JPWO2015068790A1 - Fermented milk with suppressed increase in acidity and method for producing the same - Google Patents

Abstract

The object of the present invention is to solve the problems of the prior art, without the need for using additives for promoting fermentation or suppressing acidity, with a fermentation time comparable to that of the prior art, and by a normal manufacturing process, during refrigerated storage It is providing the fermented milk which suppressed the raise of the acidity in, and its manufacturing method. According to the present invention, (a) after inoculating a skim milk powder medium adjusted to pH 4.2 to 4.3 by adding lactic acid, the pH maintained at 35 to 47 ° C. is decreased by 0.2. Lactobacillus delbrueckii subsp. Bulgaricus bacterium having mycological properties, which takes 15 hours or more, and (b) inoculating into skim milk medium and culturing at 37-45 ° C. for 12-24 hours. The present invention relates to a lactic acid bacteria starter containing Streptococcus thermophilus bacteria having mycological properties that do not produce aggregates when cooled at 10 ° C., a method for producing fermented milk using the lactic acid bacteria starter, and the produced fermented milk.

Description

  The present invention relates to fermented milk in which an increase in acidity is suppressed and a method for producing the same. In particular, the present invention relates to a useful thermophilus bacterium obtained by using a novel screening method for thermophilus, a fermented milk in which an increase in acidity using the thermophilus is suppressed, and a method for producing the same.

  Fermented milk produced using lactic acid-producing bacteria often contains live lactic acid-producing bacteria even in the final product. In order to preserve the flavor of fermented milk, the final product is usually stored refrigerated. However, even during refrigerated storage, fermentation progresses slowly and the acidity rises due to live lactic acid-producing bacteria, so it is difficult to maintain a certain quality for a long period of time. Such a phenomenon is distinguished from acid production, which is essential in the production of fermented milk, as post-addition or after-addition.

As a method for producing fermented milk in which an increase in acidity during refrigerated storage is suppressed, a method of reducing the activity of lactic acid bacteria in fermented milk by applying pressure treatment after fermentation has been proposed (Patent Document 1).
Moreover, the manufacturing method of the fermented milk which suppressed the acidity raise at the time of a preservation | save using the mutant of Streptococcus thermophilus is proposed (patent documents 2 and 3).

Furthermore, a method for producing fermented milk that suppresses an increase in acidity during storage has been proposed in which an acid production-suppressing strain of Lactobacillus bulgaricus and a viscous product-producing strain of Streptococcus thermophilus are used as starter lactic acid bacteria (patent Reference 4).
The Streptococcus thermophilus OLS3290 that can be used in the present invention has already been isolated and is known to be used in the production of frozen yogurt (Patent Document 5).

Japanese Patent Laid-Open No. 04-075555 JP 2000-270844 A JP 2005-021050 A Japanese Patent Application Laid-Open No. 07-236416 Japanese Patent No. 4416127

  However, according to the research by the present inventors, in the invention of Patent Document 1, it is necessary to perform high-pressure treatment on the entire product after completion of fermentation, which is not practical. Moreover, in the invention of Patent Document 2, it is necessary to use a yeast extract or the like in order to promote fermentation and suppress a delay in fermentation time, and the acidity achieved in normal fermentation time is low. . Furthermore, in the invention of Patent Document 3, the fermentation time for achieving a sufficient lactic acid acidity is 8 to 10 hours (FIG. 2 of Patent Document 3), which is extremely long and is not practical. Moreover, in invention of patent document 4, fermented milk is manufactured using the lactic-acid-bacteria starter prepared using the yeast extract.

  As described above, various methods have been proposed to suppress post-acidification, but there are still special fermentation times and normal fermentation times without using additives for promoting fermentation or suppressing acidity. A method for producing fermented milk that does not require a production process and suppresses an increase in acidity during refrigerated storage has not been established. Moreover, in the manufacturing method of fermented milk which suppressed the raise of the acidity at the time of the conventional cold storage, fermentation time was long and the preferable fragrance of fermented milk was not often rich.

  Therefore, the problem of the present invention is to solve the problems of the prior art, and it is not necessary to use an additive for promoting fermentation or suppressing acidity, and it is refrigerated by a normal production process with a fermentation time comparable to the conventional one. It is providing the fermented milk which suppressed the raise of the acidity at the time of a preservation | save, and its manufacturing method.

  In order to solve the above-mentioned problems, the inventors of the present invention have conducted intensive research to produce fermented milk using a lactic acid-producing strain having acid sensitivity, so that the fermentation can be performed without delaying the fermentation. It was found that an increase in acidity in the medium could be suppressed, and an excellent strain of Lactobacillus delbrueckii subsp. Bulgaricus was already found (Japanese Patent Application No. 2013-116332). Furthermore, the present invention was completed as a result of further studies to find excellent strains for thermophilus (Streptococcus thermophilus).

That is, the present invention relates to the following.
[1] (a) After inoculating a skim milk powder medium adjusted to pH 4.2 to 4.3 by adding lactic acid, pH 0.2 is lowered in the medium maintained at 35 to 47 ° C. Lactobacillus delbrueckii subsp. Bulgaricus having mycological properties, which takes 15 hours or more to complete, and
(B) including Streptococcus thermophilus having a mycological property that does not produce aggregates when inoculated into skim milk medium and cultured at 37-45 ° C. for 12-24 hours and then cooled at 1-10 ° C. , Lactic acid bacteria starter.
[2] The lactic acid bacteria starter according to the above [1], wherein the Lactobacillus delbrueckii subsp. Bulgaricus bacterium is Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 (NITE BP-01569).
[3] One or more Streptococcus thermophilus bacteria selected from the group consisting of Streptococcus thermophilus OLS3615 (NITE BP-01696), Streptococcus thermophilus OLS3078 (NITE BP-01697) and Streptococcus thermophilus OLS3290 (FERM BP-19638) The lactic acid bacteria starter according to [1] or [2].
[4] The lactic acid bacteria starter according to any one of [1] to [3], for producing fermented milk in which an increase in acidity is suppressed.
[5] Streptococcus thermophilus OLS3615 (NITE BP-01696).
[6] Streptococcus thermophilus OLS3078 (NITE BP-01697).
[7] Fermented milk containing Streptococcus thermophilus OLS3615 (NITE BP-01696) or Streptococcus thermophilus OLS3078 (NITE BP-01697).
[8] (a) Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 (NITE BP-01569);
(B) Fermentation comprising one or more selected from the group consisting of Streptococcus thermophilus OLS3615 (NITE BP-01696), Streptococcus thermophilus OLS3078 (NITE BP-01697) and Streptococcus thermophilus OLS3290 (FERM BP-19638) milk.

[9] A method for producing fermented milk, comprising a step of adding the lactic acid bacteria starter according to any one of [1] to [4] to a raw material mix.
[10] The production method according to [9], including a step of fermentation at 35 to 45 ° C. for 3 to 5 hours.
[11] The production method according to [9] or [10], wherein the fermentation process is terminated when the acidity is 0.6 or more and 1.4 or less.
[12] The production method according to any one of [9] to [11], including a deoxidation treatment step of the raw material mix.
[13] Fermented milk produced by the production method according to any one of [9] to [12].
[14] The fermented milk according to any one of [7], [8] or [13], wherein the pH is 4.1 to 4.7.
[15] The fermented milk according to any one of [7], [8], [13] or [14], which is refrigerated and stored.
[16] The fermented milk according to [15], wherein an increase in acidity is suppressed.
[17] The fermented milk according to any one of [7], [8] or [13] to [16], wherein the acidity is 0.6 to 1.4.

