JPWO2019157358A5

JPWO2019157358A5 -

Info

Publication number: JPWO2019157358A5
Application number: JP2020540485A
Authority: JP
Publication date: 2022-02-16
Anticipated expiration: 2039-02-08

Claims

(I) A genotype containing an active tryptase allele count that is greater than or equal to the reference active tryptase alligen number, or (ii) an expression level of tryptase that is greater than or equal to the reference level tryptase in the patient's sample. A drug for treating patients with mast cell-mediated inflammatory diseases, such as tryptase antagonist, IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, protease-activated receptor 2 (PAR2). A drug comprising an antagonist or a drug selected from a combination thereof .

Whether the patient with mast cell-mediated inflammatory disease is a tryptase antagonist, IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, protease-activated receptor 2 (PAR2) antagonist, or a combination thereof. A kit for determining whether a treatment containing a drug of choice is likely to be responded to .
( 1 ) In a sample of a patient having a mast cell-mediated inflammatory disease, the number of active tryptase alleles equal to or higher than the reference active tryptase allele number is the means for determining the number of active tryptase alleles in the patient. A means of indicating that a patient is likely to respond to the treatment ; or
(2) A means for determining the expression level of tryptase in a sample of a patient having a mast cell-mediated inflammatory disease, and the expression level of tryptase, which is higher than the reference level of tryptase in the sample, is the treatment for the patient. Means to indicate that you are likely to respond to
Kit including .

The kit of claim 2, wherein the treatment is given to the patient .

The drug according to claim 1.
(I) The patient has been identified as having a level of the type 2 biomarker below the reference level of the type 2 biomarker in the patient's sample, and the agent is administered to the patient as monotherapy. ; Or
(Ii) The patient has been identified as having a level of the type 2 biomarker that is above the reference level of the type 2 biomarker in the patient's sample, and an additional TH2 _pathway inhibitor has been added to the patient. Further administered
Medicine .

Mast cells identified as having (i) a genotype containing an active tryptase allele count less than the reference active tryptase allelic number, or (ii) an expression level of tryptase below the reference level of tryptase in the patient's sample. A drug for treating a patient with a mediated inflammatory disease and comprising an IgE antagonist or an Fc epsilon receptor ( FcεR ) antagonist .

A kit for determining whether patients with mast cell-mediated inflammatory disease are more likely to respond to treatments containing IgE antagonists or FcεR antagonists .
( 1 ) In a sample of a patient having a mast cell-mediated inflammatory disease, the number of active tryptase alleles less than the reference active tryptase allele number , which is a means for determining the number of active tryptase alleles in the patient, is Means indicating that the patient is likely to respond to the treatment; or
(2) The expression level of tryptase, which is a means for determining the expression level of tryptase in a sample of a patient having a mast cell-mediated inflammatory disease and is lower than the reference level of tryptase in the sample of the patient, is determined. Means to indicate that the patient is likely to respond to the treatment
Kit including .

The kit of claim 6 , wherein the treatment is given to the patient .

A kit for selecting treatment for patients with mast cell-mediated inflammatory disease .
(A) A means for determining the number of active tryptase alleles in a sample of a patient with a mast cell-mediated inflammatory disease.
(I) When the number of active tryptase allelic genes in the patient is equal to or greater than the reference active tryptase allelic gene, tryptase antagonist, IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, protease-activated receptor 2 Treatment with (PAR2) antagonists, or agents selected from combinations thereof , or
(Ii) If the number of active tryptase alleles in the patient is less than the reference number of active tryptase alleles, treatment comprising an IgE antagonist or an FcεR antagonist,
Is the means of choice for the patient; or
(B) A means for determining the expression level of tryptase in a sample of a patient with a mast cell-mediated inflammatory disease.
(I) When the expression level of tryptase in the sample of the patient is equal to or higher than the reference level of tryptase, tryptase antagonist, IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, protease-activated receptor 2 (PAR2). ) Treatments containing agents selected from antagonists or combinations thereof, or
(Ii) Treatment with an IgE antagonist or FcεR antagonist, where the tryptase expression level in the sample of the patient is below the tryptase reference level.
Is the means of choice for the patient
Kit including.

