New! Search for patents from more than 100 countries including Australia, Brazil, Sweden and more

WO1997034911A1 - Apoptosis inducing molecule ii - Google Patents

Apoptosis inducing molecule ii Download PDF


Publication number
WO1997034911A1 PCT/US1996/016966 US9616966W WO9734911A1 WO 1997034911 A1 WO1997034911 A1 WO 1997034911A1 US 9616966 W US9616966 W US 9616966W WO 9734911 A1 WO9734911 A1 WO 9734911A1
Prior art keywords
aim ii
amino acid
seq id
Prior art date
Application number
Other languages
French (fr)
Reinhard Ebner
Steven M. Ruben
Guo-Liang Yu
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US1392396P priority Critical
Priority to US60/013,923 priority
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority claimed from AU11153/97A external-priority patent/AU734384B2/en
Publication of WO1997034911A1 publication Critical patent/WO1997034911A1/en



    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70575NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
    • A61K38/00Medicinal preparations containing peptides
    • C07K2319/00Fusion polypeptide
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/38Medical treatment of vector-borne diseases characterised by the agent
    • Y02A50/408Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa
    • Y02A50/411Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Plasmodium, i.e. Malaria
    • Y02A50/412Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Plasmodium, i.e. Malaria the medicinal preparation containing antigens or antibodies, e.g. vaccines, antisera


The present invention relates to a novel member of the TNF-Ligand superfamily, Apoptosis Inducing Molecule II (AIM II). In particular, isolated nucleic acid molecules are provided encoding the human AIM II protein. AIM II polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of AIM II activity. Also provided are therapeutic methods for treating lymphadenopathy, autoimmune disease, graft versus host disease, and to inhibit neoplasia, such as tumor cell growth.


Apoptosis Inducing Molecule II

Background of the Invention Field of the Invention

The present invention relates to a novel member of the TNF-Ligand superfamily. More specifically, isolated nucleic acid molecules are provided encoding a human Apoptosis Inducing Molecule II (AIM II). AIM II polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of AIM II activity. Also provided are therapeutic methods for treating lymphadenopathy, autoimmune disease, graft versus host disease, and to inhibit neoplasia, such as tumor cell growth.

Related Art

Human tumor necrosis factors α (TNF-α) and β (TNF-β, or lymphotoxin) are related members of a broad class of polypeptide mediators, which includes the interferons, interleukins and growth factors, collectively called cytokines (Beutler, B. and Cerami. A., Annu. Ret,. Immunol, 7:625-655 (1989)).

Tumor necrosis factor (TNF-α and TNF-β) was originally discovered as a result of its anti-tumor activity, however, now it is recognized as a pleiotropic cytokine capable of numerous biological activities including apoptosis of some transformed cell lines, mediation of cell activation and proliferation and also as playing important roles in immune regulation and inflammation.

To date, known members of the TNF-ligand superfamily include TNF-α, TNF-β (lymphotoxin-α). LT-β, OX40L, Fas ligand, CD30L, CD27L, CD40L and 4-IBBL. The ligands of the TNF ligand superfamily are acidic, TNF-like molecules with approximately 20% sequence homology in the extracellular domains (range, 12%-36%) and exist mainly as membrane-bound forms with the biologically active form being a trimeric/multimeric complex. Soluble forms of the TNF ligand superfamily have only been identified so far for TNF, LTα, and Fas ligand (for a general review, see Gruss, H. and Dower, S.K., Blood, 85(12):3378-3404 (1995)), which is hereby incorporated by reference in its entirety.

These proteins are involved in regulation of cell proliferation, activation, and differentiation, including control of cell survival or death by apoptosis or cytotoxicity (Armitage, R.J., Curr. Opin. Immunol. 6:407 (1994) and Smith, C. A., Cell 75:959 (1994)).

Mammalian development is dependent on both the proliferation and differentiation of cells as well as programmed cell death which occurs through apoptosis (Walker, et al., Methods Achiev. Exp. Pathol. 13:18 (1988). Apoptosis plays a critical role in the destruction of immune thymocytes that recognize self antigens. Failure of this normal elimination process may play a role in autoimmune diseases (Gammon et al, Immunology Today 12:193 (1991)).

Itoh et al. (Cell 66:233 (1991)) described a cell surface antigen, Fas/CD95 that mediates apoptosis and is involved in clonal deletion of T-cells. Fas is expressed in activated T-cells, B-cells, neutrophils and in thymus, liver, heart and lung and ovary in adult mice (Watanabe-Fukunaga et al., J. Immunolo. 148:1274 (1992)) in addition to activated T-cells, B-cells, neutorophils. In experiments where a monoclonal Ab to Fas is cross-linked to Fas, apoptosis is induced

(Yonehara et al., J. Exp. Med. 169:1741 (1989); Trauth et al., Science 245:301 (1989)). In addition, there is an example where binding of a monoclonal Ab to Fas may stimulate T-cells under certain conditions (Alderson et al., J. Exp. Med. 178:2231 (1993)).

Fas antigen is a cell surface protein of relative MW of 45 Kd. Both human and murine genes for Fas have been cloned by Watanabe-Fukunaga et al., (J. Immunol. 148:1214 (1992)) and Itoh et al. (Cell 66:233 (1991)). The proteins encoded by these genes are both transmembrane proteins with structural homology to the Nerve Growth Factor/Tumor Necrosis Factor receptor superfamily, which includes two TNF receptors, the low affinity Nerve Growth Factor receptor and the LTβ receptor CD40, CD27, CD30, and OX40.

Recently the Fas ligand has been described (Suda et al., Cell 75:1169 (1993)). The amino acid sequence indicates that Fas ligand is a type II transmembrane protein belonging to the TNF family. Fas ligand is expressed in splenocytes and thymocytes. The purified Fas ligand has a MW of 40 kd.

Recently, it has been demonstrated that Fas/Fas ligand interactions are required for apoptosis following the activation of T-cells (Ju et al., Nature 373:444 (1995); Brunner et al., Nature 373:441 (1995)). Activation of T-cells induces both proteins on the cell surface. Subsequent interaction between the ligand and receptor results in apoptosis of the cells. This supports the possible regulatory role for apoptosis induced by Fas/Fas ligand interaction during normal immune responses.

The polypeptide of the present invention has been identified as a novel member of the TNF ligand super-family based on structural and biological similarities.

Clearly, there is a need for factors that regulate activation, and differentiation of normal and abnormal cells. There is a need, therefore, for identification and characterization of such factors that modulate activation and differentiation of cells, both normally and in disease states. In particular, there is a need to isolate and characterize additional Fas ligands that control apoptosis ofr the treatment of autoimmune disease, graft versus host disease and lymphadenopathy.

Summary of the Invention The present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding the AIM II polypeptide having the amino acid sequence shown in Figures 1A-C (SEQ ID NO:2) or the amino acid sequence encoded by the cDNA clone deposited in a bacterial host as ATCC Deposit Number 97689 on August 22, 1996.

The present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of AIM II polypeptides or peptides by recombinant techniques.

The invention further provides an isolated AIM II polypeptide having an amino acid sequence encoded by a polynucleotide described herein.

As used herein the term "AIM II" polypeptide includes membrane-bound proteins (comprising a cytoplasmic domain, a transmembrane domain, and an extracellular domain) as well as truncated proteins that retain the AIM II polypeptide activity. In one embodiment, soluble AIM II polypeptides comprise all or part of the extracellular domain of an AIM II protein, but lack the transmsmbrane region that would cause retention of the polypeptide on a cell membrane. Soluble AIM II may also include part of the transmembrane region or part of the cytoplasmic domain or other sequences, provided that the soluble AIM II protein is capable of being secreted. A heterologous signal peptide can be fused to the N-terminus of the soluble AIM II polypeptide such that the soluble AIM II polypeptide is secreted upon expression.

The invention also provides for AIM II polypeptides, particularly human AIM-II polypeptides, which may be employed to treat lymphadenopathy, autoimmune disease, graft versus host disease, which may be used to stimulate peripheral tolerance, destroy some transformed cell lines, mediate cell activation and proliferation and are functionally linked as primary mediators of immune regulation and inflammatory response.

The invention further provides compositions comprising an AIM II polynucleotide or an AIM II polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism. In certain particularly preferred embodiments of this aspect of the invention, the compositions comprise an AIM II polynucleotide for expression of an AIM II polypeptide in a host organism for treatment of disease. Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with aberrant endogenous activity of an AIM II.

. The present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a cellular response induced by AIM II, which involves contacting cells which express AIM II with the candidate compound, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assyed when contact is made in absence of the candidate compound; whereby, an increased cellular response over the standard indicates that the compound is an agonist and a decreased cellular response over the standard indicates that the compound is an antagonist.

In another aspect, a screening assay for AIM II agonists and antagonists is provided. The antagonists may be employed to prevent septic shock, inflammation, cerebral malaria, activation of the HIV virus, graft-host rejection, bone resorption, rheumatoid arthritis and cachexia (wasting or malnutrition).

An additional aspect of the invention is related to a method for treating an individual in need of an increased level of AIM II activity in the body comprising administering to such an indivdual a composition comprising a therapeutically effective amount of an isolated AIM II polypeptide of the invention or an agonist thereof.

A still further aspect of the invention is related to a method for treating an individual in need of a decreased level of AIM II activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of an AIM II antagonist.

Brief Description of the Figures

Figures 1A-C show the nucleotide (SEQ ID NO:l) and deduced amino acid (SEQ ID NO:2) sequences of AIM II. The protein has a deduced molecular weight of about 26.4 kDa. The predicted Transmembrane Domain of the AIM II protein is underlined.

Figures 2A-F show the regions of similarity between the amino acid sequences of the AIM II protein and human TNF-α (SEQ ID NO: 3), human TNF-β (SEQ ID NO:4), human lymphotoxin (SEQ ID NO:5) and human Fas

Ligand (SEQ ID NO:6).

Figures 3A-F show an analysis of the AIM II amino acid sequence. Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown. In the "Antigenic Index - Jameson- Wolf ' graph, about amino acid residues 13-20, 23-36, 69-79, 85-94, 167-178, 184-196, 221-233 in Figures 1A-C correspond to the shown highly antigenic regions of the AIM II protein.

Detailed Description

The present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding an AIM II polypeptide having the amino acid sequence shown in Figures 1A-C (SEQ ID NO:2), which was determined by sequencing a cloned cDNA. The AIM II protein of the present invention shares sequence homology with human TNF-α (SEQ ID NO: 3), human TNF-β (SEQ

ID NO:4), human lymphotoxin (SEQ ID NO: 5) and human Fas Ligand (SEQ ID NO:6) (Figures 2A-F). The nucleotide sequence shown in Figures 1 A-C (SEQ

ID NO:1) were obtained by sequencing the a cDNA clone, which was deposited on August 22, 1996 at the American Type Culture Collection, 12301 Park Lawn

Drive, Rockville. Maryland 20852, and given accession number 97689. The deposited clone is contained in the pBluescript SK(-) plasmid (Stratagene, La Jolla, CA). Nucleic Acid Molecules

Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about

99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.

Using the information provided herein, such as the nucleotide sequence in Figures 1A-C, a nucleic acid molecule of the present invention encoding an AIM II polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material. Illustrative of the invention, the nucleic acid molecule described in Figures 1A-C (SEQ ID NO:1) was discovered in a cDNA library derived from human macrophage ox LDL (HMCCB64). The gene was also identified in cDNA libraries from activated T-cells (HT4CC72). The determined nucleotide sequence of the AIM II cDNA of Figures 1 A-C (SEQ ID NO:1) contains an open reading frame encoding a protein of 240 amino acid residues, with an initiation codon at positions 49-51 of the nucleotide sequence in Figures 1A-C (SEQ ID NO:1), an extracellular domain comprising amino acid residues from about 60 to about 240 in Figures 1 A-C (SEQ ID NO:2), a transmembrane domain comprising amino acid residues from about 37 to about 59 in Figures 1A-C (SEQ ID NO:2), a intracellular domain comprising amino acid residues from about 1 to about 36 in

Figures 1A-C (SEQ ID NO:2) and a deduced molecular weight of about 26.4 kDa. The AIM II protein shown in Figures 1 A-C (SEQ ID NO:2) is about 27% identical and about 51% similar to the amino acid sequence of human Fas Ligand (Figures 2A-F) and is about 26% identical and about 47% similar to the amino acid sequence of human TNF-α (Figures 2A-F).

As one of ordinary skill would appreciate, due to the possibilities of sequencing errors discussed above, the predicted AIM II polypeptide encoded by the deposited cDNA comprises about 240 amino acids, but may be anywhere in the range of 230-250 amino acids. It will further be appreciated that, depending on the criteria used, concerning the exact "address" of the extracelluar, intracelluar and transmembrane domains of the AIMII polypeptide differ slightly. For example, the exact location of the AIM II extracellular domain in Figures 1 A-C [SEQ ID NO:2] may vary slightly (e.g., the address may "shift" by about 1 to 5 residues) depending on the criteria used to define the domain.

As indicated, nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically. The DNA may be double-stranded or single-stranded. Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.

By "isolated" nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment For example, recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention. Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.

Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) shown in Figures 1A-C (SEQ ID NO:1); DNA molecules comprising the coding sequence for the AIM II protein shown in Figures 1A-C (SEQ ID NO:2); and DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the AIM II protein.

Of course, the genetic code is well known in the art. Thus, it would be routine for one skilled in the art to generate such degenerate variants.

In another aspect, the invention provides isolated nucleic acid molecules encoding the AIM II polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97689 on

August 22, 1996. Preferably, this nucleic acid molecule will encode the polypeptide encoded by the above-described deposited cDNA clone. The invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figures 1 A-C (SEQ ID NO: 1) or the nucleotide sequence of the AIM II cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences. Such isolated molecules, particularly DNA molecules, are useful as probes for gene mapping, by in situ hybridization with chromosomes, and for detecting expression of the AIM II gene in human tissue, for instance, by Northern blot analysis.

The present invention is further directed to fragments of the isolated nucleic acid molecules described herein. By a fragment of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in Figures 1A-C (SEQ ID NO:1) is intended fragments at least about 15 nt. and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length which are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments 50-1500 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in Figures 1 A-C (SEQ

ID NO:1). By a fragment at least 20 nt in length, for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in Figures 1A-C (SEQ ID NO:1).

Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding epitope-bearing portions of the AIM II protein. In particular, such nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising amino acid residues from about 13 to about 20 in Figures 1 A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 23 to about 36 in Figures 1A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 69 to about 79 in Figures 1 A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 85 to about 94 in Figures 1 A-C (SEQ ID NO:2);a polypeptide comprising amino acid residues from about 167 to about 178 in Figures 1A-C (SEQ ID NO:2);a polypeptide comprising amino acid residues from about 184 to about 196 in

Figures 1 A-C (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 221 to about 233 in Figures 1 A-C (SEQ ID NO:2). The inventors have determined that the above polypeptide fragments are antigenic regions of the AIM II protein. Methods for determining other such epitope-bearing portions of the AIM II protein are described in detail below.