[18] A method for screening Streptococcus thermophilus for producing fermented milk in which an increase in acidity is suppressed,
(A) a step of inoculating a non-fat dry milk medium with a candidate Streptococcus thermophilus;
(B) a step of cooling the skimmed milk powder medium inoculated with the Streptococcus thermophilus bacterium that is a candidate in (a), and then cooling the culture medium;
(C) confirming the formation of aggregates of skim milk powder medium cooled in (b), and
(D) including a step of determining the Streptococcus thermophilus bacterium as a candidate confirmed not to produce an aggregate in (c) as a Streptococcus thermophilus bacterium for producing fermented milk in which an increase in acidity is suppressed, Said screening method.
[19] The above-mentioned [18], wherein the nonfat dry milk medium is 8 to 12% by weight of nonfat dry milk and 92 to 88% by weight of water with respect to 100% by weight of the whole. Screening method.
[20] The screening method according to [19] above, wherein the yeast extract is mixed with the skim milk powder medium in an amount of 0.05 to 0.15% by weight with respect to 100% by weight of the skim milk powder medium.
[21] The screening method according to [20], wherein the candidate Streptococcus thermophilus bacterium is inoculated at 1 to 3% by weight with respect to 100% by weight of the skim milk medium.
[22] The screening method according to any one of [18] to [21], wherein the culture in (b) is performed at 37 to 45 ° C. for any of 12 to 24 hours.
[23] The screening method according to any one of [18] to [22], wherein the cooling of (b) is performed at 1 to 10 ° C.

According to the present invention, whether a thermophilus bacterium (Streptococcus thermophilus bacterium) suitable as a starter has aggregability with respect to skim milk medium (may be mixed with yeast extract) without using a raw material mix. Screening can be performed efficiently and accurately with a simple index.
The thermophilus selected by the screening method of the present invention can produce savory fermented milk without agglomerating the raw material mix in the production of fermented milk. In particular, by using the Thermophilus bacterium alone or in combination with the Bulgarian bacterium, fermented milk that suppresses an increase in acidity during refrigerated storage can be provided.

  In providing the fermented milk of the present invention, it is not necessary to use an additive for accelerating fermentation or suppressing increase in acidity, and it is not necessary to use a special production process with a fermentation time comparable to the conventional one. In particular, Streptococcus thermophilus bacteria that do not have cohesiveness to skim milk medium can be used to suppress the increase in acidity even when used in combination with Bulgarian bacteria that can suppress the increase in acidity. A suitable fermented milk can be produced without inhibiting the action.

The present invention also relates to thermophilus bacteria that are optimal as mixed starters in combination with Bulgarian bacteria that are excellent as acid-sensitive lactic acid-producing strains such as Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 (NITE BP-01569) (hereinafter also referred to as OLL1171 strain). Can be provided. In particular, production of fermented milk while maintaining a refreshing flavor and viable number of lactic acid-producing bacteria over a long period of time, while suppressing increase in acidity and pH drop over time during refrigerated storage of fermented milk Changes in flavor during subsequent distribution or storage can be suppressed as compared to conventional cases.
Furthermore, the present invention can achieve an improved texture (body feeling = high viscosity and responsive to eating) while maintaining a good flavor, particularly in soft type yogurt.

FIG. 1 is a diagram showing visual evaluation (left: smoothness; ◎ (no agglomeration), right: smoothness; x (with agglomeration)) of smoothness (coagulation: formation of agglomerates) of fermented milk. is there. FIG. 2 shows fermented milk (plain yogurt) prepared with a mixed starter of Thermophilus bacteria (candidate strain: 6, candidate strain: 7, candidate strain: 19) and OLL1171 strain of the present invention, and a mixed starter of strains Y and B It is a figure which shows the comparison of the flavor after refrigeration (low temperature) preservation | save of fermented milk (plain yoghurt) prepared by (comparative example). FIG. 3 shows fermented milk (plain yogurt) prepared with a mixed starter of Thermophilus bacteria (candidate strain 19) and OLL1171 strain of the present invention, and fermented milk (plain) prepared with a mixed starter of strain Y and strain B (comparative example). It is a figure which shows the comparison of the flavor immediately after manufacture of yoghurt). FIG. 4 shows fermented milk (plain yogurt) prepared with a mixed starter of Thermophilus (candidate strain 6) and OLL1171 strain of the present invention, and fermented milk (plain) prepared with a mixed starter of strain Y and strain B (comparative example). It is a figure which shows the comparison of the flavor immediately after manufacture of yoghurt). FIG. 5 shows fermented milk (plain yogurt) prepared with a mixed starter of Thermophilus bacterium (candidate strain 19) and OLL1171 strain of the present invention, and fermented milk (plain) prepared with a mixed starter of strain Y and strain B (comparative example). It is a figure which shows the comparison of the flavor after refrigerated storage of (yogurt). FIG. 6 shows fermented milk (plain yogurt) prepared with a mixed starter of Thermophilus bacterium (candidate strain 6) and OLL1171 strain of the present invention, and fermented milk (plain) prepared with a mixed starter of strain Y and strain B (comparative example). It is a figure which shows the comparison of the flavor after refrigerated storage of (yogurt). FIG. 7 shows fermented milk (plain yogurt) prepared with a mixed starter of Thermophilus bacterium (candidate strain 19) and OLL1171 strain of the present invention, and fermented milk (fruit) prepared with a mixed starter of strain Y and strain B (comparative example) It is a figure which shows the comparison of the flavor immediately after manufacture of yoghurt). FIG. 8 shows fermented milk (plain yogurt) prepared with a mixed starter of Thermophilus bacterium (candidate strain 19) and OLL1171 strain of the present invention, and fermented milk (fruit) prepared with a mixed starter of strain Y and strain B (comparative example) It is a figure which shows the comparison of the flavor after refrigerated storage of (yogurt).

  In this specification, “fermented milk” refers to a product obtained by fermenting milk. “Fermented milk”, “lactic acid bacteria beverage”, “ Includes “milk drinks”, “natural cheese” and the like. For example, fermented milk is “fermented milk” as defined by the ministerial ordinance such as raw milk, milk, special milk, raw goat milk, pasteurized goat milk, raw noodle milk, ingredient-adjusted milk, low-fat milk, non-fat milk. Milk such as processed milk or milk containing non-fat milk solids equivalent to or higher than this is fermented with lactic acid bacteria or yeast to form solid (hard type), pasty (soft type) or liquid (drink type) Or those that have been frozen.

  A typical example of fermented milk is yogurt. According to the international standard defined by the United Nations Food and Agriculture Organization (FAO) / World Health Organization (WHO), “Products called yogurt are lactic acid fermentative effects of both Streptococcus salivarius subsp. Thermophilus and Lactobacillus delbrueckii subsp. Bulgaricus. It is made from dairy products such as milk and skim milk powder, and a large amount of the above-mentioned two bacteria are alive in the final product. In this specification, “yogurt” includes yogurt defined by the FAO / WHO.

  Since yogurt contains a large amount of live lactic acid-producing bacteria, the acid-sensitive lactic acid-producing bacteria of the present invention are used for the production of yogurt. appear. Therefore, in the present invention, yogurt, and lactic acid bacteria beverages, milk beverages and cheese (natural cheese, processed cheese) containing live bacteria are suitable as fermented milk. Particularly, fermented milk is preferably yogurt that is refrigerated and stored such as plain yogurt, hard yogurt (set type yogurt), soft yogurt, and drink yogurt.

