WO2014049177A1

WO2014049177A1 - Method for diagnosing igg4 related diseases

Info

Publication number: WO2014049177A1
Application number: PCT/EP2013/070384
Authority: WO
Inventors: Marieke DOORENSPLEET; Lucas Joseph MAILLETTE DE BUY WENNIGER; Ulrich BEUERS; Niek DE VRIES
Original assignee: Academisch Medisch Centrum Bij De Universiteit Van Amsterdam
Priority date: 2012-09-30
Filing date: 2013-09-30
Publication date: 2014-04-03

Abstract

The invention provides a method of determining the risk of suffering from or developing an IgG4-related systemic disease in a subject comprising the steps of determining in a biological sample from said subject the number and/or frequency of IgG4 positive BCR clones, and determining the risk of suffering from or developing an IgG4- related systemic disease based on said number of IgG4 positive BCR clones, wherein an increase of said number of IgG4 positive BCR clones and/or a higher frequency of at least one IgG4 positive BCR clone compared to a healthy control indicates an increased risk. In a preferred embodiment, said increased risk is indicated when at least 0.5% of the total number of BCR clones is an IgG4 positive BCR clone.

Description

TITLE: METHOD FOR DIAGNOSING IGG4 RELATED DISEASES

TECHNICAL FIELD OF THE INVENTION

The invention relates to methods of diagnosing or prognosticating. In particular, it relates to the diagnosis and prognosticating IgG4-related systemic diseases.

BACKGROUND OF THE INVENTION

IgG4-related systemic disease (ISD) is a common denominator for incompletely understood organ abnormalities associated with IgG4+ plasma cell infiltrates and/or elevated serum IgG4 titers ^{1 5}. Although the list of possibly affected organs in ISD is expanding, the pancreas and biliary tree are considered to be among the most frequently involved localizations. Despite the fact that many patients have elevated IgG4 serum titers, and/or infiltrating IgG4+ plasma cells in the affected tissue, the role of IgG4 antibodies in the pathogenesis is largely unknown and the specificity of serum IgG4 as a bio marker disputed ^{6 7}. This is mainly due to the low sensitivity and limited specificity of this biomarker when serum IgG4 is only mildly elevated. Furthermore, it was reported that ~10- 20% of patients suffering from auto-immune pancreatitis (AIP) do not have elevated serum IgG4 levels (Kamisawa T et al. Serum IgG4-negative autoimmune pancreatitis. J

Gastroenterol 2011 ;46: 108- 116), and similar percentages were suggested for

Immunoglobulin G4-associated cholangitis ( IAC) cohorts (Ghazale A et al.

Immunoglobulin G4-associated cholangitis: clinical profile and response to therapy.

Gastroenterology 2008;134:706-715). In addition, the presence of substantial numbers of IgG4+ cells is not a specific, diagnostic biomarker for IgG4-related systemic disease, as IgG4+ cells can be found in many more inflammatory infiltrates. Finally, there is no clear relation between the extent of serum IgG4 elevation and the severity of symptoms, and in patients undergoing generally accepted treatment regimens, serum IgG4 may rise to levels above the upper limit of normal even in the prolonged absence of symptoms.

Therefore, the limitations of the use of IgG4 serum levels make it difficult to distinguish patients with IgG4-related disease from patients with diseases that cause similar symptoms, such as patients with pancreaticobiliary cancer or primary sclerosing cholangitis (in case of biliary IgG4-reated disease). As a result, many patients are not adequately and timely diagnosed with IgG4-related disease resulting in delay of correct diagnosis, or in inadequate treatment and under- or overtreatment (including major surgery causing unnecessary iatrogenic morbidity and possibly even risking mortality). Therefore, a need exists to identify an improved biomarker for the diagnosis and/or disease activity of ISD, for example with a better specificity and/or sensitivity. SUMMARY OF THE INVENTION

The invention provides a method of determining the risk of suffering from or developing an IgG4-related systemic disease in a subject comprising the steps of determining in a biological sample from said subject the number and/or frequency of IgG4 positive BCR clones, and determining the risk of suffering from or developing an IgG4- related systemic disease based on said number of IgG4 positive BCR clones, wherein an increase of said number of IgG4 positive BCR clones and/or a higher frequency of at least one IgG4 positive BCR clone compared to a healthy control indicates an increased risk. In a preferred embodiment, said increased risk is indicated when at least 0.5% of the total number of BCR clones is an IgG4 positive BCR clone. In another preferred embodiment, said increased risk is indicated when at least 1% of the total number of IgG positive BCR clones is an IgG4 positive BCR clone. In another preferred embodiment, said increased risk is indicated when at least one, more preferably 2 of the 25 most abundant BCR clones is an IgG4 positive BCR clone. More preferably, said increased risk is indicated when at least one, preferably 2 of the 10 most abundant BCR clones is an IgG4 positive BCR clone.

Preferably, said increased risk is indicated when the most abundant IgG positive

BCR clone is IgG4 positive. Preferably, said biological sample is a peripheral blood sample. Preferably, said number of BCR clones is determined using Next-generation sequencing. In a preferred embodiment, said IgG4-related systemic disease is IgG4 associated cholangitis.

In a preferred embodiment of the method according to the invention, said step wherein in said biological sample from said subject the number and/or frequency of IgG4 positive BCR clones is determined, comprises obtaining either the cDNA from the mRNA expressed from said biological sample or the genomic DNA extract of said biological sample, and performing the amplification of the cDNA obtained in said step with a set of IGHV forward primers capable of specifically hybridizing in stringent conditions with the nucleic acids encoding the variable segments (VH) of immunoglobulin heavy chains and a CH reverse primer, capable of specifically hybridizing in stringent conditions with the nucleic acid encoding the constant segment (IGHC) of the IgG4 type of an

immunoglobulin heavy chain, and determining the number and frequency of the IgG4 positive BCR clones. Preferably, said set of IGHV forward primers contains a primer having a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, and wherein said CH reverse primer has the nucleic acid sequence SEQ ID NO. 9.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows that IgG4+ clones are dominant in blood of IgG4-associated cholangitis (IAC), but not in healthy (HC) or disease (DC) controls (being patients with primary sclerosing cholangitis and pancreaticobiliary cancer).