AIM-II polynucleotides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of the AIM-II. Among these applications in autoimmune disease and aberrant cellular proliferation. Additional applications relate to diagonsis and to treatment of disorders of cells, tissues, and organisms.

This invention is also related to the use of the AIM-II polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent. Detection of a mutated form of an AIM-II associated with a dysfunction will provide a diagnostic tool that can add or define a diagnosis of a disease or susceptibility to disease which reults from under-expression, over-expression or altered expression of AIM-II, such as, for example, autoimmune diseases. The polynucleotide encoding the AIM-II may also be employed as a diagnostic marker for expression of the polypeptide of the present invention since the gene is found in many tumor cell lines including pancreatic tumor, testcs tumor, endometrial tumor and T-cell lymphoma.

In another aspect, the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clone contained in ATCC Deposit 97689. By "stringent hybridization conditions" is intended overnight incubation at 42°C in a solution comprising: 50% formamide, 5x SSC (150 mM NaCl, 15mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65 °C.

By a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.

By a portion of a polynucleotide of "at least 20 nt in length," for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the deposited cDNA or the nucleotide sequence as shown in Figures 1A-C (SEQ ID NO:1)).

Of course, a polynucleotide which hybridizes only to a poly A sequence (such as the 3' terminal poly(A) tract of the AIM II cDNA shown in Figures 1 A-C (SEQ ID NO:1)), or to a complementary stretch of T (or U) resides, would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).

As indicated, nucleic acid molecules of the present invention which encode an AIM II polypeptide may include, but are not limited to those encoding the amino acid sequence of the polypeptide, by itself; the coding sequence for the polypeptide and additional sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities. Thus, the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide. In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. The "HA" tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al., Cell 37: 161 (1984). As discussed below, other such fusion proteins include the AIM II fused to Fc at the N- or C-terminus.

Nucleic acid molecules according to the present invention further include those encoding the full-length AIM-II polypeptide lacking the N-terminal methonine.

The present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the AIM II protein. Variants may occur naturally, such as a natural allelic variant. By an "allelic variant" is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non-naturally occurring variants may be produced using art-known mutagenesis techniques.

Such variants include those produced by nucleotide substitutions, deletions or additions which may involve one or more nucleotides. The variants may be altered in coding regoins, non-coding regions, or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the AIM II protein or portions thereof. Also especially preferred in this regard are conservative substitutions.

Further embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to (a) a nucleotide sequence encoding the AIM II polypeptide having the complete amino acid sequence in Figures 1 A-C (SEQ ID NO:2); (b) a nucleotide sequence encoding the AIM II polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97689; (c) a nucleotide sequence encoding the AIM II polypeptide extracellular domain; (d) a nucleotide sequence encoding the AIM II polypeptide transmembrane domain; (e) a nucleotide sequence encoding the AIM II polypeptide intracellular domain;

(f) a nucleotide sequence encoding a soluble AIM II polypeptide having the extracellular and intracellular domains but lacking the transmembrane domain; and (g) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f) above.

By a polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence encoding an AIM II polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the AIM II polypeptide. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.

As a practical matter, whether any particular nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the nucleotide sequence shown in Figures 1 A-C or to the nucleotides sequence of the deposited cDNA clone can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711. Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of homology between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.

The present application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figures 1A-C (SEQ ID NO: 1) or to the nucleic acid sequence of the deposited cDNA, irrespective of whether they encode a polypeptide having AIM II activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having AIM II activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having AIM II activity include, inter alia, (1) isolating the AIM II gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the AIM II gene, as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and Northern Blot analysis for detecting AIM II mRNA expression in specific tissues.

Preferred, however, are nucleic acid molecules having sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figures 1A-C (SEQ ID NO:1) or to the nucleic acid sequence of the deposited cDNA which do, in fact, encode a polypeptide having AIM II protein activity. By "a polypeptide having AIM II activity" is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the AIM II protein of the invention, as measured in a particular biological assay. For example, AIM II protein cytotoxic activity can be measured using propidium iodide staining to demonstrate apoptosis as described by Zarres et al., Cell 70: 31-46 (1992). Alternatively, AIMII induced apoptosis can also be measured using TU NEL staining as described by Gavierli et al., J. Cell. Biol. 119: 493-501 (1992).

Briefly, the propidium iodide staining is performed as follows. Cells either from tissue or culture are fixed in formaldehyde, cut into frozen sections and stained with propidium iodide. The cell nuclei are visualized by propidium iodide using confocal fluorescent microscopy. Cell death is indicated by pyknotic nuclei ( chromosome clumping, shrinking and/or fragmentation of nuclei).

Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large number of the nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in Figures 1A-C (SEQ ID NO:1) will encode a polypeptide "having AIM II protein activity." In fact, since degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay.

It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having AIM II protein activity. This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid).

For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie, J. U. et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247: 1306- 1310 (1990), wherein the authors indicate that proteins are surprisingly tolerant of amino acid substitutions. Vectors and Host Cells

The present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of AIM II polypeptides or fragments thereof by recombinant techniques.

The polynucleotides may be joined to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

The DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan. The expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiating at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.

As indicated, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracycline or ampicillin resistance genes for culturing in E. coli and other bacteria. Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli,

Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art. Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, ρKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other suitable vectors will be readily apparent to the skilled artisan.

Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology (1986).

The polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art. A preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins. For example, EP-A-O 464

533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof. In many cases, the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262). On the other hand, for some uses it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is the case when Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations. In drug discovery, for example, human proteins, such as, hIL5- has been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al., Journal of Molecular Recognition, Vol. 8:52-58 (1995) and K. Johanson et al., The Journal of Biological Chemistry, Vol. 270, No. 16:9459-9471 (1995).

The AIM II protein can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction, chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography

("HPLC") is employed for purification. Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes. AIMII Polypeptides and Fragments

The invention further provides an isolated AIM II polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in Figures 1A-C (SEQ ID NO:2), or a peptide or polypeptide comprising a protion of the above polypeptides. It will be recognized in the art that some amino acid sequences of the AIM II polypeptide can be varied without significant effect of the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the protein which determine activity.

Thus, the invention further includes variations of the AIM II polypeptide which show substantial AIM II polypeptide activity or which include regions of AIM II protein such as the protein portions discussed below. Such mutants include deletions, insertions, inversions, repeats, and type substitutions. As indicated above, guidance concerning which amino acid changes are likely to be phenotypically silent can be found in Bowie, J.U., et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990).

Thus, the fragment, derivative or analog of the polypeptide of Figures 1A-C (SEQ ID NO:2), or that encoded by the deposited cDNA, may be

(i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IgG Fc fusion region peptide of leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.

Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

Of particular interest are substitutions of charged amino acids with another charged amino acid and with neutral or negatively charged amino acids. The latter results in proteins with reduced positive charge to improve the characteristics of the AIM II protein. The prevention of aggregation is highly desirable. Aggregation of proteins not only results in a loss of activity but can also be problematic when preparing pharmaceutical formulations, because they can be immunogenic. (Pinckard et al., Clin Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36:838-845 (1987); Cleland et al. Crit. Rev. Therapeutic Drug Carrier Systems 10:307-377 (1993)).

The replacement of amino acids can also change the selectivity of binding to cell surface receptors. Ostade et al., Nature 361:266-268 (1993) describes certain mutations resulting in selective binding of TNF-α to only one of the two known types of TNF receptors. Thus, the AIM II receptor of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.

As indicated, changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 1).

Figure imgf000023_0001
Amino acids in the AIM II protein of the present invention that are essential for function can be identified by methods known in the art, such as site- directed mutagenesis or alanine-scanning mutagenesis (Cunmngham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro, or in vitro proliferative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol Biol 224:899-904 (1992) and de Vos et al. Science 255:306-312 (1992)).

The polypeptides of the present invention are preferably provided in an isolated form. By "isolated polypeptide" is intended a poypeptide removed from its native environment. Thus, a polypeptide produced and contained within a recombinant host cell is considered "isolated" for purposes of the present invention. Also intended as an "isolated polypeptide" are polypeptides that have been purified, partially or substantially, from a recombinant host. For example, a recombinantly produced version of the AIM II polypeptide can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).

The polypeptides of the present invention include the polypeptide encoded by the deposited cDNA, the polypeptide of Figures 1A-C (SEQ ID NO:2), the polypeptide of Figures 1 A-C (SEQ ID NO:2) lacking the N-terminal methinone, the extracellular domain, the transmembrane domain, the intracellular domain, soluble polypeptides comprising all or part of the extracellular and intracelluar domains but lacking the transmembrane domain, as well as polypeptides which are at least 80% identical, more preferably at least 90% or 95% identical, still more preferably at least 96%, 97%, 98% or 99% identical to the polypeptide encoded by the deposited cDNA, to the polypeptide of Figures 1A-C (SEQ ID NO:2), and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids. By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of an AIM II polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the AIM II polypeptide. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.

As a practical matter, whether any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence shown in Figures 1A-C (SEQ ID NO:2) or to the amino acid sequence encoded by deposited cDNA clone can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis

Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 5371 1. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.

As used herein the term "AIM II" polypeptide includes membrane-bound proteins (comprising a cytoplasmic domain, a transmembrane domain, and an extracellular domain) as well as truncated proteins that retain the AIM II polypeptide activity. In one embodiment, soluble AIM II polypeptides comprise all or part of the extracellular domain of an AIM II protein, but lack the transmsmbrane region that would cause retention of the polypeptide on a cell membrane. Soluble AIM II may also include part of the transmembrane region or part of the cytoplasmic domain or other sequences, provided that the soluble AIM II protein is capable of being secreted. A heterologous signal peptide can be fused to the N-terminus of the soluble AIM II polypeptide such that the soluble AIM II polypeptide is secreted upon expression.

The polypeptide of the present invention could be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.

In another aspect, the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide of the invention. The epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide described herein. An "immunogenic epitope" is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen. On the other hand, a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope." The number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al., Proc. Natl. Acad. Sei. USA 81:3998- 4002 (1983).

As to the selection of peptides or polypeptides bearing an antigenic epitope (i.e., that contain a region of a protein molecule to which an antibody can bind), it is well known in that art that relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R.A. (1983) Antibodies that react with predetermined sites on proteins. Science 219:660-666. Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals.

Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. See, for instance, Wilson et al. Cell 37: 767-778 (1984) at 777.

Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine and most preferably between about at least about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.

Non-limiting examples of antigenic polypeptides or peptides that can be used to generate AIM Il-specific antibodies include: a polypeptide comprising amino acid residues from about 13 to about 20 in Figures 1 A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 23 to about 36 in

Figures 1A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 69 to about 79 in Figures 1A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 85 to about 94 in Figures 1 A-C (SEQ ID NO:2);a polypeptide comprising amino acid residues from about 167 to about 178 in Figures 1A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 184 to about 196 in Figures 1A-C (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 221 to about 233 in Figures 1A-C (SEQ ID NO:2). As indicated above, the inventors have determined that the above polypeptide fragments are antigenic regions of the AIM II protein.

The epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means. Houghten, R. A. (1985) General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids. Proc. Natl. Acad. Sci. USA 82:5131-5135. This "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,21 1 to Houghten et al. (1986).

The AIM II polypeptide of the present invention may be employed to treat lymphoproliferative disease which results in lymphadenopathy, the AIM II mediates apoptosis by stimulating clonal deletion of T-cells and may therefore, be employed to treat autoimmune disease, to stimulate peripheral tolerance and cytotoxic T-cell mediated apoptosis. The AIM II may also be employed as a research tool in elucidating the biology of autoimmune disorders including systemic lupus erythematosus (SLE), immunoproliferative disease lymphadenopathy (IPL), angioimmunoproliferative lymphadenopathy (AIL), immunoblastive lymphadenopathy (IBL), rheumatoid arthritis, diabetes, and multiple sclerosis, allergies and to treat graft versus host disease.

The AIM II polypeptide of the present invention may also be employed to inhibit neoplasia, such as tumor cell growth. The AIM II polypeptide may be responsible for tumor destruction through apoptosis and cytotoxicity to certain cells. AIM II may also be employed to treat diseases which require growth promotion activity, for example, restenosis, since AIM II has proliferation effects on cells of endothelial origin. AIM II may, therefore, also be employed to regulate hematopoiesis in endothelial cell development.

This invention also provides a method for identification of molecules, such as receptor molecules, that bind AIM II. Genes encoding proteins that bind AIM II, such as receptor proteins, can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Such methods are described in many laboratory manuals such as, for instance, Coligan et al, Current Protocols in Immunology, 1 (2): Chapter 5 (1991).

For instance, expression cloning may be employed for this purpose. To this end polyadenyiated RNA is prepared from a cell responsive to AIM II, a cDNA library is created from this RNA, the library is divided into pools and the pools are transfected individually into cells that are not responsive to AIM II. The transfected cells then are exposed to labeled AIM II. (AIM II can be labeled by a variety of well-known techniques including standard methods of radio-iodination or inclusion of a recognition site for a site-specific protein kinase.) Following exposure, the cells are fixed and binding of AIM II is determined. These procedures conveniently are carried out on glass slides.

Pools are identified of cDNA that produced AIM II-binding cells.

Sub-pools are prepared from these positives, transfected into host cells and screened as described above. Using an iterative sub-pooling and re-screening process, one or more single clones that encode the putative binding molecule, such as a receptor molecule, can be isolated.

Alternatively a labeled ligand can be photo affinity linked to a cell extract, such as a membrane or a membrane extract, prepared from cells that express a molecule that it binds, such as a receptor molecule. Cross-linked material is resolved by polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray film. The labeled complex containing the ligand-receptor can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing can be used to design unique or degenerate oligonucleotide probes to screen cDNA libraries to identify genes encoding the putative receptor molecule.

Polypeptides of the invention also can be used to assess AIM II binding capacity of AIM II binding molecules, such as receptor molecules, in cells or in cell-free preparations.

As one of skill in the art will appreciate, AIM II polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides. These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al., Nature 331:84- 86 (1988)). Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric AIM II protein or protein fragment alone (Fountoulakis et al., J Biochem 270:3958-3964 (1995)).

The present inventors have discovered that AIM II is expressed in spleen, thymus and bone marrow tissue. For a number of disorders, such as septic shock, inflammation, cerebral malaria, activation of the HIV virus, graft-host rejection, bone resorption, rheumatoid arthritis and cachexia, it is believed that significantly higher or lower levels of AIM II gene expression can be detected in certain tissues (e.g., spleen, thymus and bone marrow tissue) or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" AIM II gene expression level, i.e., the AIM II expression level in tissue or bodily fluids from an individual not having the disorder. Thus, the invention provides a diagnostic method useful during diagnosis of a disorder, which involves: (a) assaying AIM II gene expression level in cells or body fluid of an individual; (b) comparing the

AIM II gene expression level with a standard AIM II gene expression level, whereby an increase or decrease in the assayed AIM II gene expression level compared to the standard expression level is indicative of a disorder.