  Hereinafter, the present invention will be described in detail focusing on the case where the fermented milk is yogurt. However, the present invention is not limited to such an embodiment, and includes embodiments such as a lactic acid bacteria beverage, a milk beverage, and cheese. In addition, yogurt and other aspects can be appropriately modified by those skilled in the art based on the description of the present specification.

  In the present specification, the “raw material mix” is a liquid containing milk components such as raw milk, whole milk, skim milk and whey. Here, raw milk refers to animal milk such as milk. In addition to milk components such as raw milk, whole milk, skim milk and whey, the raw material mix includes processed products (for example, whole milk powder, whole fat concentrated milk, skim milk powder, skim concentrated milk, condensed milk, whey powder, Including buttermilk, butter, cream, cheese, whey protein concentrate (WPC), whey protein isolate (WPI), α-lactalbumin (α-La), β-lactoglobulin (β-Lg), etc. Can do.

  In addition to milk components, the raw material mix includes soy milk, sugar, sugar, sweetener, flavor, fruit juice, pulp, vitamins, minerals, fats and oils, ceramide, collagen, milk phospholipids, polyphenols, food ingredients and It can contain food additives and the like. In addition, the raw material mix may contain stabilizers such as pectin, soybean polysaccharide, CMC (carboxymethylcellulose), agar, gelatin, carrageenan, gums, thickener, gelling agent and the like as necessary. .

  In the present invention, the raw material mix preferably contains only the above-mentioned foods, food ingredients, food additives and stabilizers, thickeners, and gelling agents that are generally used in the production of fermented milk. In particular, from the viewpoint of the texture and flavor of fermented milk, do not add (formulate) fermented milk ingredients such as "yeast extract" or "chitosan" that have an effect of promoting fermentation or an effect of suppressing an increase in acidity, Even when they are added to fermented milk, it is desirable to add them in a trace amount that does not exhibit such an effect.

  In a preferred embodiment of the present invention, the amount of yeast extract added to the raw material mix is, for example, 0.01% by weight or less, preferably 0.005% by weight or less, more preferably 0.001% by weight or less, and even more preferably 0%. .0005% by weight or less, particularly preferably 0.0001% by weight or less, and most preferably no yeast extract. And in a preferred embodiment of the present invention, the amount of yeast extract added to the fermented milk is, for example, 0.01% by weight or less, preferably 0.005% by weight or less, more preferably 0.001% by weight or less, and still more preferably. Is 0.0005% by weight or less, particularly preferably 0.0001% by weight or less, and most preferably not containing yeast extract.

  In a preferred embodiment of the present invention, the amount of chitosan added to the raw material mix is, for example, less than 0.01% by weight, preferably less than 0.005% by weight, more preferably less than 0.001% by weight, and still more preferably. It is less than 0.0005% by weight, particularly preferably less than 0.0001% by weight, and most preferably no chitosan is contained. In a preferred embodiment of the present invention, the amount of chitosan added to the fermented milk is, for example, less than 0.01% by weight, preferably less than 0.005% by weight, more preferably less than 0.001% by weight, and still more preferably. It is less than 0.0005% by weight, particularly preferably less than 0.0001% by weight, and most preferably no chitosan is contained.

  In this specification, “including lactic acid-producing bacteria”, “including Streptococcus thermophilus OLS3615 (accession number: NITE BP-01696)”, “including Streptococcus thermophilus OLS3078 (accession number: NITE BP-01697)”, “Streptococcus thermophilus Expressions such as “including OLS3290 (accession number: FERM BP-19638)” and “including Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 strain (accession number: NITE BP-01569)” include fermented milk containing the microorganism (the microorganism) It preferably indicates that it contains live bacteria. By using lactic acid-producing bacteria as starter bacteria in fermented milk, not only when the obtained fermented milk contains the bacteria, but separately from lactic acid-producing bacteria used as starter bacteria, Or the case where the said microbe is included is mentioned by adding after fermentation. In the present specification, “starter fungus” means a microorganism that ferments, and “starter” means a culture of starter fungus.

  In this specification, “acidity” means a value measured by “5. Method for Measuring Acidity of Milk and Dairy Products” on page 56 of the Laws and Regulations Related to Milk (Milk Industry Hygiene Liaison Council, March 2006). The details are as follows. That is, in this specification, “acidity” means “diluted by adding water containing no carbon dioxide gas in the same amount to 10 ml of a sample, and adding 0.5 ml of phenolphthalein solution as an indicator to give 0.1 mol / L. Titrate with sodium hydroxide solution for 30 seconds up to the point where faint red color does not disappear, and determine the percent amount of lactic acid per 100 g of sample from the titration, and use it as acidity. , Corresponding to 9 mg of lactic acid. The indicator is an acidity measured based on “1 ml of phenolphthalein dissolved in 50% ethanol to make 100 ml”.

  Generally, when fermented milk shipped as a final product is yogurt, the acidity of the fresh product (at the end of fermentation) is about 0.6 to 0.8%. Since fermented milk can usually be refrigerated for about 1 to 2 weeks (7 to 14 days), when fermented milk is actually consumed, the acidity of the refrigerated product (after refrigerated storage) is 0. It can rise to about 9-1.2%. At this time, from the viewpoint of the texture and flavor (particularly acidity) of the fermented milk, the acidity of the fermented milk is, for example, 0.6 to 1.1%, preferably 0.7 to 0.9%, and more preferably 0. About 75 to 0.85%. Therefore, in the present invention, since the increase in acidity during refrigerated storage of fermented milk is suppressed, the acidity of the fresh product of fermented milk is, for example, 0.6 to 0.9%, preferably 0.65 to 0. 0. 85%, more preferably 0.7 to 0.8%. After refrigerated storage in about 1 to 2 weeks, the acidity of the refrigerated preserved fermented milk is, for example, 0.7 to 1.1%, preferably It is 0.75 to 1.0%, more preferably 0.75 to 0.9%.

  In the present specification, “inhibition of increase in acidity” means that the increase in acidity is 0.25% or less when refrigerated for a certain period from the acidity at the end of fermentation. In one aspect of the present invention, the change (increase) in acidity after 1 week (7 days) when stored refrigerated (10 ° C.) from the end of fermentation to the end of 1 week (7 days) is, for example, 0 .15% or less, preferably 0.13% or less, more preferably 0.11% or less, still more preferably 0.10% or less, and particularly preferably 0.09% or less. At this time, the lower limit of the change (increase) in the acidity is not particularly limited, but is 0.02%, for example.

  In one embodiment of the present invention, the change (increase) in acidity after 2 weeks (14 days) when stored refrigerated (10 ° C.) from the end of fermentation to the end of 2 weeks (14 days) is, for example, 0 .25% or less, preferably 0.23% or less, more preferably 0.21% or less, further preferably 0.20% or less, and particularly preferably 0.19% or less. At this time, the lower limit of the change (increase) in the acidity is not particularly limited, but is, for example, 0.05%.

  In one aspect of the present invention, the acidity of the fermented milk for the first week (7 days) when stored refrigerated (10 ° C.) from the end of fermentation to the end of 1 week (7 days) is, for example, 0.6. To 0.95%, preferably 0.65 to 0.9%, more preferably 0.7 to 0.85%, still more preferably 0.75 to 0.85%, and particularly preferably 0.8 to 0.8. 85%. In one embodiment of the present invention, the acidity of the fermented milk at the second week (14 days) when stored refrigerated (10 ° C.) from the end of fermentation to the end of two weeks (14 days) is, for example, 0.7. To 1.05%, preferably 0.75 to 1.0%, more preferably 0.8 to 0.95%, still more preferably 0.85 to 0.95%, and particularly preferably 0.9 to 0.00. 95%.