The kit of claim 8 , wherein the treatment selected according to ( b) is given to the patient .

Is it a tryptase antagonist, IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, protease-activated receptor 2 (PAR2) antagonist, or a combination thereof in patients with mast cell-mediated inflammatory disease? A kit for evaluating or monitoring the response to treatment with treatments containing the drugs of choice .
During or after treatment with a drug selected from tryptase antagonists, IgE ⁺ B cell depleting antibodies, mast cell or basophil depleting antibodies, PAR2 antagonists, or combinations thereof for said patients. Including means for determining the expression level of tryptase in a sample of a patient with a mast cell-mediated inflammatory disease at a time point.
The treatment is maintained, adjusted or stopped based on a comparison of tryptase expression levels in the sample with tryptase reference levels.
Changes in the expression level of tryptase in the sample of the patient relative to the reference level indicate a response to treatment with the treatment.
Kit .

The drug according to claim 1.
(I) The number of active tryptase alleles is determined by sequencing the TPSAB1 and TPSB2 loci of the patient's genome ;
(Ii) The number of active tryptase alleles is determined by the following formula: 4-the sum of the number of tryptase α and tryptase βIII frame shift (βIII ^FS ) alleles in the patient's genotype;
(Iii) Tryptase beta III ^FS is detected by detecting the c980_981insC mutation in TPSB2 containing the nucleotide sequence CACACGGTCACCCTGCCCCCTGCCTCAGAGAACCTTCCCCCC (SEQ ID NO: 37);
(Iv) The reference active tryptase allele number is determined in the group of patients with the mast cell-mediated inflammatory disease;
(V) The reference active tryptase allele number is 3;
(Vi) The patient has 3 or 4; or 0.1 or 2 active tryptase alleles:
(Vii) The tryptase is tryptase beta I, tryptase beta II, tryptase beta III, tryptase alpha I, or a combination thereof;
(Viii) The expression level of the tryptase is the expression level of the protein;
(Ix) The expression level of the tryptase is the expression level of mRNA;
(X) The reference level of the tryptase is the level determined in the group of individuals with the mast cell-mediated inflammatory disease; or
(Xi) The sample of the patient is selected from a blood sample, a tissue sample, a sputum sample, a fine bronchial lavage fluid sample, a mucosal coating fluid (MLF) sample, a bronchial adsorption sample, or a nasal absorption sample.
Medicine .

The medicine according to claim 11.
(I) The sequencing is Sanger sequencing or massively parallel sequencing ;
(Ii) The TPSAB1 locus is (a) a first forward primer containing the nucleotide sequence of (a) 5'-CTG GTG TGC AAG GTG AAT GG-3'(SEQ ID NO: 31) and 5'-AGG TCC AGC ACT CAG GAG. Amplifying the nucleic acid of interest to form a TPSAB1 amplicon in the presence of a first reverse primer containing the nucleotide sequence of GA-3'(SEQ ID NO: 32) and (b) sequencing the TPSAB1 amplicon. Sequencing by doing and including methods;
(Iii) A second forward primer containing the nucleotide sequence of (a) 5'-GCA GGT GAG CCT GAG AGT CC-3'(SEQ ID NO: 33) and 5'-GGG ACC TTC ACC TTC. Amplifying the nucleic acid of interest to form a TPSB2 amplicon in the presence of a second reverse primer containing the nucleotide sequence of AG-3'(SEQ ID NO: 34) and (b) sequencing the TPSB2 amplicon. Sequencing by methods including doing;
(Iv) Tryptase alpha is detected by detecting the presence of c733G> A SNP in TPSAB1 comprising the nucleotide sequence CTGCAGGCGGGCGTGGTCAGCTGGG [G / A] CGAGGGCTGCGCCCAGCCAACCGG (SEQ ID NO: 36). Shows tryptase alpha;
(V) The protein expression level of the tryptase is the expression level of active tryptase or the expression level of total tryptase;
(Vi) The mRNA expression level is measured using the polymerase chain reaction (PCR) method or a microarray chip:
(Vii) The reference level for the tryptase is median; or
(Viii) The blood sample is a whole blood sample, a serum sample, a plasma sample, or a combination thereof.
Medicine .