AIM II Agonists and Antagonists The invention also provides a method of screening compounds to identify those which enhance or block the action of AIM II on cells, such as its interaction with AIM II-binding molecules such as receptor molecules. An agonist is a compound which increases the natural biological functions of AIM II or which functions in a manner similar to AIM II. while antagonists decrease or eliminate such functions.

For example, a cellular compartment, such as a membrane preparation, may be prepared from a cell that expresses a molecule that binds AIM II, such as a molecule of a signaling or regulatory pathway modulated by AIM II. The preparation is incubated with labeled AIM II in the absence or the presence of a candidate molecule which may be an AIM II agonist or antagonist. The ability of the candidate molecule to bind the binding molecule or AIM II itself is reflected in decreased binding of the labeled ligand. Molecules which bind gratuitously, /. e. , without inducing the effects of AIM II when bound to the AIM

II binding molecule, are most likely to be good antagonists. Molecules that bind well and elicit effects that are the same as or closely related to AIM II, are good agonists.

AIM II-like effects of potential agonists and antagonists may by measured, for instance, by determining activity of a second messenger system following interaction of the candidate molecule with a cell or appropriate cell preparation, and comparing the effect with that of AIM II or molecules that elicit the same effects as AIM II. Second messenger systems that may be useful in this regard include but are not limited to AMP guanylate cyclase, ion channel or phosphoinositide hydrolysis second messenger systems.

Another example of an assay for AIM II antagonists is a competitive assay that combines AIM II and a potential antagonist with membrane-bound AIM II receptor molecules or recombinant AIM II receptor molecules under appropriate conditions for a competitive inhibition assay. AIM II can be labeled, such as by radioactivity, such that the number of AIM II molecules bound to a receptor molecule can be determined accurately to assess the effectiveness of the potential antagonist.

Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention, and thereby inhibit or extinguish its activity. Potential antagonists also may be small organic molecules, a peptide, a polypeptide such as a closely related protein or antibody that binds the same sites on a binding molecule, such as a receptor molecule, without inducing AIM II-induced activities, thereby preventing the action of AIM II by excluding AIM II from binding. Other potential antagonists include antisense molecules. Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).

Triple helix formation is discussed in, for instance, Lee et al., Nucleic Acids Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al, Science 251:1360 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA. For example, the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of AIM II. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into AIM II polypeptide. The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of AIM II.

The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.

The antagonists may be employed for instance to treat cachexia which is a lipid clearing defect resulting from a systemic deficiency of lipoprotein lipase, which is believed to be suppressed by AIM II. The AIM II antagonists may also be employed to treat cerebral malaria in which AIM II may play a pathogenic role. The antagonists may also be employed to treat rheumatoid arthritis by inhibiting AIM-II induced production of inflammatory cytokines, such as IL1 in the synovial cells. When treating arthritis, AIM II antagonists are preferably injected intra-articularly. The AIM II antagonists may also be employed to prevent graft-host rejection by preventing the stimulation of the immune system in the presence of a graft.

The AIM II antagonists may also be employed to inhibit bone resorption and, therefore, to treat and/or prevent osteoporosis.

The antagonists may also be employed as anti-inflammatory agents, and to treat endotoxic shock. This critical condition results from an exaggerated response to bacterial and other types of infection.

Cancer Prognosis

It is believed that certain tissues in mammals with cancer express significantly reduced levels of the AIM II protein and mRNA encoding the AIM II protein when compared to a corresponding "standard" mammal, i.e., a mammal of the same species not having the cancer. Further, it is believed that reduced levels of the AIM II protein can be detected in certain body fluids (e.g., sera, plasma, urine, and spinal fluid) from mammals with cancer when compared to sera from mammals of the same species not having the cancer. Thus, the invention provides a diagnostic method useful during tumor diagnosis, which involves assaying the expression level of the gene encoding the AIM II protein in mammalian cells or body fluid and comparing the gene expression level with a standard AIM II gene expression level, whereby an decrease in the gene expression level over the standard is indicative of certain tumors.

Where a tumor diagnosis has already been made according to conventional methods, the present invention is useful as a prognostic indicator, whereby patients exhibiting enhanced AIM II gene expression may experience a better clinical outcome relative to patients expressing the gene at a lower level.

By "assaying the expression level of the gene encoding the AIM II protein" is intended qualitatively or quantitatively measuring or estimating the level of the AIM II protein or the level of the mRNA encoding the AIM II protein in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the AIM II protein level or mRNA level in a second biological sample).

Preferably, the AIM II protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard AIM II protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the cancer. As will be appreciated in the art, once a standard AIM II protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.

By "biological sample" is intended any biological sample obtained from an individual, cell line, tissue culture, or other source which contains AIM II protein or mRNA. Biological samples include mammalian body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain secreted mature AIM II protein, and ovarian, prostate, heart, placenta, pancreas liver, spleen, lung, breast and umbilical tissue.

The present invention is useful for detecting cancer in mammals. In particular the invention is useful during diagnosis of the of following types of cancers in mammals: breast, ovarian, prostate, bone, liver, lung, pancreatic, and spleenic. Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are humans.

Total cellular RNA can be isolated from a biological sample using the single-step guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels of mRNA encoding the AIM II protein are then assayed using any appropriate method. These include Northern blot analysis (Harada et al., Cell 63:303-312 (1990)), S1 nuclease mapping (Fujita et al., Cell 49:351-361 (1987)) , the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR) (Makino et al., Technique 2:295-301 (1990)) , and reverse transcription in combination with the ligase chain reaction (RT-LCR). Assaying AIM II protein levels in a biological sample can occur using antibody-based techniques. For example, AIM II protein expression in tissues can be studied with classical immunohistological methods (Jalkanen, M., et al.,

J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J. Cell . Biol 105:3087-3096 (1987)).

Other antibody-based methods useful for detecting AIM II protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).

Suitable lables are known in the art and include enzyme lables, such as, Glucose oxidase, and radioisotopes, such as iodine (125I, 121I), carbon (14C), sulpher (35S), tritium (3H), indium (112In), and technetium (99mTc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.

Therapeutics The AIM II polypeptides, particularly human AIM-II polypeptides, may be employed to treat neoplasia, lymphadenopathy, autoimmune disease, graft versus host disease. In addition, the AIM II polypeptide of the present invention may be employed to inhibit neoplasia, such as tumor cell growth. The AIM II polypeptide may be responsible for tumor destruction through apoptosis and cytotoxicity to certain cells. AIM II may also be employed to treat diseases which require growth promotion activity, for example, restenosis, since AIM II has proliferation effects on cells of endothelial origin. AIM II may, therefore, also be employed to regulate hematopoiesis in endothelial cell development.

Modes of administration

It will be appreciated that conditions, such as those discussed above, can be treated by administration of AIM II protein. Thus, the invention further provides a method of treating an individual in need of an increased level of AIM II activity comprising administering to such an individual a pharmaceutical composition comprising an effective amount of an isolated AIM II polypeptide of the invention, particularly a mature form of the AIM II, effective to increase the AIM II activity level in such an individual.

As a general proposition, the total pharmaceutically effective amount of AIM II polypeptide administered parenterally per dose will be in the range of about 1 μg/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone. If given continuously, the AIM II polypeptide is typically administered at a dose rate of about 1 μg/kg/hour to about 50 μg/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed.

Pharmaceutical compositions containing the AIM II of the invention may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray. By "pharmaceutically acceptable carrier" is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The term "parenteral" as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.

In addition to soluble AIM II polypeptides, AIM II polypeptides containing the transmembrane region can also be used when appropriately solubilized by including detergents, such as triton X-100, with buffer.

Chromosome Assays

The nucleic acid molecules of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.

In certain preferred embodiments in this regard, the cDNA herein disclosed is used to clone genomic DNA of an AIM II protein gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA then is used for in situ chromosome mapping using well known techniques for this purpose.

In addition, in some cases, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes.

Fluorescence in situ hybridization ("FISH") of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with probes from the cDNA as short as 50 or 60 bp. For a review of this technique, see Verma et al., Human Chromosomes: A Manual Of Basic Techniques, Pergamon Press, New York


Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance In Man, available on-line through Johns Hopkins University, Welch

Medical Library. The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

Having generally described the invention, the same will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended as limiting.


Example 1: Expression and Purification of AIM II in E. coli

A Expression of AIM II with an N-terminal HA tag

The DNA sequence encoding the AIM II protein in the deposited cDNA clone is amplified using PCR oligonucleotide primers specific to the amino terminal sequences of the AIM II protein and to vector sequences 3' to the gene.

Additional nucleotides containing restriction sites to facilitate cloning are added to the 5' and 3' sequences respectively.

A 22 kDa AIM II protein fragment (lacking the N-terminus and transmembrane region) is expressed using the following primers:

The 5' oligonucleotide primer has the sequence 5' GCGGGATCCGGAGAGATGGTCACC 3' (SEQ ID NO:7) containing the underlined BamHl restriction site, which encodes 244-258 nucleotides of the AIM II protein coding sequence in Figures 1A-C (SEQ ID NO:l).

The 3 ' primer has the sequence 5 '

CGCAAGCTTCCTTCACACCATGAAAGC 3' (SEQ ID NO:8) containing the underlined Hind III restriction site followed by 756-783 nucleotides as shown in Figures 1A-C.

The entire AIM II protein can be expressed using the following primers: The 5' oligonucleotide primer has the sequence 5 ' GACC GGATCC ATG

GAG GAG AGT GTC GTA CGG C 3' (SEQ ID NO:9) containing the underlined

Bam HI restriction site, which encodes 22 nucleotides of the AIM II protein coding sequence in Figures 1A-C (SEQ ID NO: 1). The 3' primer has the sequence 5' CGC AAGCTT CCT TCA CAC CAT GAA AGC 3' (SEQ ID NO: 10) containing the underlined Hindlll restriction site followed followed by 756-783 nucleotides as shown in Figures 1 A-C.

The restriction sites are convenient to restriction enzyme sites in the bacterial expression vector pQE9, which are used for bacterial expression in these examples. (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 9131 1). pQE9 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site ("RBS"). a 6-His tag and restriction enzyme sites.

The amplified AIM II DNA and the vector pQE9 both are digested with

BamHI and Hind III and the digested DNAs are then ligated together. Insertion of the AIM II protein DNA into the restricted pQE9 vector places the AIM II protein coding region downstream of and operably linked to the vector's IPTG- inducible promoter and in-frame with an initiating AUG appropriately positioned for translation of AIM II protein.

B. Expression of AIM II with a C-terminal HA tag

The bacterial expression vector pQE60 is used for bacterial expression in this example. (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 9131 1). pQE60 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site

("RBS"), six codons encoding histidine residues that allow affinity purification using nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity resin sold by QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites. These elements are arranged such that an inserted DNA fragment encoding a polypeptide expresses that polypeptide with the six His residues (i.e., a "6 X His tag") covalently linked to the carboxyl terminus of that polypeptide.

The DNA sequence encoding the desired portion of the AIM II protein is amplified from the deposited cDNA clone using PCR oligonucleotide primers which anneal to the amino terminal sequences of the desired portion of the AIM II protein and to sequences in the deposited construct 3' to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector are added to the 5' and 3' sequences, respectively.

For cloning the protein, the 5' primer has the sequence 5' GACGC CCATGG AG GAG GAG AGT GTC GTA CGG C 3' (SEQ ID NO: 17) containing the underlined Ncol restriction site followed by nucleotides complementary to the amino terminal coding sequence of the AIM II sequence in Figures 1A-C. One of ordinary skill in the art would appreciate, of course, that the point in the protein coding sequence where the 5' primer begins may be varied to amplify a DNA segment encoding any desired portion of the complete protein (shorter or longer). The 3' primer has the sequence 5' GACC GGATCC CAC

CAT GAA AGC CCC GAA GTA AG 3' (SEQ ID NO: 18) containing the underlined BamHI restriction site followed by nucleotides complementary to the 3' end of the coding sequence immediately before the stop codon in the AIM II DNA sequence in Figures 1A-C, with the coding sequence aligned with the restriction site so as to maintain its reading frame with that of the six His codons in the pQE60 vector.

The amplified AIM II DNA fragment and the vector pQE60 are digested with BamHI and Nco I and the digested DNAs are then ligated together. Insertion of the AIM II DNA into the restricted pQE60 vector places the AIM II protein coding region downstream from the IPTG-inducible promoter and in- frame with an initiating AUG and the six histidine codons.

The ligation mixture from the HA tagged expression constructs made in A or B, above, is transformed into competent E. coli cells using standard procedures. Such procedures are described in Sambrook et al, Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press,

Cold Spring Harbor, N.Y. (1989). E. coli strain M15/rep4, containing multiple copies of the plasmid pREP4, which expresses lac repressor and confers kanamycin resistance ("Kanr"), is used in carrying out the illustrative example described herein. This strain, which is only one of many that are suitable for expressing AIM II protein, is available commercially from Qiagen. Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis.

Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 μg/ml) and kanamycin (25 μg/ml).

The O/N culture is used to inoculate a large culture, at a dilution of approximately 1:100 to 1:250. The cells are grown to an optical density at 600nm

("OD600") of between 0.4 and 0.6. Isopropyl-B-D-thiogalactopyranoside ("IPTG") is then added to a final concentration of 1 mM to induce transcription from lac repressor sensitive promoters, by inactivating the lacl repressor. Cells subsequently are incubated further for 3 to 4 hours. Cells then are harvested by centrifugation and disrupted, by standard methods. Inclusion bodies are purified from the disrupted cells using routine collection techniques, and protein is solubilized from the inclusion bodies into 8M urea. The 8M urea solution containing the solubilized protein is passed over a PD-10 column in 2X phosphate-buffered saline ("PBS"), thereby removing the urea, exchanging the buffer and refolding the protein. The protein is purified by a further step of chromatography to remove endotoxin. Then, it is sterile filtered. The sterile filtered protein preparation is stored in 2X PBS at a concentration of 95 μ/ml.

C. Expression and Purification of AIM II without an HA tag

The bacterial expression vector pQE60 is used for bacterial expression in this example. (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 9131 1). pQE60 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"). an IPTG inducible promoter, a ribosome binding site

("RBS"), six codons encoding histidine residues that allow affinity purification using nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity resin sold by QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites. These elements are arranged such that a DNA fragment encoding a polypeptide may be inserted in such as way as to produce that polypeptide with the six His residues (i.e., a "6 X His tag") covalently linked to the carboxyl terminus of that polypeptide. However, in this example, the polypeptide coding sequence is inserted such that translation of the six His codons is prevented and, therefore, the polypeptide is produced with no 6 X His tag.