  In this specification, “refrigerated storage” refers to storage at a low temperature of 10 ° C. or less, and typically refers to storage at 5 to 10 ° C. Generally, when fermented milk shipped as a final product is yogurt, the pH of the fresh product (at the end of fermentation) is about 4.0 to 5.0. At this time, from the viewpoint of the texture and flavor (particularly acidity) of the fermented milk, the pH of the fermented milk is, for example, 4.0 or more, preferably 4.1 or more, and more preferably 4.2 or more. Therefore, in the present invention, since the increase in acidity during refrigerated storage of fermented milk is suppressed, the pH of fresh fermented milk is, for example, 4.0 to 5.0, preferably 4.1 to 4.7. More preferably, it is 4.2 to 4.6, and after refrigerated storage in about 1 to 2 weeks, the pH of the refrigerated product of fermented milk is, for example, 4.0 to 5.0, preferably 4.1 to 4.7, more preferably 4.2 to 4.6.

  In one embodiment of the present invention, the change (decrease) in pH during one week (7 days) when stored refrigerated (10 ° C.) from the end of fermentation to the end of one week (7 days) is, for example, 0. It is 35 or less, preferably 0.32 or less, more preferably 0.3 or less, further preferably 0.27 or less, and particularly preferably 0.25 or less. The lower limit value of the change (decrease) in acidity is not particularly limited, but is 0.02, for example.

  In one embodiment of the present invention, the change (decrease) in pH during 2 weeks (14 days) when stored refrigerated (10 ° C.) from the end of fermentation to the end of 2 weeks (14 days) is, for example, 0. It is 5 or less, preferably 0.47 or less, more preferably 0.45 or less, further preferably 0.42 or less, and particularly preferably 0.4 or less. At this time, the lower limit of the change (decrease) in pH is not particularly limited, but is, for example, 0.05.

  In one aspect of the present invention, the pH of the fermented milk in the first week (7 days) when stored refrigerated (10 ° C.) from the end of fermentation to the end of one week (7 days) is, for example, 4.0. It is -5.0, Preferably it is 4.1-4.8, More preferably, it is 4.2-4.6, More preferably, it is 4.3-4.6, Most preferably, it is 4.4-4.6. In one aspect of the present invention, the pH of fermented milk at the second week (14 days) when stored refrigerated (10 ° C.) from the end of fermentation to the end of two weeks (14 days) is, for example, 4.0. It is -5.0, Preferably it is 4.1-4.8, More preferably, it is 4.2-4.6, More preferably, it is 4.3-4.6, Most preferably, it is 4.4-4.6.

  In one aspect of the present invention, if the change in acidity or pH over time is within the above range, the fermented milk is managed (maintained) at a predetermined quality (especially a predetermined flavor) over a long period of time. And the shelf life of fermented milk can be extended sufficiently.

  In this specification, “lactic acid-producing bacteria” refers to microorganisms that produce lactic acid, and include lactic acid bacteria belonging to the genus Lactobacillus, Streptococcus, Lactococcus, Leuconostoc and Pediococcus, and the genus Bifidobacterium. Here, as a lactic acid-producing bacterium, preferably Lactobacillus bulgaricus (Lactobacillus delbrueckii subsp. Bulgaricus, also referred to herein as “Bulgaria”, “L. bulgaricus”), which is essential for the production of yogurt, And Streptococcus thermophilus (Streptococcus salivarius subsp. Thermophilus, also referred to herein as “thermophilus”, “S. thermophilus”), and particularly preferably a Bulgarian bacterium that produces a large amount of lactic acid in the production of yogurt (L. bulgaricus).

Regarding the Bulgarian bacterium that suppresses the increase in acidity that can be used in the present invention, the present inventors have already studied in Japanese Patent Application No. 2013-116332, and stated that “the pH is adjusted to 4.2 to 4.3 by adding lactic acid. Lactobacillus delbrueckii subsp. Bulgaricus bacterium having mycological properties, which requires 15 hours or more for pH 0.2 to drop in the medium maintained at 35 to 47 ° C. after inoculating the adjusted skim milk medium ” It has been found that an increase in acidity during refrigerated storage of fermented milk can be suppressed by selecting and using. Examples of Bulgarian bacteria having such properties include Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 (NITE BP-01569) (hereinafter also referred to as OLL1171 strain).
The Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 strain was founded on March 13, 2013 in the National Institute of Product Evaluation Technology Patent Microorganism Depositary (Room 2-5-8 Kazusa, Kisarazu, Chiba 292-0818, Japan) Date, deposit number: NITE BP-01569 is deposited internationally.

Here, L. bulgaricus OLL1171 has the following scientific properties (morphological, medium characteristics, physiological properties, etc.).
(A) Morphological properties Colony properties on the medium (BL (+) Agar, Nissui): Basically round (slightly polymorphic), white to gray, Smooth type (some: rough type), flat shape (b ) Physiological properties Bacteria form: Neisseria gonorrhoeae, Gram staining: positive, Lactic acid fermentation format: Homolactic fermentation, Aerobic growth: +

(C) Other properties that characterize the microorganism
Since the subsp. Subspecies cannot be distinguished in the 16sRNA sequence, groEL sequence analysis is used to identify four delbrueckii subspecies (delbrueckii, bulgaricus, lactis, indicus), and the following sequences are used to identify the OLL1171 strain. can do.
groEL sequence (OLL1171 strain)
AAAGGCCACCAAAGCAGCCGTTGACCAATTGCACAAGAACAGCCACAAAGTTTCCAGCCGGGACCAAATTGCCCAAGTTGCTTCAATCTCAAGTGCTTCAAAGGAAATCGGCGACTTGATCGCTGAAGCCATGGAAAAGGTCGGCAAGGACGGTGTTATCACCATTGAAGACTCCCGCGGGATCGAAACTGAACTGAGCGTGGTTGAAGGGATGCAATTCGACCGCGGCTACCTGTCCCAATACATGGTAACGGACAACGACAAGATGGAAGCTGACTTGGAAAACCCATACATCTTGATCACTGACAAGAAGATTTCCAACATCCAGGACATCTTGCCAATGTTGCAGGAAATCGTGCAAC (SEQ ID NO: 1)

Moreover, L. bulgaricus OLL1171 has the characteristic of suppressing the increase in acidity of fermented milk.
The thermophilus bacteria which do not have a cohesiveness with respect to the skim milk medium which can be used for this invention are inoculated into a skim milk medium (you may mix a yeast extract), and 12-24 at 37-45 degreeC. When cultured for 1 hour and then cooled at 1 to 10 ° C. (preferably cooled for 5 to 15 hours), it has bacteriological properties that do not produce aggregates, more preferably “fat dry milk medium (yeast extract) Inoculated into a mixture (which may be mixed), cultured at 43 ° C. for 18 hours, and then cooled to 4 ° C. for 8 hours, it has bacteriological properties that do not produce aggregates. ”Streptococcus thermophilus. Examples of thermophilus having such properties include Streptococcus thermophilus OLS3615 (NITE BP-01696) (hereinafter also referred to as OLS3615 strain), Streptococcus thermophilus OLS3078 (NITE BP-01697) (hereinafter also referred to as OLS3078 strain) or Streptococcus thermophilus OLS3290 (FERM BP-19638) (hereinafter also referred to as OLS3290 strain).

  Streptococcus thermophilus OLS3615 (NITE BP-01696) is an independent administrative agency of the National Institute for Product Evaluation Technology Patent Microorganisms Depositary Center (Room 2-5-8 Kazusa, Kazusa, Kisarazu, Chiba 292-0818, Japan) Deposited internationally as of NITE BP-01696 on May 23rd.