Figure 1A shows the contribution of individual clones to the IgG+ BCR 10 repertoire in all individuals. The scatterplot shows clonal abundance as percentage of the IgG+ BCR repertoire in IAC and DC as compared to HC (each dot represents an individual clone, IgG4+ clones are marked as inverted triangles) (1-way ANOVA p=0.20).

Figure IB shows the mean rank of the most dominant IgG4+ clone within the IgG+ 15 repertoire in all three groups (IAC vs. HC vs. DC) (1-way ANOVA p=0.001, ** p=0.001).

Figure 1C shows the distribution of IgG subtypes as percentage of the total IgG subset in all three groups (IAC vs. HC vs. DC).

Figure ID shows HC vs. DC).

Figure 2 shows that BCR clones overlap between peripheral blood and duodenal papilla tissue in IAC patients.

Figure 2A shows the contribution of individual clones to the IgG+ BCR repertoire in peripheral blood taken during biopsy sampling (-6 weeks) as well as 6 weeks later before the start of therapy (baseline), and affected tissue. The scatterplot shows clonal abundance as percentage of the IgG+ BCR repertoire (each dot represents an individual clone). IgG4+ clones are marked using shapes other than filled dots, identical shapes (e.g. inverted triangles) in both compartments represent identical clones.

Figure 2B is a XY-plot showing the frequency of overlapping clones in tissue (papilla biopsy) and peripheral blood at the time of biopsy sampling (- 6 weeks). Every dot represents an overlapping clone. Filled dots represent non-IgG4+ clones, IgG4+ clones are marked using symbols other than filled dots.

Figure 2C is a XY-plot showing the frequency of overlapping clones in tissue and peripheral blood after clearing the infection (baseline). Every dot represents an overlapping clone. IgG4+ clones are marked using symbols other than filled dots. Figure 2D shows the contribution of individual clones to the IgG+ BCR repertoire in affected tissue (biopsy) and paired peripheral blood (blood). The scatterplot shows clonal abundance as percentage of the IgG+ BCR repertoire (each dot represents an individual clone). IgG4+ clones are marked using shapes other than filled dots, identical shapes (e.g. inverted triangles) in both compartments represent identical clones.

Figure 2E is a XY-plot showing the frequency of overlapping clones in tissue and peripheral blood. Every dot represents an overlapping clone. IgG4+ clones are marked using symbols other than filled dots.

Figure 3 shows that high-dose corticosteroid therapy rapidly improves serum liver tests and suppresses serum IgG4 levels accompanied by regression of dominant IgG4+ clones, while leaving serum total IgG relatively unchanged. Mirroring clear improvement in clinical symptoms, biochemical abnormalities in IAC patients decrease under high-dose cortocosteroid therapy.

Figure 3A shows the decrease of both alkaline phosphatase, yGT, ALAT, ASAT as well as total bilirubin levels. ULN=Upper Limit of Normal.

Figure 3B shows a rapid decline of serum IgG4 after inception of therapy, while serum total IgG remains relatively untouched. ULN=Upper Limit of Normal.

Figure 4 shows that corticosteroid-induced response to therapy is accompanied by regression of dominant IgG4+ clones.

Figures 4A-B show the percentage of the total BCR repertoire taken up by IgA+, IgD+, IgM+ and IgG+ clones at baseline (A) as well as after 4 weeks of treatment (B, also representative picture for the 8 weeks time point). The different IgG subtypes are plotted as percentage of the total IgG subset.

Fig. 4C shows the mean rank of the most dominant IgG4+ clone within the IgG+ repertoire at baseline, and 4 and 8 weeks after treatment (1-way ANOVA p<0.0001 , *** pO.0001).

Figure 4D shows The number of overlapping clones after 4 and 8 weeks of treatment (percentage of the total number of clones), compared to the repertoire at baseline. Clones with a frequency of 1 : 10.000 were excluded to minimize disturbances by random sampling effects.

Figure 4E shows the contribution of individual clones to the IgG+ BCR repertoire in a patient suffering from disease relapse. The scatterplot shows clonal abundance as percentage of the IgG+ BCR repertoire (each dot represents an individual clone, IgG4+ clones are marked as inverted triangles). Figure 5 shows that IgG4⁺ clones are dominant in blood of IgG4-associated cholangitis (IAC), but not in healthy (HC) or disease (DC) controls.

Figure 5(A) shows the contribution of individual clones to the total BCR repertoire in all individuals (including IgA+, IgD+, IgG+ and IgM+ clones). The scatterplot shows clonal abundance as percentage of the IgG+ BCR repertoire (each dot represents an individual clone, IgG4+ clones are marked as triangles).

Figure 6 shows a graphical representation of the experimental procedures workflow. Samples were collected from peripheral blood or tissue and mRNA was isolated and cDNA was synthetized for downstream application. A linear amplification was performed, using a primer set covering all functional IGHV genes. This product was then used either for the determination of the total BCR repertoire (V-CDR3-J amplification) or for the subtyping of individual clones (V-CDR3-C amplification). For the former, a PCR using primerB as a forward primer and a generic primer specific for all functional Jheavy genes containing the primerA as reverse primer was performed. For the latter, the Ig isotypes were determined using primerB as a forward primer, and primers specific for the IgA, IgD, IgM and IgG isotype as reverse primers. Sequencing was performed on both pools of sequences (both V- CDR3-J and V-CDR3-C) according to the manual for 454 amplicon sequencing on a genome sequencer FLX (using primerA and primeB sequences). Using custom-made bioinformatics algorithms, the frequencies of individual clones were determined based on their unique VDJ rearrangement and CDR3 sequence and matched with their isotype and subclass characteristics.

Figure 7 shows the results of qPCR to determine the ratio between specific IgG4 mRNA levels and total IgG mRNA levels (ACT) in peripheral blood of patients suffering from IgG4-related disease (IgG4-RD), compared to diseased controls {DC) and healthy individuals {HC).