The DNA sequence encoding the desired portion of the AIM II protein lacking the hydrophobic leader sequence is amplified from the deposited cDNA clone using PCR oligonucleotide primers which anneal to the amino terminal sequences of the desired portion of the AIM II protein and to sequences in the deposited construct 31 to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector are added to the 5' and 3' sequences, respectively.

For cloning the protein, the 5' primer has the sequence 5'GACGC CCATGG AG GAG GAG AGT GTC GTA CGG C 3' (SEQ ID NO: 17) containing the underlined Ncol restriction site followed by nucleotides complementary to the amino terminal coding sequence of the AIM II sequence in Figures 1A-C. One of ordinary skill in the art would appreciate, of course, that the point in the protein coding sequence where the 5' primer begins may be varied to amplify a desired portion of the complete protein (i.e., shorter or longer). The 3' primer has the sequence 5' CGC AAGCTT CCTT CAC ACC ATG AAA GC

3' (SEQ ID NO: 19) containing the underlined Hind III restriction site followed by nucleotides complementary to the 3' end of the non-coding sequence in the AIM II DNA sequence in Figures 1A-C.

The amplified AIM II DNA fragments and the vector pQE60 are digested with Ncol and Hind III and the digested DNAs are then ligated together.

Insertion of the AIM II DNA into the restricted pQE60 vector places the AIM II protein coding region including its associated stop codon downstream from the IPTG-inducible promoter and in-frame with an initiating AUG. The associated stop codon prevents translation of the six histidine codons downstream of the insertion point. The ligation mixture is transformed into competent E. coli cells using standard procedures such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd Ed; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989). E. coli strain M15/rep4, containing multiple copies of the plasmid pREP4, which expresses the lac repressor and confers kanamycin resistance ("Kanr"), is used in carrying out the illustrative example described herein. This strain, which is only one of many that are suitable for expressing AIM II protein, is available commercially from QIAGEN, Inc., supra. Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.

Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 μg/ml) and kanamycin (25 μg/ml). The O/N culture is used to inoculate a large culture, at a dilution of approximately 1:25 to 1 :250. The cells are grown to an optical density at 600 nm ("OD600") of between 0.4 and 0.6. Isopropyl-b-D- thiogalactopyranoside ("IPTG") is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor. Cells subsequently are incubated further for 3 to 4 hours.

Cells then are harvested by centrifugation.

The cells are then stirred for 3-4 hours at 4°C in 6M guanidine-HCl, pH8. The cell debris is removed by centrifugation, and the supernatant containing the AIM II is dialyzed against 50 mM Na-acetate buffer pH6, supplemented with 200 mM NaCl. Alternatively, the protein can be successfully refolded by dialyzing it against 500 mM NaCl, 20% glycerol, 25 mM Tris/HCl pH7.4. containing protease inhibitors. After renaturation the protein can be purified by ion exchange, hydrophobic interaction and size exclusion chromatography. Alternatively, an affinity chromatography step such as an antibody column can be used to obtain pure AIM II protein. The purified protein is stored at 4°C or frozen at -80°C.

Example 2: Cloning and Expression of AIM II protein in a Baculovirus Expression System

The cDNA sequence encoding the full length AIM II protein in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:

The 5' primer has the sequence 5'GCT CCA GGA TCC GCC ATC ATG GAG GAG AGT GTC GTA CGG C3' (SEQ ID NO: 1 1) containing the underlined Bam HI restriction enzyme site followed by 22 bases of the sequence of AIM II protein in Figures 1A-C. Inserted into an expression vector, as described below, the 5' end of the amplified fragment encoding AIM II provides an efficient signal peptide. An efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol Biol. 196:941-950 (1987) is appropriately located in the vector portion of the construct.

The 3' primer has the sequence 5'GA CGC GGT ACC GTC CAA TGC ACC ACG CTC CTT CCT TC 3' (SEQ ID NO: 12) containing the underlined Asp 718 restriction site followed by nucleotides complementary to 769-795 nucleotides of the AIM II set out in Figures 1 A-C.

The amplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment then is digested with Bam HI and Asp 718 and again is purified on a 1 % agarose gel. This fragment is designated herein F2.

The vector pA2-GP is used to express the AIM II protein in the baculovirus expression system, using standard methods, as described in Summers et al , A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites. The signal peptide of AcMNPV gp67, including the N-terminal methionine, is located just upstream of a BamHI site. The polyadenylation site of the simian virus 40 ("SV40") is used for efficient polyadenylation. For an easy selection of recombinant virus the beta- galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter and is followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that express the cloned polynucleotide.

Many other baculovirus vectors could be used in place of pA2-GP, such as pAc373, pVL941 and pAcIMl provided, as those of skill readily will appreciate, that construction provides appropriately located signals for transcription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required. Such vectors are described in Luckow et al.,

Virology 170: 31 -39, among others.

The plasmid is digested with the restriction enzyme Bam HI and Asp 718 and then is dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art. The DNA is then isolated from a 1 % agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.).

This vector DNA is designated herein "V".

Fragment F2 and the dephosphorylated plasmid V2 are ligated together with T4 DNA ligase. E. coli HB101 cells are transformed with ligation mix and spread on culture plates. Bacteria are identified that contain the plasmid with the human AIM II gene by digesting DNA from individual colonies using Xbal and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein pBac AIM II .

5 μg of the plasmid pBac AIM II is co-transfected with 1.0 μg of a commercially available linearized baculovirus DNA ("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofection method described by Feigner et al. Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987). lμg of BaculoGold™ virus DNA and 5 μg of the plasmid pBac AIM II are mixed in a sterile well of a microtiter plate containing 50 μl of serum-free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 μl Lipofectin plus 90 μl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to Sf9 insect cells (ATCC CRL 171 1) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated for 5 hours at 27°C. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added. The plate is put back into an incubator and cultivation is continued at 27°C for four days.

After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, cited above. An agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal -expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay" of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10).

Four days after serial dilution, the virus is added to the cells. After appropriate incubation, blue stained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supematants of these culture dishes are harvested and then they are stored at 4°C. A clone containing properly inserted hESSB I, II and III is identified by DNA analysis including restriction mapping and sequencing. This is designated herein as V-AIM II . Sf9 cells are grown in Grace's medium supplemented with 10% heat- inactivated FBS. The cells are infected with the recombinant baculovirus V- AIM II at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3). Six hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Gaithersburg).

42 hours later, 5 μCi of 35S-methionine and 5 μCi 35S-cysteine (available from Amersham) are added. The cells are further incubated for 16 hours and then they are harvested by centrifugation, lysed and the labeled proteins are visualized by SDS-PAGE and autoradiography. Example 3: Cloning and Expression in Mammalian Cells

Most of the vectors used for the transient expression of the AIM II protein gene sequence in mammalian cells should carry the SV40 origin of replication. This allows the replication of the vector to high copy numbers in cells (e.g., COS cells) which express the T antigen required for the initiation of viral DNA synthesis. Any other mammalian cell line can also be utilized for this purpose.

A typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of trancription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for

RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV). However, cellular signals can also be used (e.g., human actin promoter). Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala. Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109). Mammalian host cells that could be used include, human Hela, 283, H9 and Jurkart cells, mouse NlH3T3 and C127 cells, Cos 1, Cos 7 and CV1, African green monkey cells, quail QCl-3 cells, mouse L cells and Chinese hamster ovary cells.

Alternatively, the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome. The co-transfection with a selectable marker such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.

The transfected gene can also be amplified to express large amounts of the encoded protein. The DHFR (dihydrofolate reductase) is a useful marker to develop cell lines that carry several hundred or even several thousand copies of the gene of interest. Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al., Bio/Technology 10:169-175 (1992)). Using these markers, the mammalian cells are grown in selective medium and the cells with the highest resistance are selected. These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) cells are often used for the production of proteins.

The expression vectors pC1 and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the CMV-enhancer (Boshart et al.,

Cell 41:521 -530 (1985)). Multiple cloning sites, e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of the gene of interest. The vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene. Example 3(a): Cloning and Expression in COS Cells

The expression plasmid, pAIM II HA, is made by cloning a cDNA encoding AIM II into the expression vector pcDNAI/Amp (which can be obtained from Invitrogen, Inc.). The expression vector pcDNAI/amp contains: (1) an E.coli origin of replication effective for propagation in E. coli and other prokaryotic cells; (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.

A DNA fragment encoding the AIM II protein and an HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al., Cell 37: 767 (1984). The fusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy is as follows. The AIM II cDNA of the deposited clone is amplified using primers that contain convenient restriction sites, much as described above regarding the construction of expression vectors for expression of AIM II in E. coli. To facilitate detection, purification and characterization of the expressed AIM II, one of the primers contains a hemagglutinin tag ("HA tag") as described above.

Suitable primers include the following, which are used in this example. The 5' primer, containing the underlined BamHI site, and an AUG start codon has the following sequence:


NO: 13).

The 3' primer, containing the underlined Xba I site, a stop codon, 9 codons thereafter forming the hemagglutinin HA tag, and 31 bp of 3 ' coding sequence (at the 3' end) has the following sequence: 5'GATGTTCTAGAAAGC GTAGTC TGG GAC GTC GTA TGG GTA CAC CAT GAA AGC CCC GAA GTA AGA CCG GGT AC 3' (SEQ ID NO:14).

The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with Hindlll and Xhol and then ligated. The ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 1 1099 North Torrey Pines Road, La Jolla, CA 92037), and the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of the AIM II -encoding fragment.

For expression of recombinant AIM II, COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, New York (1989). Cells are incubated under conditions for expression of AIM II by the vector.

Expression of the AIM II HA fusion protein is detected by radiolabelling and immunoprecipitation. using methods described in, for example Harlow et al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988). To this end, two days after transfection, the cells are labeled by incubation in media containing 35S-cysteine for 8 hours. The cells and the media are collected, and the cells are washed and the lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1%NP-40, 0.5% DOC, 50 mM TR1S, pH 7.5, as described by Wilson et al. cited above. Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE gels and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls. Example 3(b): Cloning and Expression in CHO Cells

The vector pC4 is used for the expression of AIM II protein. Plasmid pC 1 is a derivative of the plasmid pSV2-dhfr [ATCC Accession No. 37146]. Both plasmids contain the mouse DHFR gene under control of the SV40 early promoter. Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life. Technologies) supplemented with the chemotherapeutic agent methotrexate. The amplification of the DHFR genes in cells resistant to methotrexate (MTX) has been well documented (see, e.g., Alt, F.W., Kellems, R.M., Bertino, J.R., and Schimke, R.T., 1978, J. Biol. Chem.

253: 1357-1370, Hamlin, J.L. and Ma, C. 1990, Biochem. et Biophys. Acta, 1097:107-143, Page, M.J. and Sydenham, M.A. 1991, Biotechnology Vol. 9:64- 68). Cells grown in increasing concentrations of MTX develop resistance to the drug by overproducing the target enzyme, DHFR, as a result of amplification of the DHFR gene. If a second gene is linked to the DHFR gene it is usually co- amplified and over-expressed. It is state of the art to develop cell lines carrying more than 1,000 copies of the genes. Subsequently, when the methotrexate is withdrawn, cell lines contain the amplified gene integrated into the chromosome(s).

Plasmid pC4 contains for expressing the gene of interest the strong promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus (Cullen, et al. Molecular and Cellular Biology, March 1985:438-447) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell 47:521-530 (1985)). Downstream of the promoter are Bam HI, Xbal, and Asp718 restriction enzyme cleavage sites that allow integration of the genes. Behind these cloning sites the plasmid contains the 3' intron and polyadenylation site of the rat preproinsulin gene. Other high efficiency promoters can also be used for the expression, e.g., the human β-actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HIV and HTLVI. Clontech's Tet-Off and Tet-On gene expression systems and similar systems can be used to express the AIM II in a regulated way in mammalian cells (Gossen, M., & Bujard, H. 1992, Proc. Natl. Acad. Sci. USA 89: 5547-5551). For the polyadenylation of the mRNA other signals, e.g., from the human growth hormone or globin genes can be used as well. Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g., G418 plus methotrexate.

The plasmid pC4 is digested with the restriction enzymes Bam HI and

Asp 718 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The vector is then isolated from a 1% agarose gel.

The DNA sequence encoding the complete AIM II protein including its leader sequence is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene. The 5' primer has the sequence 5'GCT

CCA GGA TCC GCC ATC ATG GAG GAG AGT GTC GTA CGG C3 ' (SEQ ID NO:l 5) containing the underlined Bam HI restriction enzyme site followed by an efficient signal for initiation of translation in eukaryotes, as described by Kozak, M., J. Mol Biol. 796:947-950 (1987), and 22 bases of the coding sequence of AIM II shown in Figures 1 A-C (SEQ ID NO: 1). The 3' primer has the sequence 5'GA CGC GGT ACC GTC CAA TGC ACC ACG CTC CTT CCT TC 3' (SEQ ID NO: 16) containing the underlined Asp 718 restriction site followed by nucleotides complementary to nucleotides 769-795 of the AIM II gene shown in Figures 1 A-C (SEQ ID NO:1).

The amplified fragment is digested with the endonucleases BamHI and

Asp718 and then purified again on a 1% agarose gel. The isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase. E. coli HB101 or XL-1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC4 using, for instance, restriction enzyme analysis. Chinese hamster ovary cells lacking an active DHFR gene are used for transfection. 5 μg of the expression plasmid pC4 is cotransfected with 0.5 μg of the plasmid pSV2-neo using lipofectin (Feigner et al., supra). The plasmid pS V2neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418. The cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of metothrexate plus 1 mg/ml G418. After about 10-14 days single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (1 μM, 2 μM, 5 μM, 10 mM, 20 mM). The same procedure is repeated until clones are obtained which grow at a concentration of 100 - 200 μM. Expression of the desired gene product is analyzed, for instance, by SDS-PAGE and Western blot or by reverse phase HPLC analysis.

Example 4: Tissue distribution of AIM II protein expression

Northern blot analysis is carried out to examine AIM II gene expression in human tissues, using methods described by, among others, Sambrook et al., cited above. A cDNA probe containing the entire nucleotide sequence of the AIM II protein (SEQ ID NO: 1) is labeled with 32P using the rediprime™ DNA labeling system (Amersham Life Science), according to manufacturer's instructions. After labelling, the probe is purified using a CHROMA SPIN- 100™ column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT1200-1. The purified labelled probe is then used to examine various human tissues for AIM II mRNA. Multiple Tissue Northern (MTN) blots containing various human tissues (H) or human immune system tissues (IM) are obtained from Clontech and are examined with labelled probe using ExpressHyb™ hybridization solution (Clontech) according to manufacturer's protocol number PTl 190-1. Following hybridization and washing, the blots are mounted and exposed to film at -70°C overnight, and films developed according to standard procedures.

It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples.

Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.

The entire disclosure of all publications (including patents, patent applications, journal articles, laboratory manuals, books, or other documents) cited herein are hereby incorporated by reference.