Here, S. thermophilus OLS3615 has the following scientific properties (morphological, characteristics on the medium, physiological properties, etc.).
(A) Morphological properties Colony properties on medium (M17 Agar, BD): circular, white (translucent), smooth type, hemispherical (b) physiological properties Bacterial morphology: cocci, Gram stain: positive, lactic acid Fermentation format: homolactic fermentation, aerobic growth: +

(C) Other properties that characterize the microorganism
16s RNA gene sequence information
TGGCGGCGTGCCTAATACATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAATGGATGACACATGTCATTTATTTGAAAGGAGCAATTGCTCCACTACAAGATGGACCTGCGTTGTATTAGCTAGTAGGTGAGGTAATGGCTCACCTAGGCGACGATACATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGGGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGGCTAACTACGT (SEQ ID NO: 2)

  Streptococcus thermophilus OLS3078 (NITE BP-01697) is an independent administrative agency of the National Institute for Product Evaluation Technology Patent Microorganisms Depositary Center (Room 2-5-8 Kazusa, Kazusa, Kisarazu, Chiba 292-0818, Japan) Deposited internationally as NITE BP-01697, dated May 23.

Here, S. thermophilus OLS3078 has the following scientific properties (morphological, medium characteristics, physiological properties, etc.).
(A) Morphological properties Colony properties on medium (M17 Agar, BD): circular, white (translucent), smooth type, hemispherical (b) physiological properties Bacterial morphology: cocci, Gram stain: positive, lactic acid Fermentation format: homolactic fermentation, aerobic growth: +

(C) Other properties that characterize the microorganism
16s RNA gene sequence information
TGGCGGCGTGCCTAATACATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAATGGATGACACATGTCATTTATTTGAAAGGAGCAATTGCTCCACTACAAGATGGACCTGCGTTGTATTAGCTAGTAGGTGAGGTAATGGCTCACCTAGGCGACGATACATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGGGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGGCTAACTACGT (SEQ ID NO: 3)

  Streptococcus thermophilus OLS3290 (FERM BP-19638) is an independent administrative agency of the National Institute for Product Evaluation Technology Patent Biology Center (Room 2-5-8 Kazusa Kamashitsu, Kisarazu, Chiba 292-0818, Japan) Deposited on May 19 (domestic deposit date), transferred to international deposit on September 6, 2013, and deposited internationally as deposit number: FERM BP-19638.

Here, S. thermophilus OLS3290 has the following scientific properties (morphological, characteristics on the medium, physiological properties, etc.).
(A) Morphological properties Colony properties on medium (M17 Agar, BD): circular, white (translucent), smooth, hemispherical (b) Physiological properties Bacterial morphology: cocci, Gram stain: positive, lactic acid Fermentation format: homolactic fermentation, aerobic growth: +

(C) Other properties that characterize the microorganism
16s RNA gene sequence information
TGGCGGCGTGCCTAATACATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAATGGATGACACATGTCATTTATTTGAAAGGAGCAATTGCTCCACTACAAGATGGACCTGCGTTGTATTAGCTAGTAGGTGAGGTAATGGCTCACCTAGGCGACGATACATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGGGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGGCTAACTACGT (SEQ ID NO: 4)

  Although the manufacturing method of the fermented milk of this invention can employ | adopt the manufacturing process of the conventional fermented milk, the preferable aspect is demonstrated below.

  The method for producing fermented milk of the present invention includes a raw material mix preparation step in which raw materials are mixed (prepared). What is necessary is just to employ | adopt suitably the normal conditions used when manufacturing fermented milk in the preparation process of a raw material mix. Furthermore, the method for producing fermented milk of the present invention includes a raw material mix (heating) sterilization step, a raw material mix cooling step, a starter addition step, a fermentation step, and a fermented milk cooling step, as in the conventional method. It is desirable to include in this order. In addition, what is necessary is just to employ | adopt suitably the normal conditions used when manufacturing fermented milk in these processes.

  The manufacturing method of fermented milk of this invention may also include the homogenization process of a raw material mix. The method for producing fermented milk of the present invention is the same as the preparation process of the raw material mix, and thereafter, before and after the sterilization process of the raw material mix, simultaneously with the cooling process after the sterilization process of the raw material mix, and before and after, the fermentation process Then, the homogenization step of the raw material mix can be included in the order of the cooling step after the fermentation step, before or after the cooling step. And the manufacturing method of fermented milk of this invention can include the homogenization process of a raw material mix at once or in multiple times. In the homogenization step of the raw material mix, when a homogenizer or the like is used, the homogenization pressure is, for example, 1 to 100 MPa, preferably 5 to 50 MPa, more preferably 8 to 30 MPa, more preferably 10 to 20 MPa. To process.

  The method for producing fermented milk of the present invention may include a deoxygenation treatment step of deoxygenating the raw material mix. In the deoxygenation process, oxygen (dissolved oxygen concentration) present in the raw material mix is reduced or removed. The dissolved oxygen concentration (DO) reduction method (deoxygenation method) of the raw material mix is, for example, a gas replacement treatment with an inert gas such as nitrogen gas, helium, neon, argon, or xenon, a membrane separation treatment with an oxygen permeable membrane, a low pressure Or a deaeration treatment by vacuum can be used. In the deoxygenation treatment step, the dissolved oxygen concentration of the raw material mix is reduced or removed until it becomes, for example, 5 ppm or less, preferably 3 ppm or less, more preferably 2 ppm or less, and even more preferably 1 ppm or less.

  The method for producing fermented milk according to the present invention is performed simultaneously with the preparation step of the raw material mix, thereafter, after the homogenization step of the raw material mix, before or after the sterilization step of the raw material mix, and simultaneously with or before the cooling step of the raw material mix. After, before or after the starter addition step, at the same time before or after the fermentation step, at the same time as before or after the cooling step of the fermented milk it can. And the manufacturing method of fermented milk of this invention can include a deoxygenation process process once or several times.

  In the deoxygenation process, the fermentation time can be shortened by reducing the dissolved oxygen concentration of the raw material mix at the start of the fermentation process. Furthermore, the inhibitory effect of an increase in acidity during refrigerated storage of fermented milk can be enhanced. Therefore, since it is important that the dissolved oxygen concentration of the raw material mix is maintained at the start of the fermentation process, the deoxygenation process is performed immediately before or immediately after the addition process of the starter, It is desirable to include it at the same time or just before the fermentation process.

  As described above, the method for producing fermented milk of the present invention includes a starter addition step. The starter may be a single starter cultured alone with acid-sensitive lactic acid-producing bacteria, or a mixed starter cultured by mixing with other microorganisms. In the present invention, microorganisms other than lactic acid-producing bacteria having acid sensitivity can be used as further starter bacteria.

  As a component for culturing lactic acid-producing bacteria, it is preferable to use a component contained in the raw material mix, and it is more preferable to use only a component contained in the raw material mix. Specifically, raw milk, whole milk, skim milk, whole milk powder, skim milk powder, whole fat concentrated milk, skim concentrated milk, whey, whey powder, butter milk, butter, cream, cheese, whey protein concentrate (WPC) ), Whey protein isolate (WPI), α-lactalbumin (α-La), β-lactoglobulin (β-Lg), glycomacropeptide, etc. are preferably used, raw milk, pasteurized milk, skim milk, skim More preferably, powdered milk, whole milk powder, whole fat concentrated milk and / or defatted concentrated milk are used.