Figure 7A shows the ROC curve plotting the sensitivity and 1 -specificity for different cut-offs of the AGr. This shows that - in this cohort - a ACT value of 5.13 (the red star) would be the best cut-off to distinguish between patients suffering from IgG4-related disease and patients with other diseases but comparable complaints.

Figure 7B shows the AC_T values in IgG4-RD (n=22), DC (n=7) and as a reference HC (n=6). This shows that the IgG4-RD group has a significantly lower AC_T compared to DC and HC (one-way A OVA including Bonferroni post-test, **** = p<0.00001, *** = p<0.0001). The dotted line marks the cut-off of 5.13 as chosen based on the ROC curve.

Figure 7C shows the different predictive values of the test when applying the cut-off of 5.13 AC_T based on the ROC curve (1^st column) as well as the 95% confidence intervals (2^nd and 3^rd columns).

DETAILED DESCRIPTION OF THE INVENTION

Definitions

The term "IgG4-related systemic disease (IgG4-RSD)" as used herein (also known as IgG4-related disease (IgG4-RD), hyper-IgG4 disease) refers to an inflammatory condition characterized by one or more of the following: a dense lymphocytic infiltrate (in particular IgG4+ plasma cells), tumefactive laesions, storiformfibrosis, depositions of Immunoglobulin G4 in one or more organs, and elevated IgG4 serum titers.

IgG4-related systemic diseases include, but are not limited to, cholangitis (also known as IgG4-associated cholangitis or IgG4-related cholangitis), autoimmune pancreatitis, IgG4-associated kidney disease, IgG4-related prostatitis, IgG4-related lung disease, IgG4-related intestinal disease, IgG4-related nasal polyps, IgG4-related orbital pseudotumor, retroperitoneal fibrosis, mediastinal fibrosis, Riedel's thyroiditis, Mikulicz's syndrome, Kuttner's tumor and inflammatory pseudotumor. The symptoms of IgG4-RSD may vary by the organ affected. For IgG4-associated cholangitis and/or IgG4-associated autoimmune pancreatitis typical symptoms include jaundice, itch, weight loss, dry skin, pale stools, brown urine, fatigue, ascites, diabetes mellitus. A non-limiting list of symptoms of IAC is provided in table 4.

The term "BCR clone" as used herein refers to one or more B cells or plasma cells expressing the same unique VDJ rearrangement of the heavy chain encoding the heavy chain of a B cell receptor. B cells or plasma cells belonging to a certain BCR clone have the same antigen specificity. B cells or plasma cells sharing the same B-cell receptor belong to the same BCR clone. The term "frequency of a BCR clone" as used herein refers to the relative number, including a percentage or a fraction of a larger population of B cells and/or plasma cells belonging to a certain BCR clone. A BCR clone is considered more abundant compared to another B cell clone in case said BCR clone has a higher frequency when compared to said other BCR clone isolated from the same or a comparable biological sample. For the sake of completeness, the frequency of a BCR clone can be expressed as a percentage of the total BCR repertoire, by dividing the number of times that this clone's unique signature is detected over the total number of individual signatures detected in the biological sample and then multiplying by 100. E.g. if an unique BCR clone is detected 100 times in a sample, and a total of 10.000 individual BCR sequences are detected, the frequency as a percentage is 100/10000 x 100 = 1% in the particular sample.

The term "BCR repertoire" of a certain biological sample as used herein refers to the ensemble of different BCR sequences detected in the biological sample.

The term "IgG4 positive BCR clone" as used herein refers to a B cell clone having in its genome a rearranged VDJ gene and a constant domain (CH) expressing the G4 subtype, encoding a B cell receptor of the IgG4 subtype. The IGHC domain of an IgG4 positive BCR clone is therefore of the IgG4 type.

The term "Next-generation sequencing" (NGS) as used herein refers to sequencing technologies that have the capacity to sequence polynucleotides at speeds that were unprecedented using conventional sequencing methods (e.g., standard Sanger or Maxam- Gilbert sequencing methods). These unprecedented speeds are achieved by performing and reading out millions of sequencing reactions in parallel. NGS platforms include, but are not limited to, the following: Massively Parallel Signature Sequencing (Lynx Therapeutics); 454 pyro-sequencing (454 Life Sciences/Roche Diagnostics); solid-phase, reversible dye- terminator sequencing (Solexa/Illumina); SOLiD technology (Applied Biosystems); Ion semiconductor sequencing (Ion Torrent); and DNA nanoball sequencing (Complete

Genomics). Descriptions of certain NGS platforms can be found in the following: Shendure, et al, "Next-generation DNA sequencing," Nature, 2008, vol. 26, No. 10, 1135-1145;

Mardis, "The impact of next-generation sequencing technology on genetics," Trends in

Genetics, 2007, vol. 24, No. 3, pp. 133-141; Su, et al, "Next-generation sequencing and its applications in molecular diagnostics" Expert Rev Mol Diagn, 2011, 11(3):333-43;

"Sequencing technologies the next generation" by Michael Metzker, Nat Rev Genetics January 2010; and Zhang et al., "The impact of next-generation sequencing on genomics", J Genet Genomics, 2011, 38(3):95-109. The term "IGHV" refers to the ImmunoGlobulin heavy chain Variable cluster (IGHV@, encoded on chromosome 14q32.33, MIM: 147070 accessible via

http://omim.org/entry/147070) encoding the V-genes of the heavy chain.

The term "IGHC" refers to the Immunoglobulin Heavy chain Constant region, being the loci encoding the alpha (IGHA), delta (IGHD), epsilon (IGHE), gamma (IGHG) and mu (IGHM) globulins, and their individual subtypes (all encoded on chromosome 14q32.33,

MIMs: 146900, 147000, 146910, 147170, 147180, 147100, 147110, 147120, 147130, 147020, accessible via http://omim.org).