Figure imgf000055_0001
Figure imgf000056_0001

Figure imgf000056_0002
Figure imgf000057_0001
Figure imgf000057_0002
Figure imgf000057_0003
Figure imgf000057_0004
Figure imgf000058_0001
Figure imgf000058_0002
Figure imgf000058_0003
Figure imgf000059_0001
Figure imgf000060_0001
Figure imgf000060_0002
Figure imgf000060_0003
Figure imgf000061_0001
Figure imgf000061_0002
Figure imgf000061_0003
Figure imgf000062_0001
Figure imgf000062_0002
Figure imgf000062_0003
Figure imgf000063_0001
Figure imgf000063_0002
Figure imgf000063_0003
Figure imgf000064_0001
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001

Figure imgf000068_0001


What Is Claimed Is:
1. An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from the group consisting of:
(a) a nucleotide sequence encoding the AIM II polypeptide having the complete amino acid sequence in Figures 1 A-C (SEQ ID NO:2);
(b) a nucleotide sequence encoding the AIM II polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97689;
(c) a nucleotide sequence encoding the AIM II polypeptide extracellular domain;
(d) a nucleotide sequence encoding the AIM II polypeptide transmembrane domain;
(e) a nucleotide sequence encoding the AIM II polypeptide intracellular domain;
(f) a nucleotide sequence encoding a soluble AIM II polypeptide having the extracellular and intracellular domains but lacking the transmembrane domain; and
(g) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f) above.
2. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence in Figures 1A-C (SEQ ID NO: 1).
3. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figures 1A-C (SEQ ID NO:l) encoding the AIM II polypeptide having the complete amino acid sequence in Figures 1A-C (SEQ
ID NO:2).
4. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence of the cDNA clone contained in ATCC Deposit No. 97689.
5. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the AIM II polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97689.
6. An isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide having a nucleotide sequence identical to a nucleotide sequence in (a), (b), (c),
(d), (e), (f) or (g) of claim 1 wherein said polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
7. An isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of an AIM
II polypeptide having an amino acid sequence in (a), (b), (c), (d), (e) or (f) of claim 1.
8. The isolated nucleic acid molecule of claim 7, which encodes an epitope-bearing portion of an AIM II polypeptide selected from the group consisting of: a polypeptide comprising amino acid residues from about 13 to about 20 in Figures 1 A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 23 to about 36 in Figures 1A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 69 to about 79 in Figures 1A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 85 to about 94 in Figures 1A-C (SEQ ID NO:2);a polypeptide comprising amino acid residues from about 167 to about 178 in Figures 1 A-C (SEQ ID NO:2);a polypeptide comprising amino acid residues from about 184 to about 196 in Figures 1 A-C (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 221 to about 233 in Figures 1A-C (SEQ ID NO:2).
9. A method for making a recombinant vector comprising inserting an isolated nucleic acid molecule of claim 1 into a vector.
10. A recombinant vector produced by the method of claim 9.
11. A method of making a recombinant host cell comprising introducing the recombinant vector of claim 10 into a host cell.
12. A recombinant host cell produced by the method of claim 11.
13. A recombinant method for producing an AIM II polypeptide, comprising culturing the recombinant host cell of claim 12 under conditions such that said polypeptide is expressed and recovering said polypeptide.
14. An isolated AIM II polypeptide having an amino acid sequence at least 95% identical to a sequence selected from the group consisting of:
(a) the amino acid sequence of the AIM II polypeptide having the complete amino acid sequence in Figures 1 A-C (SEQ ID NO:2);
(b) the amino acid sequence of the AIM II polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97689;
(c) the amino acid sequence of the extracellular domain of the AIM II polypeptide;
(d) the amino acid sequence of the transmembrane domain of the AIM II polypeptide; (e) the amino acid sequence of the intracellular domain of the AIM II polypeptide;
(f) the amino acid sequence of a soluble AIM II polypeptide having the all or part of the extracellular and intracellular domain but lacking the transmembrane domain wherein the extracellular domain; and
(g) the amino acid sequence of an epitope-bearing portion of any one of the polypeptides of (a), (b), (c), (d), (e) or (f).
15. An isolated polypeptide comprising an epitope-bearing portion of the AIM II protein, wherein said portion is selected from the group consisting of: a polypeptide comprising amino acid residues from about 13 to about 20 in
Figures 1A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 23 to about 36 in Figures 1A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 69 to about 79 in Figures 1 A-C (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 85 to about 94 in Figures 1A-C (SEQ ID NO:2);a polypeptide comprising amino acid residues from about 167 to about 178 in Figures 1A-C (SEQ ID NO:2);a polypeptide comprising amino acid residues from about 184 to about 196 in Figures 1 A-C (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 221 to about 233 in Figures 1 A-C (SEQ ID NO:2).
16. An isolated antibody that binds specifically to an AIM II polypeptide of claim 14.
17. A method for the treatment of conditions or diseases selected from the group consisting of lymphadenopathy, autoimmune disease and graft versus host disease comprising administering an effective amount of the polypeptide in (a), (b), (c), (d), (e) or (f) of claim 14 to a patient in need thereof.
18. A method for inhibiting neoplasia comprising administering an effective amount of the polypeptide in (a), (b), (c), (d), (e) or (f) of claim 14 to a patient in need thereof.
19. A method for preventing conditions or diseases selected from the group consisting of septic shock, inflammation, cerebral malaria, activation of the HIV virus, bone resorption, rheumatoid arthritis and cachexia comprising administering an effective amount of an antagonist of the polypeptide of claim 14 to a patient in need thereof.
PCT/US1996/016966 1996-03-22 1996-10-31 Apoptosis inducing molecule ii WO1997034911A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US1392396P true 1996-03-22 1996-03-22
US60/013,923 1996-03-22

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-1998-0707496A KR100497017B1 (en) 1996-03-22 1996-10-31 Apoptosis inducing molecules ii
EP96941944A EP0904278A4 (en) 1996-03-22 1996-10-31 Apoptosis inducing molecule ii
JP9533436A JP2000508522A (en) 1996-03-22 1996-10-31 Apoptosis-inducing molecule ii
AU11153/97A AU734384B2 (en) 1996-03-22 1996-10-31 Apoptosis inducing molecule II

Publications (1)

Publication Number Publication Date
WO1997034911A1 true WO1997034911A1 (en) 1997-09-25



Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/016966 WO1997034911A1 (en) 1996-03-22 1996-10-31 Apoptosis inducing molecule ii

Country Status (6)

Country Link
EP (1) EP0904278A4 (en)
JP (1) JP2000508522A (en)
KR (2) KR20030096450A (en)
CN (2) CN1107072C (en)
CA (1) CA2248868A1 (en)
WO (1) WO1997034911A1 (en)