The pharmaceutical according to claim 12.
(I) Sequencing of the TPSB2 amplicon comprises using a first forward primer and a second reverse primer ;
(Ii) Sequencing of the TPSB2 amplicon uses the second forward primer and sequences the reverse primer containing the nucleotide sequence of 5'-CAG CCA GTG ACC CAG CAC-3'(SEQ ID NO: 35). Including singing;
(Iii) The protein expression level is measured using an immunoassay, enzyme-linked immunosorbent assay (ELISA), Western blot, or mass spectrometry;
(Iv) The PCR method is qPCR; or
(V) The blood sample is a serum sample or a plasma sample.
Medicine .

The drug according to claim 1 , wherein the drug is a tryptase antagonist.

The pharmaceutical according to claim 14 , wherein the tryptase antagonist is a tryptase alpha antagonist or a tryptase beta antagonist.

The pharmaceutical according to claim 15 , wherein the tryptase beta antagonist is an anti-tryptase beta antibody or an antigen-binding fragment thereof.

The medicine according to claim 16.
(I) The antibody comprises the following six hypervariable regions (HVR):
(A) HVR-H1, which comprises the amino acid sequence of DYGMV (SEQ ID NO: 1),
(B) HVR-H2, which comprises the amino acid sequence of FISSGSSTVYYADTMKG (SEQ ID NO: 2),
(C) HVR-H3, which comprises the amino acid sequence of RNYDDWYFDV (SEQ ID NO: 3),
(D) HVR-L1, which comprises the amino acid sequence of SASSSVTYMY (SEQ ID NO: 4),
(E) HVR-L2 comprising the amino acid sequence of RTSDLAS (SEQ ID NO: 5) and (f) HVR-L3 comprising the amino acid sequence of QHYHSYPLT (SEQ ID NO: 6) ;
(Ii) A heavy chain variable (VH) domain, wherein the antibody comprises (a) an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 7. b) A light chain variable (VL) domain comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 8, or such as (c) (a). Includes VH domain and VL domain, such as (b);
(Iii) The antibody comprises (a) a VH domain comprising the amino acid sequence of SEQ ID NO: 7, (b) a VL domain comprising the amino acid sequence of SEQ ID NO: 8, or (c) a VH domain comprising the amino acid sequence of SEQ ID NO: 7. Contains a VL domain comprising the amino acid sequence of SEQ ID NO: 8; and / or
(Iv) The antibody comprises (a) a heavy chain comprising the amino acid sequence of SEQ ID NO: 9 and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 10, or (c) a heavy chain comprising the amino acid sequence of SEQ ID NO: 11. (B) Containing a light chain comprising the amino acid sequence of SEQ ID NO: 10.
Medicine .

The pharmaceutical according to claim 14 , wherein the treatment further comprises an IgE antagonist.

The pharmaceutical according to claim 5.
(I) The FcεR antagonist is a Bruton's tyrosine kinase (BTK) inhibitor ; or
(Ii) The IgE antagonist is an anti-IgE antibody.
Medicine .

The medicine according to claim 19.
(I) The BTK inhibitor is GDC-0853, acalabrutinib, GS-4059, spebrutinib, BGB-3111, or HM71224 ; or
(Ii) The anti-IgE antibody is an IgE blocking antibody and / or an IgE depleted antibody.
Medicine .

The pharmaceutical according to claim 20 , wherein the IgE ⁺ B cell depleting antibody is an anti-M1'domain antibody.