Embodiments

Method for prognosticating the risk of developing or diagnosing an IgG4-related systemic disease

The invention relates to a method of prognosticating the risk of developing an IgG4- related systemic disease in a patient or of diagnosing an IgG4-related systemic disease in a patient. The method is based on the surprising finding that the presence of a highly abundant BCR clone capable of producing antibodies (both membrane-bound as well as secreted) having the IgG4 encoding constant gene of the heavy chain is indicative of IgG4- RSD. This is in contrast to the presence of elevated IgG4 serum levels, which were also found in a substantial percentage of the analyzed patients with primary sclerosing cholangitis (PSC) and pancreaticobiliary cancer and which can be within normal limits in a proportion of patients with IgG4-RSD. Hence, the presence of a highly abundant IgG4 positive BCR clone is a more specific biomarker for diagnosis and prognosis of IgG4-RSD.

The inventors investigated whether IgG4+ BCR clones can be identified in blood and affected tissue in IgG4-associated cholangitis (I AC). Using a novel next-generation sequencing approach to sequence the B-cell receptor repertoire for IgG4+ clones, they found highly dominant IgG4+ clones in IAC but not in healthy or in disease controls. Upon high-dose corticosteroid treatment, these dominant clones were marginalized, contrary to the rest of the repertoire which remained relatively stable despite therapy. Both the numbers of IgG4+ BCR clones as well as their individual frequency in peripheral blood are unique features of IgG4-related systemic diseases.

The method according to the invention comprises the step of determining in a biological sample from said subject the number and/or frequency of IgG4 positive BCR clones. Said biological sample may be any biological sample containing B cells and/or plasma cells, including but not limited to blood, synovial fluid, lymphoid fluid, cerebrospinal fluid, bronchoalveolar lavage fluid, saliva and peritoneal cavity fluid.

Preferably, said biological sample is a peripheral blood sample. It is important that said biological sample contains a sufficient number of B cells and/or plasma cells in order to achieve statistically reliable results. Therefore, it is preferred that said biological sample contains at least 1000 B cells and/or plasma cells. Even more preferably at least 10.000, 25,000, 50,000, 100,000, 250,000, 500,000, 1,000,000 or 5,000,000 B cells and/or plasma cells.

Subsequently, diagnosis of an IgG4-related systemic disease can be made based on said number or frequency of IgG4 positive BCR clones. An increase in the number of said

IgG4 positive BCR clones in comparison to the number in a healthy control is indicative of an increased risk. An increase in the frequency of IgG4 positive BCR clones in comparison to the frequency of IgG4 positive BCR clones in a healthy control is also indicative of an increased risk. To achieve a good sensitivity or specificity of the method, it is preferred that at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0 % of the total number of BCR clones is an IgG4 positive BCR clone.

In another preferred embodiment, the frequency of an IgG4 positive BCR clone is compared to the frequency of the total number of BCR clones of the IgG type or to the total number of BCR clones in general. It is preferred that in order to achieve a good sensitivity and specificity of the method that at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 % of the total number of

IgG BCR clones is an IgG4 positive BCR clone.

In a preferred embodiment, the most abundant BCR clones are ranked according to their frequency in a biological sample. A high ranking is indicative of an increased risk.

Therefore, in a preferred embodiment, an IgG4 positive BCR clone which ranks at least as number 20, but more preferably as number, 19, 18, 17, 16, 15, 14, 13, 12, 10, 9, 8, 7, 6, 5, 4,

3, 2 and most preferably as number 1 of the most frequent IgG positive BCR clones, is indicative of an increased risk.

In a preferred embodiment, at least one, preferably 2, 3, 4 or 5 of the 25 most abundant BCR clones is an IgG4 positive BCR clone. Even more preferred is a method according to the invention, wherein an increased risk is indicated when at least one, preferably 2, 3, 4 or 5 of the 10 most abundant BCR clones is an IgG4 positive BCR clone.

In a preferred embodiment, it is preferred that at least 500 different BCR clones are analyzed, as this results in improved sensitivity and/or specificity. Determining the number and frequency of an IgG4+BCR clone

In principle, any method for determining the number of IgG4+ BCR clones in a biological sample may be used. The number of different B cell receptors in a biological sample indicates the number of different BCR clones in the sample. The number of different BCR clones can therefore be established by any method which uniquely identifies a B cell receptor, or the rearranged nucleotide sequences comprising at least the CDR3 region and the heavy-chain encoding said B cell receptor or a part thereof which enables the identification of the BCR clones of the IgG4 subclass. In a preferred embodiment, the nucleic acid sequence of at least the CDR3 region and the IGHV and IGHC genes is determined.

In an alternative embodiment, the number of IgG+ BCR clones is determined by performing a cell-sort of IgG positive cells using anti-human IgG antibodies (such as described in Shen PUF, Fuller SG, Rezuke WN, Sherburne BJ, DiGiuseppe JA. Laboratory, morphologic, and immunophenotypic correlates of surface immunoglobulin heavy chain iso type expression in B-cell chronic lymphocytic leukemia. Am J Clin Pathol

2001;116:905-12), preferably by FACS, and establish the nucleic acid sequence of at least the CDR3 region and the IGHC-region encoding the IgG4-constant region of those cells. The number of different CDR3 nucleic acid sequences with an IgG4 rearrangement identified indicates the number of IgG4+ BCR clones within the IgG population. Suitable PCR methods are described for example in US2002/0110807 Al, examples 1-3.

In an another embodiment, IgG+ B-cells and plasma cells of a biological sample are sorted (preferably by FACS) as described above, followed by mRNA isolation of these IgG+ B-cells and plasma cells and transcriptome sequencing, preferably using a next- generation sequencing platform. The transcriptome sequences that include at least the CDR3 region as well as the IGHC-region encoding the IgG4-constant region, or a part thereof which enables the identification of the BCR clones of the IgG4 subclass, are then collected, thus providing a list of the individual BCR sequences detected in the biological sample. This list of identified BCR sequences forms the BCR repertoire of the biological sample. By assessing the frequency of individual unique BCR sequences in the BCR repertoire, the frequency of unique BCR clones in said biological sample is determined.