Cited By (132)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999035262A2 (en) * 1998-01-07 1999-07-15 Human Genome Sciences, Inc. Apoptosis inducing molecule ii
WO1999042584A1 (en) * 1998-02-20 1999-08-26 Human Genome Sciences, Inc. Apoptosis inducing molecule ii and methods of use
EP1003782A1 (en) * 1997-07-07 2000-05-31 La Jolla Institute For Allergy And Immunology Ligand for herpes simplex virus entry mediator and methods of use
WO2000053223A1 (en) * 1999-03-11 2000-09-14 Human Genome Sciences, Inc. Apoptosis inducing molecule ii and methods of use
US6235878B1 (en) 1996-07-19 2001-05-22 Takeda Chemical Industries, Ltd. Fas ligand-like protein, its production and use
WO2001079496A2 (en) * 2000-03-13 2001-10-25 La Jolla Institute For Allergy And Immunology Ligand for herpes simplex virus entry mediator and methods of use
WO2002002641A1 (en) 2000-06-16 2002-01-10 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
US6346388B1 (en) 1997-08-13 2002-02-12 Smithkline Beecham Corporation Method of identifying agonist and antagonists for tumor necrosis related receptors TR1 and TR2
EP1179347A1 (en) * 1999-05-21 2002-02-13 Takeda Chemical Industries, Ltd. Liver function controlling agents
WO2002060919A2 (en) 2000-12-12 2002-08-08 Medimmune, Inc. Molecules with extended half-lives, compositions and uses thereof
WO2002066050A1 (en) * 2001-02-23 2002-08-29 Takeda Chemical Industries, Ltd. Casoase 3 inhibitors
WO2002066049A1 (en) * 2001-02-23 2002-08-29 Takeda Chemical Industries, Ltd. Agents for plasmic change
WO2002083704A1 (en) 2001-04-13 2002-10-24 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
WO2002097033A2 (en) 2001-05-25 2002-12-05 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to trail receptors
US6495520B2 (en) 1996-03-22 2002-12-17 Human Genome Sciences, Inc. Apoptosis Inducing Molecule II and methods of use
WO2003060071A2 (en) 2001-12-21 2003-07-24 Human Genome Sciences, Inc. Albumin fusion proteins
US6635743B1 (en) 1996-03-22 2003-10-21 Human Genome Sciences, Inc. Apoptosis inducing molecule II and methods of use
WO2003086458A1 (en) 2002-04-12 2003-10-23 Medimmune, Inc. Recombinant anti-interleukin-9 antibodies
US6713061B1 (en) 1996-03-12 2004-03-30 Human Genome Sciences, Inc. Death domain containing receptors
US6759513B2 (en) 1996-03-12 2004-07-06 Human Genome Sciences, Inc. Death domain containing receptors
WO2005042743A2 (en) 2003-08-18 2005-05-12 Medimmune, Inc. Humanization of antibodies
WO2005077042A2 (en) 2004-02-09 2005-08-25 Human Genome Sciences, Inc. Albumin fusion proteins
WO2005117967A2 (en) 2004-04-12 2005-12-15 Medimmune, Inc. Anti-il-9 antibody formulations and uses thereof
US6998108B1 (en) 1997-07-07 2006-02-14 La Jolla Institute For Allergy And Immunology Antibodies to p30 polypeptides and methods making and using same
WO2006102095A2 (en) 2005-03-18 2006-09-28 Medimmune, Inc. Framework-shuffling of antibodies
WO2007002543A2 (en) 2005-06-23 2007-01-04 Medimmune, Inc. Antibody formulations having optimized aggregation and fragmentation profiles
EP1674575A3 (en) * 2000-04-12 2007-08-08 La Jolla Institute For Allergy And Immunology Ligand for herpes simplex virus entry mediator and methods of use
WO2007147090A2 (en) 2006-06-14 2007-12-21 Macrogenics, Inc. Methods for the treatment of autoimmune disorders using monoclonal antibodies with reduced toxicity
WO2008019199A2 (en) 2006-06-26 2008-02-14 Macrogenics, Inc. FCγRIIB-SPECIFIC ANTIBODIES AND METHODS OF USE THEREOF
US7357927B2 (en) 1996-03-12 2008-04-15 Human Genome Sciences, Inc. Death domain containing receptors
WO2008073312A2 (en) 2006-12-08 2008-06-19 Attenuon, Llc Urokinase-type plasminogen activator receptor epitope, monoclonal antibodies derived therefrom and methods of use thereof
WO2008136694A1 (en) 2007-05-04 2008-11-13 Technophage, Investigação E Desenvolvimento Em Biotecnologia, Sa Engineered rabbit antibody variable domains and uses thereof
WO2008157379A2 (en) 2007-06-21 2008-12-24 Macrogenics, Inc. Covalent diabodies and uses thereof
EP2027874A2 (en) 2000-11-28 2009-02-25 Medimmune, Inc. Methods of administering/dosing anti-rsv antibodies for prophylaxis and treatment
WO2009092011A1 (en) 2008-01-18 2009-07-23 Medimmune, Llc Cysteine engineered antibodies for site-specific conjugation
US7575745B2 (en) 1997-07-07 2009-08-18 La Jolla Institute For Allergy And Immunology Ligand for herpes simplex virus entry mediator and methods of use
WO2009118300A1 (en) 2008-03-25 2009-10-01 Novartis Forschungsstiftung Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Treating cancer by down-regulating frizzled-4 and/or frizzled-1
WO2010027364A1 (en) 2008-09-07 2010-03-11 Glyconex Inc. Anti-extended type i glycosphingolipid antibody, derivatives thereof and use
WO2010052288A1 (en) 2008-11-07 2010-05-14 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Teneurin and cancer
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
EP2206516A1 (en) 2002-06-14 2010-07-14 Medimmune, LLC Stabilized liquid anti-RSV antibody formulations
WO2010080538A1 (en) 2008-12-19 2010-07-15 Macrogenics, Inc. Covalent diabodies and uses thereof
WO2010093993A2 (en) 2009-02-12 2010-08-19 Human Genome Sciences, Inc. Use of b lymphocyte stimulator protein antagonists to promote transplantation tolerance
WO2010100247A1 (en) 2009-03-06 2010-09-10 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Novel therapy for anxiety
EP2241323A1 (en) 2009-04-14 2010-10-20 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Tenascin-W and brain cancers
WO2010120524A2 (en) 2009-03-31 2010-10-21 Altair Therapeutics, Inc. Methods of modulating an immune response to a viral infection
EP2266628A2 (en) 2003-05-13 2010-12-29 Novartis Vaccines and Diagnostics, Inc. Method of determining the susceptibility to bone meatastases by EPhA2 expression
US7879328B2 (en) 2000-06-16 2011-02-01 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to B lymphocyte stimulator
EP2292663A2 (en) 2006-08-28 2011-03-09 Kyowa Hakko Kirin Co., Ltd. Antagonistic human light-specific human monoclonal antibodies
EP2292266A1 (en) 2009-08-27 2011-03-09 Novartis Forschungsstiftung, Zweigniederlassung Treating cancer by modulating copine III
EP2298806A1 (en) 2002-10-16 2011-03-23 Purdue Pharma L.P. Antibodies that bind cell-associated CA 125/0722P and methods of use thereof
WO2011036118A1 (en) 2009-09-22 2011-03-31 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Treating cancer by modulating mex-3
WO2011044368A1 (en) 2009-10-07 2011-04-14 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
WO2011045352A2 (en) 2009-10-15 2011-04-21 Novartis Forschungsstiftung Spleen tyrosine kinase and brain cancers
EP2316487A1 (en) 2003-04-11 2011-05-04 MedImmune, LLC Recombinant IL-9 antibodies & uses thereof
WO2011051392A1 (en) 2009-10-30 2011-05-05 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Phosphorylated twist1 and cancer
EP2332575A1 (en) 2003-12-23 2011-06-15 Genentech, Inc. Treatment of cancer with novel anti-IL 13 monoclonal antibodies
US7964190B2 (en) 1996-03-22 2011-06-21 Human Genome Sciences, Inc. Methods and compositions for decreasing T-cell activity
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
WO2011107586A1 (en) 2010-03-05 2011-09-09 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research, Smoc1, tenascin-c and brain cancers
EP2368578A1 (en) 2003-01-09 2011-09-28 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
EP2371389A2 (en) 2002-08-14 2011-10-05 MacroGenics, Inc. FcgammaRIIB-specific antibodies and methods of use thereof
WO2011131611A1 (en) 2010-04-19 2011-10-27 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Modulating xrn1
US8062906B2 (en) 2000-08-18 2011-11-22 Human Genome Sciences, Inc. B-lymphocyte stimulator binding polypeptides and methods based thereon
US8071092B1 (en) 1996-10-25 2011-12-06 Human Genome Sciences, Inc. Methods of inhibiting B lymphocytes using antibodies to Neutrokine-alpha
WO2011154485A1 (en) 2010-06-10 2011-12-15 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Treating cancer by modulating mammalian sterile 20-like kinase 3
EP2407548A1 (en) 2006-10-16 2012-01-18 MedImmune, LLC Molecules with reduced half-lives, compositions and uses thereof
WO2012018687A1 (en) 2010-08-02 2012-02-09 Macrogenics, Inc. Covalent diabodies and uses thereof
WO2012019061A2 (en) 2010-08-05 2012-02-09 Stem Centrx, Inc. Novel effectors and methods of use
EP2422811A2 (en) 2004-10-27 2012-02-29 MedImmune, LLC Modulation of antibody specificity by tailoring the affinity to cognate antigens
WO2012027723A1 (en) 2010-08-27 2012-03-01 Stem Centrx, Inc Notum protein modulators and methods of use
WO2012031273A2 (en) 2010-09-03 2012-03-08 Stem Centrx, Inc. Novel modulators and methods of use
WO2012032143A1 (en) 2010-09-10 2012-03-15 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Phosphorylated twist1 and metastasis
EP2431054A2 (en) 2000-06-15 2012-03-21 Human Genome Sciences, Inc. Human tumor necrosis factor delta and epsilon
WO2012065937A1 (en) 2010-11-15 2012-05-24 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Anti-fungal agents
WO2012078813A2 (en) 2010-12-08 2012-06-14 Stem Centrx, Inc. Novel modulators and methods of use
US8211649B2 (en) 2006-03-31 2012-07-03 Human Genome Sciences, Inc. Methods of diagnosing and prognosing hodgkin's lymphoma
US8211858B2 (en) 2007-04-27 2012-07-03 The University Of Toledo Modified plasminogen activator inhibitor type-1 molecule and methods based thereon
US8212004B2 (en) 1999-03-02 2012-07-03 Human Genome Sciences, Inc. Neutrokine-alpha fusion proteins
WO2012103165A2 (en) 2011-01-26 2012-08-02 Kolltan Pharmaceuticals, Inc. Anti-kit antibodies and uses thereof
WO2012112943A1 (en) 2011-02-18 2012-08-23 Stem Centrx, Inc. Novel modulators and methods of use
EP2500030A2 (en) 2005-11-04 2012-09-19 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
WO2012162068A2 (en) 2011-05-21 2012-11-29 Macrogenics, Inc. Deimmunized serum-binding domains and their use for extending serum half-life
WO2012168259A1 (en) 2011-06-06 2012-12-13 Novartis Forschungsstiftung, Zweigniederlassung Protein tyrosine phosphatase, non-receptor type 11 (ptpn11) and triple-negative breast cancer
US8388965B2 (en) 2007-10-15 2013-03-05 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2570432A1 (en) 2002-06-14 2013-03-20 Medimmune, Inc. Stabilized anti-respiratory syncytial virus (RSV) antibody formulations
EP2573114A1 (en) 2005-08-10 2013-03-27 MacroGenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
WO2013043071A1 (en) 2011-09-23 2013-03-28 Technophage, Investigação E Desenvolvimento Em Biotecnologia, Sa Modified albumin-binding domains and uses thereof to improve pharmacokinetics
WO2013068432A1 (en) 2011-11-08 2013-05-16 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Early diagnostic of neurodegenerative diseases
WO2013068431A1 (en) 2011-11-08 2013-05-16 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research New treatment for neurodegenerative diseases
WO2013093809A1 (en) 2011-12-23 2013-06-27 Pfizer Inc. Engineered antibody constant regions for site-specific conjugation and methods and uses therefor
EP2610267A1 (en) 2006-12-18 2013-07-03 Genentech, Inc. Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases
WO2013102825A1 (en) 2012-01-02 2013-07-11 Novartis Ag Cdcp1 and breast cancer
EP2626371A1 (en) 2007-07-31 2013-08-14 MedImmune, LLC Multispecific epitope binding proteins and uses thereof
WO2013119960A2 (en) 2012-02-08 2013-08-15 Stem Centrx, Inc. Novel modulators and methods of use
EP2639301A2 (en) 2006-06-30 2013-09-18 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
WO2013144240A1 (en) 2012-03-29 2013-10-03 Friedrich Miescher Institute For Biomedical Research Inhibition of interleukin- 8 and/or its receptor cxcrl in the treatment her2/her3 -overexpressing breast cancer
WO2014001482A1 (en) 2012-06-29 2014-01-03 Novartis Forschungsstiftung, Zweigniererlassung, Friedrich Miescher Institute For Biomedical Research Treating diseases by modulating a specific isoform of mkl1
WO2014006115A1 (en) 2012-07-06 2014-01-09 Novartis Ag Combination of a phosphoinositide 3-kinase inhibitor and an inhibitor of the il-8/cxcr interaction
WO2014006114A1 (en) 2012-07-05 2014-01-09 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research New treatment for neurodegenerative diseases
US8637026B2 (en) 2007-12-26 2014-01-28 Vaccinex, Inc. Anti-C35 antibody combination therapies and methods
WO2014018625A1 (en) 2012-07-25 2014-01-30 Kolltan Pharmaceuticals, Inc. Anti-kit antibodies and uses thereof
EP2703007A1 (en) 2007-03-30 2014-03-05 MedImmune, LLC Antibodies with decreased deamidation profiles
EP2711018A1 (en) 2009-06-22 2014-03-26 MedImmune, LLC Engineered Fc regions for site-specific conjugation
WO2014059028A1 (en) 2012-10-09 2014-04-17 Igenica, Inc. Anti-c16orf54 antibodies and methods of use thereof
EP2769737A1 (en) 2009-07-20 2014-08-27 Bristol-Myers Squibb Company Combination of an anti-CTLA4 antibody with etoposide for the synergistic treatment of proliferative diseases
US8852608B2 (en) 2009-02-02 2014-10-07 Medimmune, Llc Antibodies against and methods for producing vaccines for respiratory syncytial virus
US8937169B2 (en) 1996-01-11 2015-01-20 Human Genome Sciences, Inc. Human G-protein chemokine receptor HSATU68
WO2015019286A1 (en) 2013-08-07 2015-02-12 Friedrich Miescher Institute For Biomedical Research New screening method for the treatment friedreich's ataxia
US8980262B2 (en) 2007-08-29 2015-03-17 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8986972B2 (en) 2012-02-24 2015-03-24 Stem Centrx, Inc. Nucleic acid encoding DLL3 antibodies
US9168286B2 (en) 2005-10-13 2015-10-27 Human Genome Sciences, Inc. Methods and compositions for use in treatment of patients with autoantibody positive disease
WO2015189816A1 (en) 2014-06-13 2015-12-17 Friedrich Miescher Institute For Biomedical Research New treatment against influenza virus
WO2015198202A1 (en) 2014-06-23 2015-12-30 Friedrich Miescher Institute For Biomedical Research Methods for triggering de novo formation of heterochromatin and or epigenetic silencing with small rnas
WO2016001830A1 (en) 2014-07-01 2016-01-07 Friedrich Miescher Institute For Biomedical Research Combination of a brafv600e inhibitor and mertk inhibitor to treat melanoma
US9244074B2 (en) 2011-06-07 2016-01-26 University Of Hawaii Biomarker of asbestos exposure and mesothelioma
WO2016046768A1 (en) 2014-09-24 2016-03-31 Friedrich Miescher Institute For Biomedical Research Lats and breast cancer
EP3037544A1 (en) 2005-10-13 2016-06-29 Human Genome Sciences, Inc. Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases
WO2016139482A1 (en) 2015-03-03 2016-09-09 Kymab Limited Antibodies, uses & methods
EP3073267A1 (en) 2004-09-21 2016-09-28 Medimmune, Inc. Antibodies against and methods for producing vaccines for respiratory syncytial virus
WO2016166304A1 (en) 2015-04-15 2016-10-20 Van Berkel Patricius Hendrikus Cornelis Site-specific antibody-drug conjugates
US9505823B2 (en) 2006-08-07 2016-11-29 TEV A Biopharmaceuticals USA, Inc. Albumin-insulin fusion proteins
US9561274B2 (en) 2011-06-07 2017-02-07 University Of Hawaii Treatment and prevention of cancer with HMGB1 antagonists
US9592289B2 (en) 2012-03-26 2017-03-14 Sanofi Stable IgG4 based binding agent formulations
WO2017072669A1 (en) 2015-10-28 2017-05-04 Friedrich Miescher Institute For Biomedical Research Tenascin-w and biliary tract cancers
WO2017096051A1 (en) 2015-12-02 2017-06-08 Stcube & Co., Inc. Antibodies and molecules that immunospecifically bind to btn1a1 and the therapeutic uses thereof
WO2018083248A1 (en) 2016-11-03 2018-05-11 Kymab Limited Antibodies, combinations comprising antibodies, biomarkers, uses & methods
US9968687B2 (en) 2013-02-22 2018-05-15 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates
EP3338793A1 (en) 2013-08-28 2018-06-27 AbbVie Stemcentrx LLC Novel sez6 modulators and methods of use
US10017580B2 (en) 2014-04-15 2018-07-10 ADC Therpeutics S.A. Humanized anti-Tn-MUC1 antibodies and their conjugates
US10035853B2 (en) 2013-08-28 2018-07-31 Abbvie Stemcentrx Llc Site-specific antibody conjugation methods and compositions
US10100123B2 (en) 2013-06-06 2018-10-16 Pierre Fabre Medicament Anti-C10orf54 antibodies and uses thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0922099B1 (en) * 1996-07-19 2004-09-08 Takeda Chemical Industries, Ltd. Fas ligand-like protein, its production and use
US6346388B1 (en) * 1997-08-13 2002-02-12 Smithkline Beecham Corporation Method of identifying agonist and antagonists for tumor necrosis related receptors TR1 and TR2
WO1999011662A1 (en) * 1997-09-05 1999-03-11 Millennium Biotherapeutics, Inc. Novel molecules of the tnfr-ligand-related protein family and uses thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
ANNALS OF ONCOLOGY, 1996, Vol. 7, Suppl. 4, GRUSS et al., "Structural and Biological Features of the TNF Receptor and TNF Ligand Superfamilies: Interactive Signals in the Pathobiology of Hodgkins Disease", S19-S26. *
BLOOD, 15 June 1995, Vol. 85, No. 12, GRUSS et al., "Tumor Necrosis Factor Ligand Superfamily: Involvement in the Pathology of Malignant Lymphomas", pages 3378-3404. *
CYTOKINES AND MOLECULAR THERAPY, 1995, Vol. 1, GRUSS et al., "The TNF Ligand Superfamily and Its Relevance for Human Diseases", pages 75-105. *
INTERNATIONAL IMMUNOLOGY, 1993, Vol. 5, No. 6, TAKEDA et al., "Rapid Acceleration of Neutrophil Apoptosis by Tumor Necrosis Factor-alpha", pages 691-694. *
LEUKEMIA AND LYMPHOMA, 1996, Vol. 20, GRUSS et al., "CD30 Ligand, a Member of the TNF Ligand Superfamily, With Growth and Activation Control for CD30+Lymphoid and Lymphoma Cells", pages 397-409. *
See also references of EP0904278A4 *

