser?Leu?Asp

100?????????????????105?????????????????110Leu?Gly?Leu?Arg?Arg?Leu?Glu?His?Met?Lys?Lys?Asp?Asn?Met?Asp?Cys

115?????????????????120?????????????????125Pro?His?Val?Gly?Ser?Ala?Leu?Arg?Lys?Tyr?Phe?Gln?Gly?Ile?Gly?Leu

130?????????????????135?????????????????140Tyr?Leu?Lys?Glu?Lys?Lys?Tyr?Ser?Pro?Cys?Ala?Trp?Glu?Ile?Val?Arg145?????????????????150?????????????????155?????????????????160Val?Glu?Ile?Glu?Arg?Cys?Phe?Ser?Leu?Thr

165?????????????????170<210>14<211>212<212>PRT<213>Homo?sapiens<400>14Met?Asn?Ser?Phe?Ser?Thr?Ser?Ala?Phe?Gly?Pro?Val?Ala?Phe?Ser?Leu??1???????????????5??????????????????10??????????????????15Gly?Leu?Leu?Leu?Val?Leu?Pro?Ala?Ala?Phe?Pro?Ala?Pro?Val?Pro?Pro

20??????????????????25??????????????????30Gly?Glu?Asp?Ser?Lys?Asp?Val?Ala?Ala?Pro?His?Arg?Gln?Pro?Leu?Thr

35??????????????????40??????????????????45Ser?Ser?Glu?Arg?Ile?Asp?Lys?Gln?Ile?Arg?Tyr?Ile?Leu?Asp?Gly?Ile

50??????????????????55??????????????????60Ser?Ala?Leu?Arg?Lys?Glu?Thr?Cys?Asn?Lys?Ser?Asn?Met?Cys?Glu?Ser?65??????????????????70??????????????????75??????????????????80Ser?Lys?Glu?Ala?Leu?Ala?Glu?Asn?Asn?Leu?Asn?Leu?Pro?Lys?Met?Ala

85??????????????????90??????????????????95Lys?Glu?Asp?Gly?Cys?Phe?Gln?Ser?Gly?Phe?Asn?Glu?Glu?Thr?Cys?Leu

100?????????????????105?????????????????110Val?Lys?Ile?Ile?Thr?Gly?Leu?Leu?Glu?Phe?Glu?Val?Tyr?Leu?Glu?Tyr

115?????????????????120?????????????????125Leu?Gln?Asn?Arg?Phe?Glu?Ser?Ser?Glu?Glu?Gln?Ala?Arg?Ala?Val?Gln

130?????????????????135?????????????????140Met?Ser?Thr?Lys?Val?Leu?Ile?Gln?Phe?Leu?Gln?Lys?Lys?Ala?Lys?Asn145?????????????????150?????????????????155?????????????????160Leu?Asp?Ala?Ile?Thr?Thr?Pro?Asp?Pro?Thr?Thr?Asn?Ala?Ser?Leu?Leu

165?????????????????170?????????????????175Thr?Lys?Leu?Gln?Ala?Gln?Asn?Gln?Trp?Leu?Gln?Asp?Met?Thr?Thr?His

180?????????????????185?????????????????190Leu?Ile?Leu?Arg?Ser?Phe?Lys?Glu?Phe?Leu?Gln?Ser?Ser?Leu?Arg?Ala

195?????????????????200?????????????????205Leu?Arg?Gln?Met

210<210>15<211>186<212>PRT<213>Homo?sapiens<400>15Met?Thr?His?Arg?Cys?Leu?Leu?Gln?Met?Val?Leu?Leu?Leu?Cys?Phe?Ser??1???????????????5??????????????????10??????????????????15Thr?Thr?Ala?Leu?Ser?Arg?Ser?Tyr?Ser?Leu?Leu?Arg?Phe?Gln?Gln?Arg

20??????????????????25??????????????????30Arg?Ser?Leu?Ala?Leu?Cys?Gln?Lys?Leu?Leu?Arg?Gln?Leu?Pro?Ser?Thr

35??????????????????40??????????????????45Pro?Gln?His?Cys?Leu?Glu?Ala?Arg?Met?Asp?Phe?Gln?Met?Pro?Glu?Glu