Any method to establish whether a BCR clone is of the IgG4 subclass may be used. A B-cell receptor of the IgG4 subclass can suitably be detected based on the nucleic acid sequence of the CHI domain of the C-gene segment of the heavy chain (as published online at e.g. http://www.imgt.org/IMGT_GENE-DB/GENElect?livret=0). In a preferred embodiment of the invention, the method comprises the steps of obtaining either the cDNA from the mRNA expressed from the biological sample or the genomic DNA extract of the biological sample. Subsequently, the obtained cDNA or the genomic DNA extract is subjected to amplification using a set of IGHV forward primers capable of specifically hybridizing in stringent conditions with the nucleic acids encoding the variable gene segments (VH) of immunoglobulin heavy chains and a CH reverse primer capable of specifically hybridizing in stringent conditions with the nucleic acid encoding the constant segment (CH) of the IgG4 type of an immunoglobulin heavy chain using forward and reverse primers. Preferably, a primerset for the amplification of the JH or CH gene segments is used to amplify all possible immunoglobulin isotypes (preferably using the primer sequences as shown in Table 2). An advantage thereof is that sequence information of all BCR clones is gathered, which can be used to determine the frequency of a specific IgG4+ B cell clone within the total number of BCR clones.

Preferably, said amplification step is followed by Next-Generation Sequencing of the amplified nucleotides comprising at least the CDR3 region and the CH domain (CHI) coding for IgG4 or a part thereof which enables the identification of the BCR clones of the IgG4 subclass. Based on the number of unique CDR3 sequences, the number of unique BCR clones can be established. Based on the number of unique IgG4+ BCR clones and the total number of unique BCR clones, the frequency of said IgG4+ BCR clones can be determined. An increase in the frequency of IgG4+ BCR clones in the total number of BCR clones in a biological sample of a subject compared to the frequency of IgG4+ BCR clones in a healthy control indicates a higher risk. It is preferred that also the frequency of the unique IgG4+ BCR clones is determined. The inventors have found that the presence of a highly abundant IgG4+ BCR clone is indicative of a higher risk of suffering from IgG4-

RSD or an increased risk of developing IgG4-RSD. The frequency of a unique IgG4+ BCR clone is preferably determined by determining the amount of amplified sequences of a specific IgG4+ BCR clone and compare said number with the total number of amplified sequences, preferably of all IgG+ BCR clones. Quantifying the amount of amplified material is preferably be done by using fluorospectometry. This technique is well known in the art. By quantifying the amount of the fluorescent label incorporating in double-stranded DNA, the amount of amplified material can be determined.

In a preferred embodiment, said method of the invention is performed comprising the following steps. The obtained cDNA or the genomic DNA is subjected to linear amplification of the complete immunoglobulin heavy-chain repertoire using a primer set covering all functional IGHV genes of the B-cell receptor (preferably using the primer sequences in Table 1). The IGHV-primers preferably contain a primerB sequence as provided in Table 3 required for Amplicon sequencing, preferably according to the 454 titanium protocol (version 2010) (Roche Diagnostics, Mannheim, Germany). Optionally, amplified products are purified, preferably using AMPure XP SPRI-beads (#A63881 , Agencourt-Bioscience, Beverly, MA, USA), preferably in a template:bead ratio of around 1 : 1. After cleaning the cleaned product, it is used in a PCR using primer (according to the 454 Titanium protocol for amplicon sequencing) as forward primer and a generic primer specific for all functional IGHJ genes comprising the primerA as reverse primer, preferably having the SEQ ID NO 12 as provided in Table 3. In an alternative embodiment, an additional primerset is used for the amplification of the IGHC gene segments to analyze preferably all possible immunoglobulin isotypes, preferably using any of the primer sequences selected from Table 2). These primers all comprise the primerA sequence and can therefore be used as a substitute for the IGHJ primer. After amplification, samples are preferably purified, preferably using the AMPure beads and quantified using

fluorospectometry (preferably using Qubit in combination with Quant-iT dsDNA HS Assay Kit (#Q32851 , Invitrogen-LifeTechnologies, USA). Samples are subsequently prepared for sequencing. Sequencing is preferably performed on a next-generation sequencing platform (for example on a Roche Genome Sequencer FLX using the Titanium platform). For each sample preferably at least 40,000 (bead-bound) BCR sequences are analyzed.

In an alternative embodiment, the obtained cDNA can be used in a quantitative PCR (qPCR), using the primer sequences in Table 3, to determine the amount of specific IgG4 mRNA compared to the total amount of IgG mRNA in any given sample. The alternative method of the invention is preferably performed comprising the following steps. The cDNA from the mRNA expressed from said biological sample is used for quantitative PCRs using a generic IgG forward primer, and either a specific IgG4 reverse primer (reaction 1), preferably having SEQ ID NO. 17, or a generic IgG reverse primer (reaction 2), preferably having the sequence according to any Table 3. Preferably an equivalent of 25ng mRNA is used per reaction, and both reactions are preferably performed in triplicate. The qPCR reactions are preferably used in the presence of CYBR green, and preferably in a total volume of 20μΙ_^ per reaction, for preferably 40 PCR cycles. For all individual reactions the cycle threshold (CT) value can be determined and the mean can be calculated for specific IgG4 mRNA as well as total IgG mRNA. The ACT value can be calculated by determining the difference between the mean CT value for specific IgG4 mRNA and the mean CT value for total IgG mRNA. A ACT value of 5.13 or lower is predictive of an IgG4 related disease.

The reverse primer for the amplification of specific IgG4 mRNA having SEQ ID NO: 17 is unique in the sense that it has the ability to amplify specifically based on 2-base specific region in CHI of the B-cell receptor heavy chain at which the primer has to dock to be able to amplify. The IgG reverse primer docks in this same CHI region 36 bases downstream of the specific IgG4 primer on a region which is identical for all different IgG isotypes (all alleles). This results in comparable amplification conditions but still enables the separation of the two amplification products based on their length.

The above disclosure generally describes the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this invention belongs. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention.