Cited By (238)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8937169B2 (en) 1996-01-11 2015-01-20 Human Genome Sciences, Inc. Human G-protein chemokine receptor HSATU68
US7708996B2 (en) 1996-03-12 2010-05-04 Human Genome Sciences, Inc. DR3 antibodies
US8105589B2 (en) 1996-03-12 2012-01-31 Human Genome Sciences, Inc. Use of DR3 antibodies in the treatment of inflammatory disease
US7357927B2 (en) 1996-03-12 2008-04-15 Human Genome Sciences, Inc. Death domain containing receptors
US6759513B2 (en) 1996-03-12 2004-07-06 Human Genome Sciences, Inc. Death domain containing receptors
US6713061B1 (en) 1996-03-12 2004-03-30 Human Genome Sciences, Inc. Death domain containing receptors
US6635743B1 (en) 1996-03-22 2003-10-21 Human Genome Sciences, Inc. Apoptosis inducing molecule II and methods of use
US6479254B2 (en) 1996-03-22 2002-11-12 Human Genome Sciences, Inc. Apoptosis inducing molecule II
US7964190B2 (en) 1996-03-22 2011-06-21 Human Genome Sciences, Inc. Methods and compositions for decreasing T-cell activity
US6495520B2 (en) 1996-03-22 2002-12-17 Human Genome Sciences, Inc. Apoptosis Inducing Molecule II and methods of use
US6235878B1 (en) 1996-07-19 2001-05-22 Takeda Chemical Industries, Ltd. Fas ligand-like protein, its production and use
US8303951B2 (en) 1996-10-25 2012-11-06 Human Genome Sciences, Inc. Neutrokine-alpha antibodies and methods of use thereof
US8173122B2 (en) 1996-10-25 2012-05-08 Human Genome Sciences, Inc. Methods of treatment using antibodies to neutrokine-alpha
US8231873B2 (en) 1996-10-25 2012-07-31 Human Genome Sciences, Inc. Methods of treatment using antibodies to Neutrokine-alpha
US8071092B1 (en) 1996-10-25 2011-12-06 Human Genome Sciences, Inc. Methods of inhibiting B lymphocytes using antibodies to Neutrokine-alpha
US7575745B2 (en) 1997-07-07 2009-08-18 La Jolla Institute For Allergy And Immunology Ligand for herpes simplex virus entry mediator and methods of use
EP1003782A4 (en) * 1997-07-07 2002-07-10 Jolla Inst Allergy Immunolog Ligand for herpes simplex virus entry mediator and methods of use
EP1003782A1 (en) * 1997-07-07 2000-05-31 La Jolla Institute For Allergy And Immunology Ligand for herpes simplex virus entry mediator and methods of use
US6140467A (en) * 1997-07-07 2000-10-31 La Jolla Institute For Allergy And Immunology Ligand for herpes simplex virus entry mediator and methods of use
US6998108B1 (en) 1997-07-07 2006-02-14 La Jolla Institute For Allergy And Immunology Antibodies to p30 polypeptides and methods making and using same
US6346388B1 (en) 1997-08-13 2002-02-12 Smithkline Beecham Corporation Method of identifying agonist and antagonists for tumor necrosis related receptors TR1 and TR2
WO1999035262A2 (en) * 1998-01-07 1999-07-15 Human Genome Sciences, Inc. Apoptosis inducing molecule ii
WO1999035262A3 (en) * 1998-01-07 1999-12-02 Human Genome Sciences Inc Apoptosis inducing molecule ii
WO1999042584A1 (en) * 1998-02-20 1999-08-26 Human Genome Sciences, Inc. Apoptosis inducing molecule ii and methods of use
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
US8212004B2 (en) 1999-03-02 2012-07-03 Human Genome Sciences, Inc. Neutrokine-alpha fusion proteins
WO2000053223A1 (en) * 1999-03-11 2000-09-14 Human Genome Sciences, Inc. Apoptosis inducing molecule ii and methods of use
EP1179347A1 (en) * 1999-05-21 2002-02-13 Takeda Chemical Industries, Ltd. Liver function controlling agents
EP1179347A4 (en) * 1999-05-21 2002-06-26 Takeda Chemical Industries Ltd Liver function controlling agents
WO2001079496A2 (en) * 2000-03-13 2001-10-25 La Jolla Institute For Allergy And Immunology Ligand for herpes simplex virus entry mediator and methods of use
WO2001079496A3 (en) * 2000-03-13 2002-08-29 Jolla Inst Allergy Immunolog Ligand for herpes simplex virus entry mediator and methods of use
EP2216409A1 (en) 2000-04-12 2010-08-11 Human Genome Sciences, Inc. Albumin fusion proteins
EP1674575A3 (en) * 2000-04-12 2007-08-08 La Jolla Institute For Allergy And Immunology Ligand for herpes simplex virus entry mediator and methods of use
EP2236152A1 (en) 2000-04-12 2010-10-06 Human Genome Sciences, Inc. Albumin fusion proteins
EP2275557A1 (en) 2000-04-12 2011-01-19 Human Genome Sciences, Inc. Albumin fusion proteins
EP2298355A2 (en) 2000-04-12 2011-03-23 Human Genome Sciences, Inc. Albumin fusion proteins
EP2357008A1 (en) 2000-04-12 2011-08-17 Human Genome Sciences, Inc. Albumin fusion proteins
EP2311872A1 (en) 2000-04-12 2011-04-20 Human Genome Sciences, Inc. Albumin fusion proteins
EP2267026A1 (en) 2000-04-12 2010-12-29 Human Genome Sciences, Inc. Albumin fusion proteins
EP2213743A1 (en) 2000-04-12 2010-08-04 Human Genome Sciences, Inc. Albumin fusion proteins
EP2295456A1 (en) 2000-04-12 2011-03-16 Human Genome Sciences, Inc. Albumin fusion proteins
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
EP2431054A2 (en) 2000-06-15 2012-03-21 Human Genome Sciences, Inc. Human tumor necrosis factor delta and epsilon
EP2275449A1 (en) 2000-06-16 2011-01-19 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
US7605236B2 (en) 2000-06-16 2009-10-20 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to B lymphocyte stimulator protein
US7879328B2 (en) 2000-06-16 2011-02-01 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to B lymphocyte stimulator
WO2002002641A1 (en) 2000-06-16 2002-01-10 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
EP2281842A1 (en) 2000-06-16 2011-02-09 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to BLyS
US9187548B2 (en) 2000-06-16 2015-11-17 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to B lymphocyte stimulator protein
US8101181B2 (en) 2000-06-16 2012-01-24 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to B lymphocyte stimulator protein
EP2281843A1 (en) 2000-06-16 2011-02-09 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
US8062906B2 (en) 2000-08-18 2011-11-22 Human Genome Sciences, Inc. B-lymphocyte stimulator binding polypeptides and methods based thereon
EP2027874A2 (en) 2000-11-28 2009-02-25 Medimmune, Inc. Methods of administering/dosing anti-rsv antibodies for prophylaxis and treatment
EP2412384A1 (en) 2000-11-28 2012-02-01 MedImmune, LLC Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment
EP2338512A1 (en) 2000-11-28 2011-06-29 MedImmune, LLC Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment
EP2341060A1 (en) 2000-12-12 2011-07-06 MedImmune, LLC Molecules with extended half-lives, compositions and uses thereof
EP2357187A1 (en) 2000-12-12 2011-08-17 MedImmune, LLC Molecules with extended half-lives, compositions and uses thereof
WO2002060919A2 (en) 2000-12-12 2002-08-08 Medimmune, Inc. Molecules with extended half-lives, compositions and uses thereof
EP2354149A1 (en) 2000-12-12 2011-08-10 MedImmune, LLC Molecules with extended half-lives, compositions and uses thereof
WO2002066050A1 (en) * 2001-02-23 2002-08-29 Takeda Chemical Industries, Ltd. Casoase 3 inhibitors
WO2002066049A1 (en) * 2001-02-23 2002-08-29 Takeda Chemical Industries, Ltd. Agents for plasmic change
WO2002083704A1 (en) 2001-04-13 2002-10-24 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
EP2228389A2 (en) 2001-04-13 2010-09-15 Human Genome Sciences, Inc. Antibodies against vascular endothelial growth factor 2
WO2002097033A2 (en) 2001-05-25 2002-12-05 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to trail receptors
EP2261250A1 (en) 2001-12-21 2010-12-15 Human Genome Sciences, Inc. Albumin fusion proteins
WO2003060071A2 (en) 2001-12-21 2003-07-24 Human Genome Sciences, Inc. Albumin fusion proteins
EP1997829A1 (en) 2001-12-21 2008-12-03 Human Genome Sciences, Inc. Albumin fusion proteins
EP2277888A2 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Fusion proteins of albumin and erythropoietin
EP2277910A1 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Albumin fusion proteins
EP2277889A2 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Fusion proteins of albumin and interferon beta
EP2990417A1 (en) 2001-12-21 2016-03-02 Human Genome Sciences, Inc. Albumin insulin fusion protein
EP2270049A2 (en) 2002-04-12 2011-01-05 Medimmune, Inc. Recombinant anti-interleukin-9-antibody
WO2003086458A1 (en) 2002-04-12 2003-10-23 Medimmune, Inc. Recombinant anti-interleukin-9 antibodies
EP2570432A1 (en) 2002-06-14 2013-03-20 Medimmune, Inc. Stabilized anti-respiratory syncytial virus (RSV) antibody formulations
EP2327421A1 (en) 2002-06-14 2011-06-01 MedImmune, LLC Stabilized liquid anti-RSV antibody formulations
EP2206516A1 (en) 2002-06-14 2010-07-14 Medimmune, LLC Stabilized liquid anti-RSV antibody formulations
EP2371389A2 (en) 2002-08-14 2011-10-05 MacroGenics, Inc. FcgammaRIIB-specific antibodies and methods of use thereof
EP2891666A1 (en) 2002-10-16 2015-07-08 Purdue Pharma L.P. Antibodies that bind cell-associated CA 125/O722P and methods of use thereof
EP2298806A1 (en) 2002-10-16 2011-03-23 Purdue Pharma L.P. Antibodies that bind cell-associated CA 125/0722P and methods of use thereof
EP3301114A1 (en) 2002-10-16 2018-04-04 Purdue Pharma LP Fusion polypeptides of antibodies that bind cell-associated ca 125/o722p
EP2368578A1 (en) 2003-01-09 2011-09-28 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
EP2316487A1 (en) 2003-04-11 2011-05-04 MedImmune, LLC Recombinant IL-9 antibodies & uses thereof
EP2266628A2 (en) 2003-05-13 2010-12-29 Novartis Vaccines and Diagnostics, Inc. Method of determining the susceptibility to bone meatastases by EPhA2 expression
WO2005042743A2 (en) 2003-08-18 2005-05-12 Medimmune, Inc. Humanization of antibodies
EP2272566A2 (en) 2003-08-18 2011-01-12 MedImmune, LLC Humanisation of antibodies
EP2332575A1 (en) 2003-12-23 2011-06-15 Genentech, Inc. Treatment of cancer with novel anti-IL 13 monoclonal antibodies
EP2805728A1 (en) 2003-12-23 2014-11-26 Genentech, Inc. Novel anti-IL 13 antibodies and uses thereof
EP2351584A1 (en) 2003-12-23 2011-08-03 Genentech, Inc. Novel anti-IL 13 antibodies and uses thereof
WO2005077042A2 (en) 2004-02-09 2005-08-25 Human Genome Sciences, Inc. Albumin fusion proteins
WO2005117967A2 (en) 2004-04-12 2005-12-15 Medimmune, Inc. Anti-il-9 antibody formulations and uses thereof
EP3073267A1 (en) 2004-09-21 2016-09-28 Medimmune, Inc. Antibodies against and methods for producing vaccines for respiratory syncytial virus
EP2422811A2 (en) 2004-10-27 2012-02-29 MedImmune, LLC Modulation of antibody specificity by tailoring the affinity to cognate antigens
WO2006102095A2 (en) 2005-03-18 2006-09-28 Medimmune, Inc. Framework-shuffling of antibodies
WO2007002543A2 (en) 2005-06-23 2007-01-04 Medimmune, Inc. Antibody formulations having optimized aggregation and fragmentation profiles
EP2573114A1 (en) 2005-08-10 2013-03-27 MacroGenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
EP3037544A1 (en) 2005-10-13 2016-06-29 Human Genome Sciences, Inc. Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases
US9168286B2 (en) 2005-10-13 2015-10-27 Human Genome Sciences, Inc. Methods and compositions for use in treatment of patients with autoantibody positive disease
EP3299027A1 (en) 2005-11-04 2018-03-28 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
EP2998318A1 (en) 2005-11-04 2016-03-23 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
EP2500030A2 (en) 2005-11-04 2012-09-19 Genentech, Inc. Use of complement pathway inhibitors to treat ocular diseases
US8211649B2 (en) 2006-03-31 2012-07-03 Human Genome Sciences, Inc. Methods of diagnosing and prognosing hodgkin's lymphoma
EP2815764A1 (en) 2006-06-14 2014-12-24 Macrogenics, Inc. Methods for the treatment of autoimmune disorders using monoclonal antibodies with reduced toxicity
WO2007147090A2 (en) 2006-06-14 2007-12-21 Macrogenics, Inc. Methods for the treatment of autoimmune disorders using monoclonal antibodies with reduced toxicity
EP2505209A1 (en) 2006-06-26 2012-10-03 MacroGenics, Inc. Fcgamma-RIIB-specific antibodies and methods of the use thereof
WO2008019199A2 (en) 2006-06-26 2008-02-14 Macrogenics, Inc. FCγRIIB-SPECIFIC ANTIBODIES AND METHODS OF USE THEREOF
EP2639301A2 (en) 2006-06-30 2013-09-18 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
EP2671946A1 (en) 2006-06-30 2013-12-11 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
US9505823B2 (en) 2006-08-07 2016-11-29 TEV A Biopharmaceuticals USA, Inc. Albumin-insulin fusion proteins
US8058402B2 (en) 2006-08-28 2011-11-15 Kyowa Hakko Kirin Antagonistic human LIGHT-specific human monoclonal antibodies
US8974787B2 (en) 2006-08-28 2015-03-10 Kyowa Hakko Kirin Co., Limited Antagonistic human light-specific human monoclonal antibodies
US9771419B2 (en) 2006-08-28 2017-09-26 Kyowa Hakko Kirin Co., Limited Antagonistic human light-specific human monoclonal antibodies
US8461307B2 (en) 2006-08-28 2013-06-11 Kyowa Hakko Kirin Co., Limited Antagonistic human LIGHT-specific human monoclonal antibodies
EP2484696A1 (en) 2006-08-28 2012-08-08 Kyowa Hakko Kirin Co., Ltd. Antagonistic human light-specific human monoclonal antibodies
EP2292663A2 (en) 2006-08-28 2011-03-09 Kyowa Hakko Kirin Co., Ltd. Antagonistic human light-specific human monoclonal antibodies
EP2407548A1 (en) 2006-10-16 2012-01-18 MedImmune, LLC Molecules with reduced half-lives, compositions and uses thereof
WO2008073312A2 (en) 2006-12-08 2008-06-19 Attenuon, Llc Urokinase-type plasminogen activator receptor epitope, monoclonal antibodies derived therefrom and methods of use thereof
EP2610267A1 (en) 2006-12-18 2013-07-03 Genentech, Inc. Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases
EP2703007A1 (en) 2007-03-30 2014-03-05 MedImmune, LLC Antibodies with decreased deamidation profiles
US8211858B2 (en) 2007-04-27 2012-07-03 The University Of Toledo Modified plasminogen activator inhibitor type-1 molecule and methods based thereon
WO2008136694A1 (en) 2007-05-04 2008-11-13 Technophage, Investigação E Desenvolvimento Em Biotecnologia, Sa Engineered rabbit antibody variable domains and uses thereof
WO2008157379A2 (en) 2007-06-21 2008-12-24 Macrogenics, Inc. Covalent diabodies and uses thereof
EP2626371A1 (en) 2007-07-31 2013-08-14 MedImmune, LLC Multispecific epitope binding proteins and uses thereof
US9815902B2 (en) 2007-08-29 2017-11-14 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their uses
US9228019B2 (en) 2007-08-29 2016-01-05 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9243067B2 (en) 2007-08-29 2016-01-26 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8980262B2 (en) 2007-08-29 2015-03-17 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9175087B2 (en) 2007-08-29 2015-11-03 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8388965B2 (en) 2007-10-15 2013-03-05 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2574630A1 (en) 2007-10-15 2013-04-03 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
EP2574626A1 (en) 2007-10-15 2013-04-03 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2574629A1 (en) 2007-10-15 2013-04-03 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
US9732162B2 (en) 2007-10-15 2017-08-15 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573117A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573121A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
EP2573118A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573119A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573115A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573116A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US9738728B2 (en) 2007-10-15 2017-08-22 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US8637026B2 (en) 2007-12-26 2014-01-28 Vaccinex, Inc. Anti-C35 antibody combination therapies and methods
WO2009092011A1 (en) 2008-01-18 2009-07-23 Medimmune, Llc Cysteine engineered antibodies for site-specific conjugation
WO2009118300A1 (en) 2008-03-25 2009-10-01 Novartis Forschungsstiftung Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Treating cancer by down-regulating frizzled-4 and/or frizzled-1
WO2010027364A1 (en) 2008-09-07 2010-03-11 Glyconex Inc. Anti-extended type i glycosphingolipid antibody, derivatives thereof and use
WO2010052288A1 (en) 2008-11-07 2010-05-14 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Teneurin and cancer
EP2786762A2 (en) 2008-12-19 2014-10-08 MacroGenics, Inc. Covalent diabodies and uses thereof
WO2010080538A1 (en) 2008-12-19 2010-07-15 Macrogenics, Inc. Covalent diabodies and uses thereof
US8852608B2 (en) 2009-02-02 2014-10-07 Medimmune, Llc Antibodies against and methods for producing vaccines for respiratory syncytial virus
US9499590B2 (en) 2009-02-02 2016-11-22 Medimmune, Llc Antibodies against and methods for producing vaccines for respiratory syncytial virus
WO2010093993A2 (en) 2009-02-12 2010-08-19 Human Genome Sciences, Inc. Use of b lymphocyte stimulator protein antagonists to promote transplantation tolerance
WO2010100247A1 (en) 2009-03-06 2010-09-10 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Novel therapy for anxiety
WO2010120511A2 (en) 2009-03-31 2010-10-21 Altair Therapeutics, Inc. Method of treating respiratory disorders
WO2010120524A2 (en) 2009-03-31 2010-10-21 Altair Therapeutics, Inc. Methods of modulating an immune response to a viral infection
EP2241323A1 (en) 2009-04-14 2010-10-20 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Tenascin-W and brain cancers
EP2711018A1 (en) 2009-06-22 2014-03-26 MedImmune, LLC Engineered Fc regions for site-specific conjugation
EP2769737A1 (en) 2009-07-20 2014-08-27 Bristol-Myers Squibb Company Combination of an anti-CTLA4 antibody with etoposide for the synergistic treatment of proliferative diseases
EP2947098A1 (en) 2009-07-20 2015-11-25 Bristol-Myers Squibb Company Combination of anti-ctla4 antibody with gemcitabine for the synergistic treatment of proliferative diseases
EP2292266A1 (en) 2009-08-27 2011-03-09 Novartis Forschungsstiftung, Zweigniederlassung Treating cancer by modulating copine III
WO2011036118A1 (en) 2009-09-22 2011-03-31 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Treating cancer by modulating mex-3
WO2011044368A1 (en) 2009-10-07 2011-04-14 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
US9096877B2 (en) 2009-10-07 2015-08-04 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
WO2011045352A2 (en) 2009-10-15 2011-04-21 Novartis Forschungsstiftung Spleen tyrosine kinase and brain cancers
WO2011051392A1 (en) 2009-10-30 2011-05-05 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Phosphorylated twist1 and cancer
WO2011107586A1 (en) 2010-03-05 2011-09-09 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research, Smoc1, tenascin-c and brain cancers
WO2011131611A1 (en) 2010-04-19 2011-10-27 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Modulating xrn1
WO2011154485A1 (en) 2010-06-10 2011-12-15 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Treating cancer by modulating mammalian sterile 20-like kinase 3
WO2012018687A1 (en) 2010-08-02 2012-02-09 Macrogenics, Inc. Covalent diabodies and uses thereof
WO2012019061A2 (en) 2010-08-05 2012-02-09 Stem Centrx, Inc. Novel effectors and methods of use
WO2012027723A1 (en) 2010-08-27 2012-03-01 Stem Centrx, Inc Notum protein modulators and methods of use
WO2012031273A2 (en) 2010-09-03 2012-03-08 Stem Centrx, Inc. Novel modulators and methods of use
WO2012032143A1 (en) 2010-09-10 2012-03-15 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Phosphorylated twist1 and metastasis
WO2012065937A1 (en) 2010-11-15 2012-05-24 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Anti-fungal agents
WO2012078813A2 (en) 2010-12-08 2012-06-14 Stem Centrx, Inc. Novel modulators and methods of use
WO2012118547A1 (en) 2010-12-08 2012-09-07 Stem Centrx, Inc. Novel modulators and methods of use
WO2012103165A2 (en) 2011-01-26 2012-08-02 Kolltan Pharmaceuticals, Inc. Anti-kit antibodies and uses thereof
WO2012112943A1 (en) 2011-02-18 2012-08-23 Stem Centrx, Inc. Novel modulators and methods of use
WO2012162068A2 (en) 2011-05-21 2012-11-29 Macrogenics, Inc. Deimmunized serum-binding domains and their use for extending serum half-life
WO2012168259A1 (en) 2011-06-06 2012-12-13 Novartis Forschungsstiftung, Zweigniederlassung Protein tyrosine phosphatase, non-receptor type 11 (ptpn11) and triple-negative breast cancer
US9181553B2 (en) 2011-06-06 2015-11-10 Novartis Forschungsstiftung Zweigniederlassung Friedrich Miescher Institute For Biomedical Research Method of treatment of breast cancers over-expressing the SHP2 signature genes
US9561274B2 (en) 2011-06-07 2017-02-07 University Of Hawaii Treatment and prevention of cancer with HMGB1 antagonists
US9244074B2 (en) 2011-06-07 2016-01-26 University Of Hawaii Biomarker of asbestos exposure and mesothelioma
WO2013043071A1 (en) 2011-09-23 2013-03-28 Technophage, Investigação E Desenvolvimento Em Biotecnologia, Sa Modified albumin-binding domains and uses thereof to improve pharmacokinetics
WO2013068432A1 (en) 2011-11-08 2013-05-16 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research Early diagnostic of neurodegenerative diseases
WO2013068431A1 (en) 2011-11-08 2013-05-16 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research New treatment for neurodegenerative diseases
WO2013093809A1 (en) 2011-12-23 2013-06-27 Pfizer Inc. Engineered antibody constant regions for site-specific conjugation and methods and uses therefor
WO2013102825A1 (en) 2012-01-02 2013-07-11 Novartis Ag Cdcp1 and breast cancer
WO2013119960A2 (en) 2012-02-08 2013-08-15 Stem Centrx, Inc. Novel modulators and methods of use
US9353182B2 (en) 2012-02-24 2016-05-31 Stemcentrx, Inc. Anti-DLL3 antibodies
US9855343B2 (en) 2012-02-24 2018-01-02 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates
US9155803B1 (en) 2012-02-24 2015-10-13 Stemcentrx, Inc. Anti-DLL3 antibody drug conjugates and methods of use
US9107961B2 (en) 2012-02-24 2015-08-18 Stemcentrx, Inc. Anti-DLL3 antibody drug conjugates for treating cancer
US9931421B2 (en) 2012-02-24 2018-04-03 Abbvie Stemcentrx Llc Methods of delivering DLL3 antibody drug conjugates
US9089615B2 (en) 2012-02-24 2015-07-28 Stemcentrx, Inc. Anti-DLL3 antibodies
US9861708B2 (en) 2012-02-24 2018-01-09 Abbvie Stemcentrx Llc Kits containing DLL3 antibody drug conjugates
US10137204B2 (en) 2012-02-24 2018-11-27 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates for treating cancer
US9775916B1 (en) 2012-02-24 2017-10-03 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates for treating cancer
US9334318B1 (en) 2012-02-24 2016-05-10 Stemcentrx, Inc. Multivalent DLL3 antibodies
US9345784B1 (en) 2012-02-24 2016-05-24 Stemcentrx, Inc. Methods of delivering DLL3 antibody drug conjugates
US9352051B1 (en) 2012-02-24 2016-05-31 Stemcentrx, Inc. Kits containing DLL3 antibody drug conjugates
US9173959B1 (en) 2012-02-24 2015-11-03 Stemcentrx, Inc. Anti-DLL3 antibody drug conjugates
US9089616B2 (en) 2012-02-24 2015-07-28 Stemcentrx, Inc. Anti-DLL3 antibody drug conjugates and methods of use
US9486537B2 (en) 2012-02-24 2016-11-08 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates
US9770518B1 (en) 2012-02-24 2017-09-26 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates
US9090683B2 (en) 2012-02-24 2015-07-28 Stemcentrx, Inc. Methods of detection, diagnosis, and monitoring using anti-DLL3 antibodies
US9089617B2 (en) 2012-02-24 2015-07-28 Stemcentrx, Inc. Anti-DLL3 antibody drug conjugates
US9481727B2 (en) 2012-02-24 2016-11-01 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates
US9480757B2 (en) 2012-02-24 2016-11-01 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates
US8986972B2 (en) 2012-02-24 2015-03-24 Stem Centrx, Inc. Nucleic acid encoding DLL3 antibodies
US9867887B1 (en) 2012-02-24 2018-01-16 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates
EP3095797A1 (en) 2012-02-24 2016-11-23 Stemcentrx, Inc. Anti dll3 antibodies and methods of use thereof
US9931420B2 (en) 2012-02-24 2018-04-03 Abbvie Stemcentrx Llc Methods of making DLL3 antibody drug conjugates
US9937268B2 (en) 2012-02-24 2018-04-10 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates and methods of use
US9764042B1 (en) 2012-02-24 2017-09-19 Abbvie Stemcentrx Llc Methods of making DLL3 antibody drug conjugates
US9878053B2 (en) 2012-02-24 2018-01-30 Abbvie Stemcentrx Llc Methods of delivering DLL3 antibody drug conjugates
US9358304B1 (en) 2012-02-24 2016-06-07 Stemcentrx, Inc. Methods of making DLL3 antibody drug conjugates
US9133271B1 (en) 2012-02-24 2015-09-15 Stemcentrx, Inc. Anti-DLL3 antibody drug conjugates and methods of use
US9592289B2 (en) 2012-03-26 2017-03-14 Sanofi Stable IgG4 based binding agent formulations
WO2013144240A1 (en) 2012-03-29 2013-10-03 Friedrich Miescher Institute For Biomedical Research Inhibition of interleukin- 8 and/or its receptor cxcrl in the treatment her2/her3 -overexpressing breast cancer
WO2014001482A1 (en) 2012-06-29 2014-01-03 Novartis Forschungsstiftung, Zweigniererlassung, Friedrich Miescher Institute For Biomedical Research Treating diseases by modulating a specific isoform of mkl1
WO2014006114A1 (en) 2012-07-05 2014-01-09 Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research New treatment for neurodegenerative diseases
WO2014006115A1 (en) 2012-07-06 2014-01-09 Novartis Ag Combination of a phosphoinositide 3-kinase inhibitor and an inhibitor of the il-8/cxcr interaction
WO2014018625A1 (en) 2012-07-25 2014-01-30 Kolltan Pharmaceuticals, Inc. Anti-kit antibodies and uses thereof
EP3381943A1 (en) 2012-07-25 2018-10-03 Celldex Therapeutics, Inc. Anti-kit antibodies and uses thereof
WO2014059028A1 (en) 2012-10-09 2014-04-17 Igenica, Inc. Anti-c16orf54 antibodies and methods of use thereof
US9968687B2 (en) 2013-02-22 2018-05-15 Abbvie Stemcentrx Llc Anti-DLL3 antibody drug conjugates
US10100123B2 (en) 2013-06-06 2018-10-16 Pierre Fabre Medicament Anti-C10orf54 antibodies and uses thereof
WO2015019286A1 (en) 2013-08-07 2015-02-12 Friedrich Miescher Institute For Biomedical Research New screening method for the treatment friedreich's ataxia
EP3338793A1 (en) 2013-08-28 2018-06-27 AbbVie Stemcentrx LLC Novel sez6 modulators and methods of use
US10035853B2 (en) 2013-08-28 2018-07-31 Abbvie Stemcentrx Llc Site-specific antibody conjugation methods and compositions
US10017580B2 (en) 2014-04-15 2018-07-10 ADC Therpeutics S.A. Humanized anti-Tn-MUC1 antibodies and their conjugates
WO2015189816A1 (en) 2014-06-13 2015-12-17 Friedrich Miescher Institute For Biomedical Research New treatment against influenza virus
WO2015198202A1 (en) 2014-06-23 2015-12-30 Friedrich Miescher Institute For Biomedical Research Methods for triggering de novo formation of heterochromatin and or epigenetic silencing with small rnas
WO2016001830A1 (en) 2014-07-01 2016-01-07 Friedrich Miescher Institute For Biomedical Research Combination of a brafv600e inhibitor and mertk inhibitor to treat melanoma
WO2016046768A1 (en) 2014-09-24 2016-03-31 Friedrich Miescher Institute For Biomedical Research Lats and breast cancer
WO2016139482A1 (en) 2015-03-03 2016-09-09 Kymab Limited Antibodies, uses & methods
WO2016166304A1 (en) 2015-04-15 2016-10-20 Van Berkel Patricius Hendrikus Cornelis Site-specific antibody-drug conjugates
WO2017072669A1 (en) 2015-10-28 2017-05-04 Friedrich Miescher Institute For Biomedical Research Tenascin-w and biliary tract cancers
WO2017096051A1 (en) 2015-12-02 2017-06-08 Stcube & Co., Inc. Antibodies and molecules that immunospecifically bind to btn1a1 and the therapeutic uses thereof
WO2018083248A1 (en) 2016-11-03 2018-05-11 Kymab Limited Antibodies, combinations comprising antibodies, biomarkers, uses & methods