50??????????????????55??????????????????60Met?Lys?Gln?Ala?Gln?Gln?Phe?Gln?Lys?Glu?Asp?Ala?Ile?Leu?Val?Ile?65??????????????????70??????????????????75??????????????????80Tyr?Glu?Met?Leu?Gln?Gln?Ile?Phe?Ash?Ile?Leu?Thr?Arg?Asp?Phe?Ser

85??????????????????90??????????????????95Ser?Thr?Gly?Trp?Ser?Glu?Thr?Ile?Ile?Glu?Asp?Leu?Leu?Glu?Glu?Leu

100?????????????????105?????????????????110Tyr?Glu?Gln?Met?Asn?His?Leu?Glu?Pro?Ile?Gln?Lys?Glu?Ile?Met?Gln

115?????????????????120?????????????????125Lys?Gln?Ash?Ser?Thr?Met?Gly?Asp?Thr?Thr?Val?Leu?His?Leu?Arg?Lys

130?????????????????135?????????????????140Tyr?Tyr?Phe?Asn?Leu?Val?Gln?Tyr?Leu?Lys?Ser?Lys?Glu?Tyr?Asn?Arg145?????????????????150?????????????????155?????????????????160Cys?Ala?Trp?Thr?Val?Val?Arg?Val?Gln?Ile?Leu?Arg?Asn?Phe?Ser?Phe

165?????????????????170?????????????????175Leu?Thr?Arg?Leu?Thr?Gly?Tyr?Leu?Arg?Glu

180?????????????????185<210>16<21l>29<212>DNA<213>Homo?sapiens<400>16ggccgcatat?gctggactgt?aacttactg???????????????????????????????????29<210>17<211>33<212>DNA<213>Homo?sapiens<400>17ggccgcggta?ccttatttcc?tcctgaatag?agc??????????????????????????????33<210>18<21l>38<212>DNA<213>Homo?sapiens<400>18ggccgggatc?cgccatcatg?agcaccaaac?ctgatatg?????????????????????????38<210>19<21l>33<212>DNA<213>Homo?sapiens<400>19ggccgcggta?ccttatttcc?tcctgaatag?agc??????????????????????????????33<210>20<211>156<212>PRT<213>Homo?sapiens<400>20Met?Thr?Tyr?Arg?Cys?Leu?Leu?Gln?Met?Val?Leu?Leu?Leu?Cys?Phe?Ser??1???????????????5??????????????????10??????????????????15Thr?Thr?Ala?Leu?Ser?Arg?Ser?Tyr?Ser?Leu?Leu?Arg?Phe?Gln?Gln?Arg

20??????????????????25??????????????????30Gln?Ser?Leu?Lys?Glu?Cys?Gln?Lys?Leu?Leu?Gly?Gln?Leu?Pro?Ser?Thr

35??????????????????40??????????????????45Ser?Gln?His?Cys?Leu?Glu?Ala?Arg?Met?Asp?Phe?Gln?Met?Pro?Glu?Glu

50??????????????????55??????????????????60Met?Lys?Gln?Glu?Gln?Gln?Phe?Gln?Lys?Glu?Asp?Ala?Ile?Leu?Val?Met?65??????????????????70??????????????????75??????????????????80Tyr?Glu?Val?Leu?Gln?His?Ile?Phe?Gly?Ile?Leu?Thr?Arg?Asp?Phe?Ser

85??????????????????90??????????????????95Ser?Thr?Gly?Trp?Asn?Ser?Thr?Thr?Glu?Asp?Thr?Ile?Val?Pro?His?Leu

100?????????????????105?????????????????110Gly?Lys?Tyr?Tyr?Phe?Ash?Leu?Met?Gln?Tyr?Leu?Glu?Ser?Lys?Glu?Tyr

115?????????????????120?????????????????125Asp?Arg?Cys?Ala?Trp?Thr?Val?Val?Gln?Val?Gln?Ile?Leu?Thr?Asn?Val

130?????????????????135?????????????????140Ser?Phe?Leu?Met?Arg?Leu?Thr?Gly?Tyr?Val?Arg?Asp145?????????????????150?????????????????155<210>21<211>166<212>PRT<213>Homo?sapiens<400>21Met?Ser?Tyr?Asn?Leu?Leu?Gly?Phe?Leu?Gln?Arg?Ser?Ser?Asn?Phe?Gln??1???????????????5??????????????????10??????????????????15Cys?Gln?Lys?Leu?Leu?Trp?Gln?Leu?Asn?Gly?Arg?Leu?Glu?Tyr?Cys?Leu