Table 1 primer SEQ ID NO. Nucleotide sequence

IGHV2 SEQ ID NO. 1 5' - GCTGACCTGCACCTTCTCT - 3'

IGHV3 SEQ ID NO. 2 5' - ACTCTCCTGTGCAGCCTCTG - 3'

IGHV4 SEQ ID NO. 3 5' - CCTGTCCCTCACCTGCACT - 3'

IGHV5 SEQ ID NO. 4 5' - GATCTCCTGTAAGGGTTCTGGATAC - 3'

IGHV6 SEQ ID NO. 5 5' - TCTCACTCACCTGTGCCATCT - 3'

IGHV1 , IGHV7 SEQ ID NO. 6 5' - AGGTTTCCTGCAAGGCTTCT - 3'

Table 2 primer SEQ ID NO. Nucleotide sequence

IGHC-a SEQ ID NO. 7 5' - GAGGCTCAGCGGGAAGACCTT - 3'

IGHC-δ SEQ ID NO. 8 5' - TGTCTGCACCCTGATATGATG - 3'

IGHC-γ SEQ ID NO. 9 5' - GGGAAGWAGRCCTTGACCAG - 3'

IGHC-μ SEQ ID NO. 10 5' - CAGGAGAGAGTGATGGAGTCG - 3'

IGHJ SEQ ID NO. 11 5' - CTTACCTGAGGAGACGGTGACC- 3'

W=A/T and R=A/G

Table 3

primer SEQ ID NO. Nucleotide sequence

GS FLX Titanium SEQ ID NO. 12 5' -CGTATCGCCTCCCTCGCGCCA-3'

Primer A

GS FLX Titanium SEQ ID NO. 13 5' -CTATGCGCCTTGCCAGCCCGC-3'

Primer B

IGHGtotal forw75 SEQ ID NO. 14 5' - GCTGCCTGGTCAAGGACTAC - 3'

IGHGtotal rev288 SEQ ID NO. 15 5' - TCTTGTCCACCTTGGTGTTG - 3'

IGHG1 rev263 SEQ ID NO. 16 5' - CTTGTGATTCACGTTGCAGA - 3'

IGHG4 rev255 SEQ ID NO. 17 5' - CTACGTTGCAGGTGTAGGTCTTC - 3' Table 4: characteristics of the cohort of patients with I AC participating in the study

EXAMPLE SECTION

The inventors used novel next-generation sequencing (NGS) technology to screen the B-cell receptor (BCR) heavy-chain repertoire in IAC patients, and fingerprint individual clones. The inventors prospectively included six patients meeting the HISORt criteria for IAC with or without concurrent autoimmune pancreatitis before and during immunosuppressive treatment (Table 3). Four patients were included upon diagnosis; the fifth was included during relapse on low-dose corticosteroid therapy. The sixth patient was only diagnosed five years after the start of symptoms and included two years after diagnosis, at which point the patient already suffered from cirrhotic complications due to the initially uncontrolled disease. As control groups the inventors analyzed the blood of healthy age-/sex-matched individuals (HC) (n=6), and disease controls (DC) (primary sclerosing cholangitis (n=3) and pancreaticobiliary malignancy (n=3)).

First the inventors screened for IgG+ clones within the total BCR repertoire in peripheral blood to evaluate the presence of IgG4+ BCR clones in this IgG+ compartment. In each patient/control the inventors sequenced 10,000 BCRs yielding 3955 clones (range 1954-7277, similar in HC/DC). Equal numbers of IgG+ clones were recovered in all 3 groups (compared to HC (100%): 116.0% in IAC and 120.8% in DC, p=0.20) (Figure 1A). Of this IgG subset, the most dominant clones (as percentage of the total repertoire) were IgG4+ in IAC, which was not the case in HC or DC (Figures IB). This is reflected in the rank of the most dominant IgG4+ clone; 1st in IAC versus 88th in HC (p<0.005) and 65th in DC (p<0.005) (Figure 1C). Moreover, in IAC 9.4% of the IgG+ clones expressed IgG4 (compared to 0.13% in HC (p<0.005) and 0.15% in DC (p<0.005) (Figure ID)) and these IgG4+ clones together occupy 30.1% of the IgG+ BCRs (1.4% in HC and 1.2% in DC (Figure IE)). Even when regarding the full IgA, IgD, IgM and IgG repertoire, IgG4+ clones are found among the top 10 expanded clones in IAC (Suppl. Figure 1).

Collectively, these data showed that IgG4+ B-cell clones are present as dominant clones in IAC, but not in healthy as well as diseased controls. These IgG4+ clones are not only dominant, but also present in greater numbers, together occupying a larger part of the repertoire in IAC.

As highly dominant IgG4+ clones are present in the peripheral blood of IAC patients specifically suggesting a role in the pathogenesis of the disease, one would expect to recover these clones in the inflamed tissue as well. To this end, the inventors investigated whether dominant IgG4⁺ clones in peripheral blood represent the cellular infiltrate in the inflamed tissue. From two patients (IAC4 and IAC5) suffering from intermittent cholestasis, duodenal papilla biopsies were collected during stent replacement (together with paired peripheral blood). In both patients, highly dominant IgG4⁺ clones were recovered in the BCR repertoire in the biopsy material (Figure 2 A and 2D). In line with peripheral blood, the rank of the highest IgG4+ clone is again 1^st when selecting the IgG+ repertoire only. Comparing the retrieved IgG+ clones, a strong overlap was present between the clones found in blood and inflamed tissue (Figure 2B-C and 2E). Collectively, IgG4+ clones were detectable in the inflamed tissue and these clones showed marked overlap with those in peripheral blood. This suggests that these IgG4+ clones have a role in the pathogenesis of the disease, rather than being an apiphenomenon.