Also Published As

Publication number Publication date
CN1107072C (en) 2003-04-30
KR100497017B1 (en) 2005-11-29
KR20000064745A (en) 2000-11-06
EP0904278A1 (en) 1999-03-31
CN1216994A (en) 1999-05-19
JP2000508522A (en) 2000-07-11
CA2248868A1 (en) 1997-09-25
EP0904278A4 (en) 1999-09-15
CN1428426A (en) 2003-07-09
KR20030096450A (en) 2003-12-31

Similar Documents

Publication Publication Date Title
US6518404B1 (en) Human endothelin-bombesin receptor antibodies
US6511826B2 (en) Polynucleotides encoding human G-protein chemokine receptor (CCR5) HDGNR10
US6689579B1 (en) Polynucleotides encoding neutrokine-α
US5985614A (en) Polynucleotides encoding interleukin-19
US5861272A (en) C5A receptor
US20010000241A1 (en) Antibodies to human G-protein chemokine receptor HDGNR10 (CCR5 receptor)
US5874240A (en) Human 4-1BB receptor splicing variant
US6461823B1 (en) Death domain containing receptor-4 antibodies
US20020127637A1 (en) Human tumor necrosis factor receptor-like protein 8
US5942417A (en) CD44-like protein and nucleic acids
US20020098550A1 (en) Death domain containing receptor 5
US6171816B1 (en) Human XAG-1 polynucleotides and polypeptides
US20040151719A1 (en) Human G-protein chemokine receptor (CCR5) HDGNR10
WO1998056892A1 (en) Human tumor necrosis factor receptor tr9
WO1997033904A1 (en) Death domain containing receptors
US20030166097A1 (en) Human tumor necrosis factor receptor
WO1998005783A1 (en) A tumor necrosis factor related ligand
US5948890A (en) Human G-protein receptor HPRAJ70
WO1997033902A1 (en) Human tumor necrosis factor delta and epsilon
US20030208054A1 (en) Fc Receptors and polypeptides
WO1997033899A1 (en) Apoptosis inducing molecule i
US20020150989A1 (en) Human tumor necrosis factor receptor
WO1996014328A1 (en) Tumor necrosis factor-gamma
WO2000015759A1 (en) Interleukin 17-like receptor protein

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 96180284.7

Country of ref document: CN

AL Designated countries for regional patents

Kind code of ref document: A1


AK Designated states

Kind code of ref document: A1


121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase in:

Ref document number: 2248868

Country of ref document: CA

Ref document number: 2248868

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1019980707496

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 1996941944

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1996941944

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1019980707496

Country of ref document: KR

WWR Wipo information: refused in national office

Ref document number: 1019980707496

Country of ref document: KR

WWR Wipo information: refused in national office

Ref document number: 1996941944

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1996941944

Country of ref document: EP