20??????????????????25??????????????????30Lys?Asp?Arg?Met?Asn?Phe?Asp?Ile?Pro?Glu?Glu?Ile?Lys?Gln?Leu?Gln

35??????????????????40??????????????????45Gln?Phe?Gln?Lys?Glu?Asp?Ala?Ala?Leu?Thr?Ile?Tyr?Glu?Met?Leu?Gln

50??????????????????55??????????????????60Asn?Ile?Phe?Ala?Ile?Phe?Arg?Gln?Asp?Ser?Ser?Ser?Thr?Gly?Trp?Asn?65??????????????????70??????????????????75??????????????????80Glu?Thr?Ile?Val?Glu?Asn?Leu?Leu?Ala?Asn?Val?Tyr?His?Gln?Ile?Asn

85??????????????????90??????????????????95His?Leu?Lys?Thr?Val?Leu?Glu?Glu?Lys?Leu?Glu?Lys?Glu?Asp?Phe?Thr

100?????????????????105?????????????????110Arg?Gly?Lys?Leu?Met?Ser?Ser?Leu?His?Leu?Lys?Arg?Tyr?Tyr?Gly?Arg

115?????????????????120?????????????????125Ile?Leu?His?Tyr?Leu?Lys?Ala?Lys?Glu?Tyr?Ser?His?Cys?Ala?Trp?Thr

130?????????????????135?????????????????140Ile?Val?Arg?Val?Glu?Ile?Leu?Arg?Asn?Phe?Tyr?Phe?Ile?Asn?Arg?Leu145?????????????????150?????????????????155?????????????????160Thr?Gly?Tyr?Leu?Gly?Asn

165

Claims

1, a kind of isolating polynucleotide, it comprises at least 95% and is same as the nucleotide sequence that is selected from the member of next group:

(a) nucleotide sequence of polypeptide shown in 1～207 residue of coding SEQ ID NO:2;

(b) nucleotide sequence of polypeptide shown in 2～207 residues of coding SEQ ID NO:2;

(c) nucleotide sequence of polypeptide shown in 28～207 residues of coding SEQ ID NO:2;

(d) nucleotide sequence of polypeptide shown in 30～207 residues of coding SEQ ID NO:2;

(e) nucleotide sequence of polypeptide shown in 165～183 residues of coding SEQ ID NO:2;

(f) coding is by the nucleotide sequence that is contained in the complete polypeptide of people cDNA coding among the clone HKAPI15;

(g) coding is by the nucleotide sequence of complete polypeptide except that N end methionine(Met) that is contained in people cDNA coding among the clone HKAPI15;

(h) coding is by the nucleotide sequence that is contained in the mature polypeptide of people cDNA coding among the clone HKAPI15;

(i) with above (a), (b), (c), (d), (e), (f), arbitrary nucleotide sequence complementary nucleotide sequence (g) or (h).

2, a kind of isolating polynucleotide, it comprises the nucleotide sequence that is selected from next group:

(a) nucleotide sequence of the biological active fragment of polypeptide shown in 1～207 residue of coding SEQ ID NO:2; And

(b) with (a) nucleotide sequence complementary nucleotide sequence.

3, the nucleic acid molecule of claim 1, wherein said polynucleotide have the nucleotide sequence of KDI polypeptide that coding has 165～183 amino acids sequences of SEQID NO:2, shown in Fig. 1 (SEQ ID NO:1).

4, the nucleic acid molecule of claim 1, wherein said polynucleotide have the nucleotide sequence of KDI polypeptide that coding has 28～207 amino acids sequences of SEQID NO:2, shown in Fig. 1 (SEQ ID NO:1).