If the dominant IgG4⁺ clones were indeed pathogenic, it would be expected that these dominant clones would regress or even disappear following successful therapeutic intervention. The inventors thus compared BCR repertoires in IAC patients before and 4 and 8 weeks after initiation of their first immunosuppressive treatment episode. In patients treated with high-dose prednisolone, serum liver tests improved rapidly (Figure 3A). Simultaneously, corticosteroid therapy induced a specific decline of serum IgG4 levels, while total IgG serum levels on average remained nearly stable within or close to physiological levels (Figure 3B).

In line, after 4 weeks of treatment, the contribution of IgG4+ clones to the total blood BCR repertoire already had become negligible. The IgG+ clones with an IgG4+ subtype fell from 9.2% at baseline to 0.3% and 0.2% after 4 and 8 weeks of therapy (Figure 4A-B). Consequently, the contribution of individual dominant IgG4⁺ clones to the BCR repertoire regressed: the most dominant IgG4⁺ clone in IAC patients dropped in rank from a median of 1^st to 51^st (p<0.001) and 67^th (p<0.001) after 4 and 8 weeks respectively (Figure 4C). Furthermore, corticosteroid therapy appears to have a more profound effect on the presence of dominant IgG4+ clones than on other clones in the BCR repertoire. While dominant IgG4+ are rapidly suppressed by corticosteroid use, the majority of the non-IgG4 B cell repertoire remained more stable during 4 and 8 weeks of immunosuppressive therapy (median percentage of BCR clones recovered from the BCR repertoire after 4 and 8 weeks 70.3%) and 66.1%, respectively; Figure 4D).

The notion that dominant IgG4+ clones can be found in patients with active IAC is also supported by observations in patient IAC6, who experienced a relapse of disease while using a maintenance dose of the enterotopic corticosteroid budesonide. In this patient, the repertoire was assessed at baseline and 4 and 8 weeks after the daily dose of budesonide was increased. Also in this patient IgG4+ clones were present at the timepoint of active relapsing disease, and were suppressed by the successful therapeutic intervention (Figure 4E).

In summary, these findings show that dominant IgG4+ clones disappear specifically from the repertoire after successful therapy and support the notion that these cells might be pathogenic.

Patients

Overview of the patients included in this study is provided in Table 5. We prospectively included 6 patients clinically diagnosed with IAC and meeting the HISORt criteria as published earlier and adapted for IAC (1, 14-15). Four patients were included during the symptomatic episode that led to the most probable diagnosis of IAC, with the biliary tract as the primary site of inflammation (IAC 1-4). One patient (IAC5) was included suffering from relapsing IAC (disease duration 4 years) under maintenance dose corticosteroids (budesonide, 6 mg/day). One patient (IAC6) was included while suffering from the complications of liver cirrhosis due to an inadequately controlled IAC and was at the time of inclusion under prolonged immunosuppression (prednisolon, 5 mg/day plus azathioprine, 100 mg/d). None of the IAC patients showed signs of any malignant disease (haematological, pancreaticobiliary or other) observed to date (mean follow-up 16 months, range 8-20 months). From all newly diagnosed patients peripheral blood was drawn before the start of treatment with high-dose corticosteroids (median 40, range 20-40 mg/day). After 4 and 8 weeks respectively, additional blood samples were collected. IAC4 and IAC5 underwent ERCP for stent replacement, which allowed the collection of a duodenal papilla biopsy, paired with peripheral blood. Patients included in the primary sclerosing cholangitis control group were selected based on an unchallenged diagnosis of PSC compliant with the current EASL guidelines (16). Patients included in the malignancy control group had a histologically proven hepatobiliary malignancy (pancreatic cancer or bile duct cancer). Anonymous healthy individuals were age- and sex matched to the IAC patient group. The study was performed according to the Declaration of Helsinki and approved by the local medical ethical committee of the Academic Medical Center (METC 10/007). All patients provided written informed consent prior to inclusion in the study. Table 5: Age and gender distribution and IgG4 serology of IAC patients and healthy and disease controls

Peripheral blood and papilla biopsy sampling

Peripheral blood was collected and stored using PAXGene Blood RNA tubes according to manufacturer's instructions (Cat. Number 762165, PreAnalytiX, Breda, The Netherlands). Isolation of total RNA was performed using the PAXGene Blood RNA isolation kit (Cat. Number 762174, Qiagen, Venlo, The Netherlands). Biopsies of the duodenal papilla during ERCP were immediately preserved in RNAlater reagent (Qiagen Benelux, the Netherlands) and stored at -80°C until use. Total RNA was isolated using polytron homogenizer in the presence of STAT60 reagent as described previously (17). cDNA was synthesized with 250ng total RNA input using Superscript III RT (Invitrogen- Life Technologies, Carlsbad, CA, USA).

Linear amplification & next-generation sequencing

The linear amplification used in this study was based on the protocol used for T- cells and B cells in a previous study (18). In the first step of the protocol a linear amplification of the complete immunoglobulin repertoire was performed using a primer set covering all functional IGHV genes of the B-cell receptor (primer sequences available on request). The IGHV-primers contained a primerB sequence required for Amplicon sequencing according to the 454 titanium protocol (version 2010) (Roche Diagnostics, Mannheim, Germany). Amplified products were purified using AMPure XP SPRI-beads (#A63881, Agencourt-Bioscience, Beverly, MA, USA) in a template:bead ratio of 1 : 1. The cleaned product was used in a PCR using primerB as forward primer and a generic primer specific for all functional Jheavy genes containing the primerA as reverse primer. An additional primer set was designed for the amplification of all IGHC gene segments to analyze all possible immunoglobulin isotypes. These primers all contained the primerA sequence and can therefore be used as a substitute for the Jheavy primer. All amplified products encode the CDR3, a unique sequence that defines a unique clone. After amplification, samples were again purified using the AMPure beads and quantified using fluorospectrometry (Quant-iT dsDNA HS Assay Kit (#Q32851, Invitrogen- LifeTechnologies, USA). Samples were prepared for sequencing according to the manufacturer's protocol for Amplicon Sequencing. Sequencing was performed on a Roche Genome Sequencer FLX using the Titanium platform. For each sample at least 40,000 (bead-bound) immunoglobulin sequences were analyzed. The number of sequences reflects the amount of BCRs produced by that clone and can be used as a measure for 'dominance' of that particular clone. NGS will visualize expanded B cells as a deviation in the repertoire because they carry the same BCR-sequence. Moreover, plasma cells can be identified as these cells produce increased amounts of BCR mRNA, producing a comparable deviation in the repertoire. For clarity we will use the term 'dominant clones' to denote unique BCR- signals with a frequency >0.5% within the repertoire.