  As a growth promoter for cultivating lactic acid-producing bacteria, extracts such as yeast extract and meat extract can be added to a medium for culturing starter bacteria. However, from the viewpoint of the flavor of fermented milk, it is not preferable that these components are added to the raw material mix at a high concentration during the production of fermented milk. Therefore, the amount of the growth promoter added to the starter is, for example, less than 0.1% by weight, preferably less than 0.05% by weight, more preferably less than 0.01% by weight, and even more preferably less than 0.005% by weight. Particularly preferably, it is less than 0.001% by weight, and most preferably no growth promoter is contained.

The number of lactic acid-producing bacteria in the starter is, for example, 10 ⁵ to 10 ¹³ cfu / mL, preferably 10 ⁶ to 10 ¹² cfu / mL, more preferably 10 ⁷ to 10 ¹¹ cfu / mL, and more preferably 10 ⁸ to 10. ¹⁰ cfu / mL.

  In the raw material mix, the amount of starter added is, for example, 1 to 10% by weight, preferably 1 to 8% by weight, more preferably 2 to 6% by weight, and still more preferably 2 to 4% by weight. In the present invention, a starter can be added to the raw material mix according to a conventional method.

  As described above, the method for producing fermented milk of the present invention includes a fermentation step. In the present invention, from the viewpoint of efficiently obtaining fermented milk having a good flavor and texture, the fermentation temperature is, for example, 30 to 50 ° C, preferably 35 to 47 ° C, more preferably 37 to 45 ° C, and still more preferably 40. ˜43 ° C. On the other hand, in the case of including a deoxygenation treatment step of the raw material mix, it is desirable to ferment at a relatively low temperature from the viewpoint of efficiently obtaining fermented milk having a good flavor and texture. 28-47 degreeC, Preferably it is 30-45 degreeC, More preferably, it is 32-43 degreeC, More preferably, you may be 35-40 degreeC.

  In the present invention, from the viewpoint of efficiently obtaining fermented milk having a good flavor and texture, the fermentation time is, for example, 1 to 48 hours, preferably 2 to 24 hours, more preferably 3 to 10 hours, and still more preferably 3 -6 hours, particularly preferably 3-5 hours. On the other hand, when including a deoxygenation treatment step of the raw material mix, it is desirable to ferment in a relatively short time from the viewpoint of efficiently obtaining fermented milk with good flavor and texture, For example, it is 1 to 36 hours, preferably 1 to 12 hours, more preferably 2 to 8 hours, still more preferably 2 to 5 hours, and particularly preferably 2 to 4 hours.

  In the fermentation process, from the viewpoint of obtaining fermented milk with good flavor and texture, the acidity of the fermented milk is, for example, 0.6 to 1.4%, preferably 0.6 to 1.0%, more preferably 0.8. The process is terminated when it reaches 65 to 1.0%, more preferably 0.65 to 0.95%, particularly preferably 0.7 to 0.9%, and particularly preferably 0.75 to 0.85%. Moreover, in a fermentation process, from the viewpoint of obtaining fermented milk with favorable flavor and texture, the pH of the fermented milk is, for example, 4.15 to 4.75, preferably 4.2 to 4.7, and more preferably 4. The process is terminated when it becomes 25 to 4.65, more preferably 4.3 to 4.6.

  The manufacturing method of fermented milk of this invention can include the cooling process of fermented milk as above-mentioned. In the cooling process of fermented milk, fermented milk is lowered from a fermentation temperature (eg, 43 ° C.) to a predetermined low temperature (eg, 10 ° C.). And in the cooling process of fermented milk, as a cooling rate of fermented milk, it is 1 to 60 minutes, for example, Preferably it is 1 to 30 minutes, More preferably, it is 1 to 10 minutes, More preferably, it is 1 to 5 minutes, and is 10 degrees C or less. Allow to cool. At this time, it is desirable that the cooling rate be fast in order to minimize the acid production in the fermented milk cooling step.

  The method for producing fermented milk of the present invention can include a step of crushing the curd of fermented milk and / or a step of homogenizing the fermented milk. In the crushing process of the fermented milk curd, for example, the casein particles (solid component of the curd) contained in the fermented milk are finely dispersed in the whey by applying a stirring force to the fermented milk, and the fermented milk tissue is finely divided. Make it. In the homogenization process of fermented milk, for example, while applying pressure to the fermented milk, the fermented milk is pushed out from a narrow channel, and the casein particles (solid component of the curd) contained in the fermented milk are finely dispersed in the whey. Thus, the structure of the fermented milk will be atomized.

  The method for producing fermented milk of the present invention includes a step of crushing the curd of fermented milk and / or a step of homogenizing the fermented milk in the order such as after the fermentation step, simultaneously with the cooling step of the fermented milk, before or after it. Can be made. And in the crushing process of the card | curd of fermented milk, a tank with a stirring blade, a static mixer, etc. can be used. In the homogenization step of fermented milk, when a homogenizer or the like is used, the homogenization pressure is, for example, 1 to 100 MPa, preferably 5 to 50 MPa, more preferably 8 to 30 MPa, more preferably 10 to 20 MPa. The The crushing process for fermented milk curd is used for pre-fermented fermented milk soft-type yogurt and drink-type yogurt, and the fermented milk homogenization process is mainly used for pre-fermented fermented milk drink-type yogurt. Used.

  The method for producing fermented milk of the present invention includes a step of adding other ingredients for mixing a flavor substance, a sour agent, a nutrient-enhancing substance, a fragrance, a stabilizer and the like with a raw material mix and / or fermented milk (mainly fresh). be able to. In the process of adding other ingredients, for example, flavor substances (sugar, high-intensity sweeteners, sweeteners such as liquid sugar, fruit and vegetable juices such as fruits and vegetables, jams, sauces, preparations, etc.), acidulants (citric acid) , Lactic acid, etc.), nutrient-enhancing substances (vitamins, minerals, insoluble salts (calcium phosphate, calcium carbonate, whey calcium, etc.)), flavors (flavors), stabilizers (pectin, carboxymethylcellulose (CMC), soy polysaccharides, etc.) A fluid tromi-like or liquid solution containing the above is mixed with fermented milk.

  In the case of pre-fermented fermented milk (soft type yogurt, drink-type yogurt), the method for producing fermented milk of the present invention is homogenized after the fermentation step, simultaneously with the cooling step of the fermented milk, before or after it. The addition process of other components can be included in the order such as before or after the process. In addition, in the case of post-fermented fermented milk (hard type yogurt, set type yogurt), the method for producing fermented milk of the present invention is performed at the same time as or after the raw material mix preparation step and before the raw material mix sterilization step. Then, the addition process of another component can be included simultaneously with the cooling process after the sterilization process of the raw material mix or in the order before or after the cooling process. However, in the manufacturing process of fermented milk, it is desirable that the addition process of other components is used for pre-fermented fermented milk from the viewpoint of suppressing changes in the temperature of other components.

  In a preferred embodiment of the present invention, the amount of stabilizer (pectin, carboxymethyl cellulose (CMC), soybean polysaccharide, etc.) added to the raw material mix is, for example, 0.05 to 1.0% by weight, preferably 0.05 to 0.8 wt%, more preferably 0.1 to 0.5 wt%, further preferably 0.1 to 0.4 wt%, particularly preferably 0.1 to 0.3 wt%, most preferably It does not contain stabilizers. And in the preferable aspect of this invention, as fermented milk, as an addition amount of a stabilizer, it is 0.05 to 1.0 weight%, for example, Preferably it is 0.05 to 0.8 weight%, More preferably, it is 0.1. -0.5 wt%, more preferably 0.1-0.4 wt%, particularly preferably 0.1-0.3 wt%, most preferably no stabilizer.