The medicine according to claim 19.
(I) The anti-IgE antibody is based on the following six HVRs:
(A) HVR-H1, which comprises the amino acid sequence of GYSWN (SEQ ID NO: 40),
(B) HVR-H2, which comprises the amino acid sequence of SITYDGSTNYNPSVKG (SEQ ID NO: 41),
(C) HVR-H3, which comprises the amino acid sequence of GSHYFGHWHAV (SEQ ID NO: 42),
(D) HVR-L1, comprising the amino acid sequence of RASQSVDYDGDSYMN (SEQ ID NO: 43),
(E) HVR-L2 containing the amino acid sequence of AASYLES (SEQ ID NO: 44), and
(F) HVR-L3 containing the amino acid sequence of QQSHEDPYT (SEQ ID NO: 45).
Including ;
(Ii) A heavy chain variable (VH) domain in which the anti-IgE antibody comprises (a) an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 38. , (B) a light chain variable (VL) domain comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 39, or (c) (a). VH domains such as and VL domains such as (b);
(Iii) The anti-IgE antibody comprises (a) a VH domain comprising the amino acid sequence of SEQ ID NO: 38, (b) a VL domain comprising the amino acid sequence of SEQ ID NO: 39, or (c) a VH comprising the amino acid sequence of SEQ ID NO: 38. A VL domain comprising the domain and the amino acid sequence of SEQ ID NO: 39; and / or
(Iv) The anti-IgE antibody is omalizumab or XmAb7195.
Medicine .

The pharmaceutical according to claim 4.
(I) The type 2 biomarker is a TH 2 cell-related cytokine, periostin, eosinophil count, eosinophil signature, _FeNO , or IgE ; and / or.
(Ii) The _TH 2 pathway inhibitor is interleukin 2-inducible T cell kinase (ITK), Breton-type tyrosine kinase (BTK), Janus kinase 1 (JAK1), GATA-binding protein 3 (GATA3), IL-9. , IL-5, IL-13, IL-4, IL-33, OX40L, TSLP, IL-25, IL-9 receptor, IL-5 receptor, IL-4 receptor alpha, IL-13 receptor alpha 1. Inhibits IL-13 receptor alpha 2, OX40, TSLP-R, IL-7R alpha, IL-17RB, ST2, CCR3, CCR4, CRTH2, Flap, Syk kinase, CCR4, TLR9, or GM-CSF.
Medicine .

The drug according to claim 1.
(I) Additional therapeutic agents are administered to the patient; and / or
(Ii) The mast cell-mediated inflammatory disease includes asthma, atopic dermatitis, chronic urticaria (CSU), systemic anaphylaxis, mast cell disease, chronic obstructive pulmonary disease (COPD), and idiopathic pulmonary fibrosis (i). IPF), or eosinophilic esophagitis,
Medicine .

The medicine according to claim 24.
(I) The additional therapeutic agent is a corticosteroid, an IL-33 axis binding antagonist, a TRPA1 antagonist, a bronchial dilator or an asthma symptom inhibitor, an immunomodulator, a tyrosine kinase inhibitor, or a phosphodiesterase inhibitor . Or
(Ii) The asthma is moderate to severe asthma; not controlled by corticosteroids; and / or _TH 2-high or TH ₂ -low asthma.
The medicine according to claim 24 .

A mast that is likely to respond to treatments containing tryptase antagonists, IgE + B cell depleting antibodies, mast cell or basophil depleting antibodies, protease-activated receptor 2 (PAR2) antagonists, or agents selected from these combinations. A kit for identifying patients with cell-mediated inflammatory diseases ,
(A) Reagents for determining the number of active tryptase alleles in the patient or, optionally, the expression level of tryptase in the patient's sample.
(B) Mast cell mediated that is likely to respond to treatments comprising tryptase antagonists, IgE + B cell depleting antibodies, mast cell or basophil depleting antibodies, PAR2 antagonists, or agents selected from these combinations. A kit comprising instructions for using the reagent to identify a patient with an inflammatory disease.

A kit for identifying patients with mast cell-mediated inflammatory diseases who are likely to respond to treatment with IgE antagonists or FcεR antagonists .
(A) Reagents for determining the number of active tryptase alleles in the patient or, optionally, the expression level of tryptase in the patient's sample.
(B) Instructions for using the reagent to identify patients with mast cell-mediated inflammatory diseases who are likely to respond to treatment with IgE antagonists or FcεR antagonists.
Including , kit .