5, a kind of isolated nucleic acid molecule, it comprises and has at least 95% and be same as the polynucleotide that are selected from the nucleotide sequence of the sequence of next group:

(a) coding comprises the nucleotide sequence of polypeptide of aminoacid sequence of n～207 residue of SEQ ID NO:2, and wherein n is the integer in 1～59 scope;

(b) coding comprises the nucleotide sequence of polypeptide of aminoacid sequence of 1～m position residue of SEQ ID NO:2, and wherein m is the integers in 183～207 scopes;

(c) coding has the nucleotide sequence by the polypeptide of n～aminoacid sequence that m position residue is formed of SEQ ID NO:2, and wherein n and m are respectively at (a) with the integer of qualification (b);

(d) coding is by the nucleotide sequence that is contained in people cDNA encoded polypeptides among the HKPI15, and wherein said polypeptide N end lacks the amino acid between 1～58;

(e) coding is by the nucleotide sequence that is contained in people cDNA encoded polypeptides among the HKAPI15, and wherein said peptide C end lacks the amino acid between 1～23;

(f) coding is by the nucleotide sequence that is contained in people cDNA encoded polypeptides among the HKAPI15, wherein said polypeptide have (d) and (e) described in the arbitrary combination that lacks of N and C end.

6, a kind of isolated nucleic acid molecule, it is included under the stringent hybridization condition, with have the claim 1 of being same as (a), (b), (c), (d), (e), (f), (g) or (h) in the polynucleotide of multi-nucleotide hybrid of nucleotide sequence of nucleotide sequence, wherein said polynucleotide are not hybridized with the polynucleotide that only have the nucleotide sequence of being made up of A residue or T residue under stringent hybridization condition.

7, a kind of isolated nucleic acid molecule, it comprises (a) that coding has claim 1, (b), (c), (d), (e), (f) or (g) in the KDI polypeptide of aminoacid sequence carry the polynucleotide of the aminoacid sequence of epi-position part.

8, the isolated nucleic acid molecule of claim 7, it comprises coding and is selected from the nucleotide sequence that carries the epi-position part with the KDI polypeptide of next group:

The polypeptide that comprises about Ser49～Ser54 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Cys59～Ala65 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Pro78～Tyr88 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about His101～Gln113 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Gln120～Glu123 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Cys128～Pro155 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Leu160～Arg168 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Asn171～Asp180 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Val186～Cys193 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Phe204～Lys207 amino-acid residue among the SEQ ID NO:2.

9, a kind of method of producing recombinant vectors comprises the isolated nucleic acid molecule of claim 1 is inserted carrier.

10, a kind of recombinant vectors of producing by the method for claim 9.

11, a kind of method of producing recombinant host cell comprises that the recombinant vectors with claim 10 imports host cell.

12, a kind of recombinant host cell of producing by the method for claim 11.

13, a kind of recombination method of producing the KDI polypeptide is included in the recombinant host cell of cultivating claim 12 under the condition that described polypeptide expressed, and reclaims described polypeptide.

14, a kind of isolating KDI polypeptide, it comprises at least 95% and is same as the aminoacid sequence that is selected from the member of next group:

(a) polypeptide shown in 1～207 of SEQ ID NO:2 residue;

(b) polypeptide shown in 2～207 of SEQ ID NO:2 residues;

(c) polypeptide shown in 28～207 of SEQ ID NO:2 residues;

(d) polypeptide shown in 165～183 of SEQ ID NO:2 residues;

(e) by the complete polypeptide that is contained in people cDNA coding among the clone HKAPI15;

(f) by the complete polypeptide except that N end methionine(Met) that is contained in people cDNA coding among the clone HKAPI15;

(g) by the mature polypeptide that is contained in people cDNA coding among the clone HKAPI15.

15, a kind of isolated polypeptide, it comprises KDI albumen and carries the epi-position part, and wherein said part is selected from next group:

The polypeptide that comprises about Ser49-Ser54 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Cys59-Ala65 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Pro78-Tyr88 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about His101-Gln113 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Gln120-Glu123 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Cys128-Pro155 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Leu160-Arg168 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Asn171-Asp180 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Val186-Cys193 amino-acid residue among the SEQ ID NO:2;

The polypeptide that comprises about Phe204-Lys207 amino-acid residue among the SEQ ID NO:2.

16, a kind of isolated antibody, the KDI polypeptide specific combination of itself and claim 14.

17, a kind of isolated nucleic acid molecule, it comprises and has at least 95% polynucleotide of nucleotide sequence that are same as at least 50 continuous nucleotides of SEQ IDNO:1.

18, a kind of isolated polypeptide, it comprises the aminoacid sequence of polypeptide biological active fragment shown in 1～207 residue of SEQ ID NO:2.

19, a kind of pharmaceutical composition, it is included in the polypeptide of the claim 14 in the drug acceptable carrier.

20, a kind of method for the treatment of patient's virus infection comprises the composition of using claim 19 to the patient.