  In the present specification, “lactic acid-producing bacterium having acid sensitivity” refers to a lactic acid-producing bacterium having low activity under acidic conditions (particularly, pH is 4.5 or less). Specifically, an acid-sensitive lactic acid-producing bacterium is a lactic acid-producing bacterium that has a low ability to produce lactic acid in fermented milk having a pH of 4.5 or less.

  The change in pH can be measured according to a conventional method. Specifically, it is preferable to measure over time using a pH meter (commercially available product). The change in pH is measured over time, for example, 3 hours or more, preferably 5 hours or more, more preferably 10 hours or more, and even more preferably 24 hours or more.

The Streptococcus thermophilus bacterium of the present invention is useful for producing fermented milk in which the increase in acidity is suppressed, and even when used in combination with Bulgarian bacteria for producing fermented milk in which the increase in acidity is suppressed, Fermented milk having a relatively high viscosity and good texture can be produced without inhibiting the inhibitory effect on the increase in acidity of the fungus.
The Streptococcus thermophilus bacterium of the present invention is 2% by weight based on 100% by weight of the skim milk medium (fat dry milk: 10% by weight, water: 90% by weight) (0.1% by weight of yeast extract may be mixed). Preferably after incubating at 37-45 ° C. for 12-24 hours and then cooling to a non-freezing temperature (about 1 ° C.) to 10 ° C. (preferably 5-15 hours) Has a mycological property of not producing aggregates when cultured at 43 ° C. for 18 hours and then cooled to 4 ° C. for 8 hours.

The Streptococcus thermophilus bacterium of the present invention can typically be screened (selected) by the following steps (a) to (d).
(A) 100% by weight of skim milk powder medium (either skim milk powder: 8-12% by weight or water: 92-88% by weight) (yeast extract 0.05-0.15% by weight) A step of inoculating candidate Streptococcus thermophilus at 1 to 3% by weight,
(B) The mixed solution inoculated with the Streptococcus thermophilus bacterium as a candidate in the above (a) is typically 12 to 24 hours at 37 to 45 ° C, preferably 12 to 40 to 45 ° C. After culturing for any of ˜24 hours, cooling at any temperature not frozen (about 1 ° C.) to 10 ° C., more preferably at any of 1 to 7 ° C. , Although not particularly limited, for example, 5 to 15 hours, preferably about 8 hours)
(C) a step of confirming (by visual observation) the formation (aggregation property) of an aggregate of the mixed liquid cooled in (b) above;
(D) The Streptococcus thermophilus bacterium, which is a candidate confirmed not to produce an aggregate in (c) (no aggregability), is a Streptococcus thermophilus bacterium for producing fermented milk with suppressed acidity. Step to determine.

  At this time, in the step (a), in the composition of the skim milk powder medium, the content of skim milk powder is preferably 9 to 11% by weight, particularly preferably 10% by weight, and the water content is 91 to 89% by weight. Is preferable, and 90% by weight is particularly preferable. And in composition of the liquid mixture which mixes a yeast extract with skim milk powder culture medium, 0.07-0.13 weight% is preferable as a content of yeast extract with respect to 100 weight% of skim milk powder culture medium, 0.1 Weight percent is particularly preferred.

  In the step (b), the culture condition of the mixed solution inoculated with the candidate Streptococcus thermophilus is preferably maintained at any one of 41 to 44 ° C. for 15 to 20 hours, It is particularly preferable to hold at 18 ° C. for 18 hours. And in the cooling conditions after culture | cultivating the liquid mixture which inoculated the candidate Streptococcus thermophilus microbe, it is preferable to hold | maintain at any of 2-6 degreeC for 6 to 10 hours, and it is 8 hours at 4 degreeC. It is particularly preferable to hold the

  Hereinafter, the present invention will be described in more detail based on examples. However, the present invention is not limited to these examples, and various modifications can be made without departing from the technical idea of the present invention. Is possible. In the present specification, unless otherwise specified,% means% by weight. In addition, when a numerical range is shown, it indicates that any value within the range including the upper limit and the lower limit can be selected unless otherwise specified. For example, when expressed as “1 to 100”, It shows that any value from 1 to 100 can be selected.

[Example 1] Selection of thermophilus bacteria (1)
(A) Physical property evaluation in single cell of thermophilus bacteria Thermophilus bacteria were activated twice in skim milk medium (fat dry milk: 10% by weight, water: 90% by weight) to which 0.1% by weight of yeast extract was added. And after inoculating this non-fat dry milk culture medium except yeast extract with 2 weight% of this thermophilus bacteria, it culture | cultivated at 43 degreeC in 18 hours. Furthermore, after this cultured medium (culture solution) was cooled to 4 ° C. overnight (about 8 hours), the presence or absence of “viscousness” and “smoothness” (aggregability: formation of aggregates) were evaluated. Regarding “viscosity”, the culture is stirred with a spoonful and is divided into 4 stages (◎: strong viscosity, ○: slightly viscous, Δ: viscous, x: no viscosity) evaluated. As for “smoothness”, when the culture was placed thinly on a spoon, the presence or absence of aggregates (dama) in the culture was visually observed, and four stages (◎; smooth, ○; almost no clumps were observed. Not possible, Δ: There are agglomerates, ×: Roughness: see FIG.
In addition, in the thermophilus strain (hereinafter referred to as strain Y) for Meiji Bulgaria yogurt (fruit type soft yogurt) (Meiji Corporation, Japan: manufactured in April 2013), “viscosity” and “smoothness” are both “ ○ ”, and this was evaluated as an index.

(B) Physical property evaluation in combination of thermophilus and bulgaric bacteria In a skim milk medium (fat dry milk: 10% by weight, water: 90% by weight) added with 0.1% by weight of yeast extract, It was activated twice. Then, after inoculating a nonfat dry milk medium excluding the yeast extract with 1.8% by weight of Thermophilus and 0.2% by weight of Bulgaria, the cells were cultured at 43 ° C. for 18 hours. Furthermore, after this cultured medium (culture solution) was cooled to 4 ° C. overnight (about 8 hours), the presence or absence of “viscousness” and “smoothness” (aggregability: formation of aggregates) were evaluated. “Viscosity” and “smoothness” were evaluated in the same manner as in the physical property evaluation of (a) Thermophilus monophyll.

The strains used in the above (a) and (b) are as follows.
-Thermophilus 31 strains were used from Streptococcus thermophilus owned by the company.
・ Bulgaria bacteria
Lactobacillus delbruekii subsp. Bulgaricus OLL1171 strain was used. The strain is incorporated in the National Institute of Technology and Evaluation Patent Microorganisms Deposit Center (Room 2-5-8, Kazusa Kamashi, Kisarazu City, Chiba 292-0818, Japan), accession number: March 13, 2013 Deposited as NITE BP-01569 (Japanese Patent Application 2013-116332).

<Result>
Among the 31 thermophilus bacteria, when the physical properties of a single thermophilus bacterium were evaluated, there were 20 strains having both “viscousness” and “smoothness” evaluated as “x”. In these 20 strains, no improvement in physical properties was observed even when combined with Bulgarian bacteria. From this result, it is considered that the approximate physical property of fermented milk prepared in combination with the Bulgarian bacterium can be estimated by evaluating the physical property of a single thermophilus bacterium. In other words, a strain with good physical properties in a single thermophilus bacterium is likely to have good physical properties even in combination with bulgaria bacterium (even in fermented milk prepared in combination with bulgaria bacterium). In strains with poor physical properties, it was considered that the physical properties were hardly improved even when combined with Bulgarian bacteria.