Bioinformatics & data analysis

The bioinformatics pipeline used to obtain the BCR sequences was described previously in detail ¹⁴ and contains 4 modules: 1) MID-sorting, 2) identification of gene segments, 3) CDR3 detection, and 4) removal of artifacts. Immunoglobulin isotype homology was determined using open-access webtool BLASTn (megablast algorithm) and reference sequences for the human IGHC regions, allowing a sequence homology >97%.¹⁵

Statistics

Values are either expressed as mean and standard deviation, or median and interquartile range, depending on criteria for (non-)parametric analysis. Comparisons between all three groups were performed using 1-way-ANOVA and Bonferroni post hoc test. Two sided P-values of < 0.05 were considered statistically significant. Graphpad Prism was used to perform the analyses (Graphpad Prism software, version 5.1, 2007, La Jo 11a, CA, USA). REFERENCES

I . Ghazale A, et al. Gastroenterology 2008;134:706-15.

2. Kamisawa T, et al. J Gastroenterol 2003;38:982-4.

3. Hamano H, et al. N Engl J Med 2001 ;344:732-8.

4. Sah RP, et al. Gastroenterology 2010; 139: 140-8; quiz el2-3.

5. Stone JH, et al. N Engl J Med 2012;366:539-51.

6. Aoki S, et al. Histopathology 2005;47: 147-58.

7. Zen Y, et al. Hepatology 2007;45: 1538-46.

8. Oseini AM, et al. Hepatology 201 1 ;54:940-8.

9. Moon SH, et al. Gastrointest Endosc 2010;71 :960-6.

10. Khosroshahi A, et al. Medicine (Baltimore) 2012;91 :57-66.

I I . van der Neut Kolfschoten M, et al. Science 2007;317: 1554-7.

12. European Association for the Study of the Liver. J Hepatol 2009;51 :237-67.

13. Klarenbeek PL, et al. Ann Rheum Dis 2012.

14. Cantaert T, et al. Arthritis Rheum 2012.

15. Klarenbeek PL, et al. Immunol Lett 2010;133:42-8.

16. Giudicelli V, et al. Nucleic Acids Res 2005 ;33

Claims

1. Method of determining the risk of suffering from or developing an IgG4-related systemic disease in a subject comprising the steps of:

(a) determining in a biological sample from said subject the number and/or frequency of IgG4 positive BCR clones, and

(b) determining the risk of suffering from or developing an IgG4-related systemic disease based on said number of IgG4 positive BCR clones, wherein an increase of said number of IgG4 positive BCR clones and/or a higher frequency of at least one IgG4 positive BCR clone compared to a healthy control indicates an increased risk, wherein said BCR clone is defined as one or more B cells or plasma cells expressing the same unique VDJ

rearrangement of the heavy chain encoding the heavy chain of a B cell receptor.

2. Method according to claim 1, wherein an increased risk is indicated when at least 0.5% of the total number of BCR clones is an IgG4 positive BCR clone.

3. Method according to claim 1, wherein an increased risk is indicated when at least 1% of the total number of IgG positive BCR clones is an IgG4 positive BCR clone.

4. Method according to anyone of claims 1-3, wherein an increased risk is indicated when at least one, preferably 2 of the 25 most abundant BCR clones is an IgG4 positive BCR clone.

5. Method according to anyone of claims 1-4, wherein an increased risk is indicated when at least one, preferably 2 of the 10 most abundant BCR clones is an IgG4 positive BCR clone.

6. Method according to anyone of claims 1-5, wherein an increased risk is indicated when the most abundant IgG positive BCR clone is IgG4 positive.

7. Method according to anyone of claims 1-6, wherein said biological sample is a peripheral blood sample.

8. Method according to anyone of claims 1-7, wherein said number of BCR clones is determined using Next-generation sequencing.

9. Method according to anyone of claims 1-8, wherein said IgG4-related systemic disease is IgG4 associated cholangitis.

10. Method according to anyone of claims 1-9, comprising the steps of:

(a) obtaining either the cDNA from the mRNA expressed from the biological sample or the genomic DNA extract of the biological sample,

(b) performing the amplification of the cDNA obtained at the step (a) with a set of IGHV forward primers capable of specifically hybridizing in stringent conditions with the nucleic acids encoding the variable segments (VH) of immunoglobulin heavy chains and a CH reverse primer, capable of specifically hybridizing in stringent conditions with the nucleic acid encoding the constant segment (IGHC) of the IgG4 type of an immunoglobulin heavy chain, and

(c) determining the number and frequency of the IgG4 positive BCR clones.

11. Method according to claim 10, wherein said set of IGHV forward primers contains a primer having a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1,

SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, and wherein said CH reverse primer has the nucleic acid sequence SEQ ID NO. 9.

12. Kit for performing the method according to any of claims 1 - 11, comprising a CH reverse primer, capable of specifically hybridizing in stringent conditions with the nucleic acid encoding the constant segment (IGHC) of the IgG4 type of an immunoglobulin heavy chain.

13. Kit according to claim 12, further comprising an IGHV forward primer capable of specifically hybridizing in stringent conditions with the nucleic acids encoding the variable segments (VH) of immunoglobulin heavy chains.

14. Kit according to claim 12 or 13 wherein said CH reverse primer has the nucleic acid sequence according to SEQ ID NO. 17.

15. Kit according to any of claims 13 - 14, wherein said IGHV forward primer has the nucleic acid sequence according to SEQ ID NO. 14.

16. Kit according to any of claims 12 - 15, wherein said IGHV forward primer and said CH reverse primer has at least 15, 16, 17, 18 or 19 nucleic acids.