[Example 2] Selection of thermophilus (2) (primary screening)
The physical properties were evaluated in the same manner as in Example 1 (a) using 258 strains from Thermophilus bacteria owned by the company. The results are shown in Table 1.
Twenty-four strains having both “viscous” and “smoothness” of “Δ” or more were used as starter candidate strains.

[Example 3] Evaluation of physical properties of a combination of a starter candidate strain (thermophilus) and a Bulgarian bacterium (secondary screening)
Each of 24 starter candidate strains (Streptococcus thermophilus) selected in Example 2 was combined with Bulgarian bacteria, and physical property evaluation (viscosity and smoothness), fermentation time, and storage stability were examined.
“Viscosity” and “smoothness” were evaluated in the same manner as in Example 1 (a) physical property evaluation of thermophilus single bacteria.
About fermentation time, the time until the acidity of a culture became 0.7 or more and 0.8 or less after fermentation start was measured.
About preservation | save property, it preserve | saved at 10 degreeC after completion | finish of fermentation, the acidity after 1 day, 7 days, and 14 days after completion | finish of fermentation was measured, and the grade by which the raise of an acidity was suppressed was made into the parameter | index. The acidity is measured by a conventional method. Further, the pH after 14 days was measured.

The strains used are as follows.
-Thermophilus bacteria 24 starter candidate strains were used from Streptococcus thermophilus owned by the company.
・ Bulgaria bacteria
Lactobacillus delbruekii subsp. Bulgaricus OLL1171 strain (Accession number: NITE BP-01569).
Like the OLL1171 strain, two strains (hereinafter referred to as the strain L1 and the strain L2, respectively) in which an increase in acidity during low-temperature storage of the fermented product is suppressed.
Strain Y which is a thermophilus bacterium for Meiji Bulgaria yogurt (soft type yogurt with fruit) (Meiji Corporation, Japan: manufactured in April 2013).

  As described above, physical properties, fermentation time and storage stability were evaluated by combining 24 starter candidate strains (thermophyllus) and Bulgarian strain OLL1171. The results are shown in Table 2. As a control, physical properties of a starter (a combination of Bulgarian bacteria: strain B and thermophilus: strain Y) for Meiji Bulgaria yogurt (soft yogurt with fruit) (Meiji Corporation, Japan: manufactured in April 2013) The fermentation time and storage stability were evaluated. The results are shown in Table 3. In addition, the storage stability was not measured for the strains having both “viscosity” and “smoothness” of “x”.

Among the 24 starter candidate strains, in any combination of OLL1171 strain, strain L1 and strain L2, the strains whose “viscosity” and “smoothness” are not “x” are the starter candidate strains 6, 7, 8 , 9, 12, 17, 18, 19 and 22. Among these nine strains, the starter candidate strain 17 is practical because the fermentation time is longer than the starter for Meiji Bulgaria yogurt (fruit type soft yogurt) in any combination of OLL1171 strain, strain L1 and strain L2. It was predicted to be poor.

[Example 4] Evaluation in large-scale culture One of eight starter candidate strains of candidate strains 6, 7, 8, 9, 12, 18, 19 and 22, a Bulgarian strain OLL1171, strain L1 and The usefulness in large-scale culture was evaluated by combining one of the strains L2. Specifically, bulk starters were prepared at an inoculation ratio of Bulgarian bacteria: thermophilus bacteria = 1: 9, and fermented milk was prepared using these bulk starters. And the physical property and fermentation time of these obtained fermented milk were evaluated. The results are shown in Table 4.

From the results of Table 4, (1) OLL1171 strain and candidate strain 6, (2) OLL1171 strain and candidate strain 7, (3) OLL1171 strain and candidate strain 8, (4) OLL1171 strain and candidate strain 9, (5) OLL1171 Five combinations of strains and candidate strain 19 were selected.
And the preservation | save property (10 degreeC, 14) of fermented milk prepared with the starter (strain B + strain Y) for (6) Meiji Bulgaria yogurt (soft type yogurt containing a fruit) prepared with the combination of these five starter candidates Day) and sensory evaluation (texture and sourness). As a result, (1) Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 and candidate strain 6 (Streptococcus thermophilus OLS3290), (2) Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 and candidate strain 7 (Streptococcus thermophilus OLS3078), and bulgaricus OLL1171 and candidate strain 19 (Streptococcus thermophilus OLS3615) were superior.

  Therefore, in the following, in the production (preparation) of fermented milk, the properties of candidate strain 6, candidate strain 7 and candidate strain 19 are examined in more detail as thermophilus bacteria suitable for combination with Bulgarian bacteria (OLL1171 strain and the like). did.

[Experimental Example 1] Comparison of increase in acidity during refrigerated (low temperature) storage of fermented milk using various starters The candidate strain 6, candidate strain 7 and candidate strain of thermophilus newly discovered by screening the aforementioned strain 19 and M. Bulgaria yogurt (fruit-type soft yogurt) thermophilus bacteria (strain Y) were combined with three types of Bulgarian OLL1171 strain, strain L1 and strain L2, respectively, as a mixed starter, and reduced skim milk (defatted milk) Fermented milk (yogurt) was produced (prepared) by fermenting a 10% aqueous solution of milk powder.
For each, the fermentation time at which the acidity reached about 0.75%, the degree of acidity increase (PA: Post Acidification) after refrigerated storage (10 ° C., 14 days), and evaluation of physical properties were compared. The results are shown in Table 5.

Compared with the case where the strain Y is combined with three types of Bulgarian bacteria to make a mixed starter, the fermentation time is comparable in the case where the thermophilus candidate strain is combined with a predetermined Bulgarian bacteria to make a mixed starter. In addition to being shortened, the degree of increase in acidity (PA) after refrigeration (low temperature) storage was comparable or reduced.
At this time, compared with the case where the strain Y is combined with three types of Bulgarian bacteria and used as a mixed starter, when the thermophilus candidate strain is combined with a predetermined Bulgarian bacteria and used as a mixed starter, the viscosity of fermented milk and Smoothness was excellent.

[Experimental example 2] Comparison of flavor after refrigeration (low temperature) storage of fermented milk using various starters (1)
When the thermophilus candidate strain 6, candidate strain 7, and candidate strain 19 are combined with the Bulgarian OLL1171 strain as a mixed starter, and when the thermophilus strain Y is combined with the Bulgarian bacterial strain B as the mixed starter The fermented milk (yogurt) was manufactured (prepared) by fermenting reduced skim milk (10% aqueous solution of skim milk powder).
And the result of the sensory test after each cold storage (5 degreeC, 14 days) was compared. The result is shown in FIG.
In addition, this sensory test was carried out by five specialist panelists, and the case where Thermophilus strain Y was combined with Bulgarian strain B and mixed and started was set to the standard 0.00 (zero).
Compared to the case where Thermophilus strain Y is combined with Bulgarian strain B to make a mixed starter, Thermophilus candidate strain 6, candidate strain 7, and candidate strain 19 are combined with Bulgarian strain OLL1171, In this case, the sourness of the fermented milk was significantly lower.

In addition, when Thermophilus candidate strain 6, candidate strain 7, and candidate strain 19 are combined with Bulgarian strain OLL1171, a mixed starter is used, and Thermophilus strain Y is combined with Bulgarian strain B with a mixed starter. In this case, reduced skim milk (10% aqueous solution of skim milk powder) was fermented to produce (prepared) fermented milk (yogurt).
And the result of the sensory test immediately after each manufacture (1st day) and after refrigerated storage (5 degreeC, 18 days) was compared. The results are shown in FIGS.
In addition, this sensory test was carried out by five specialist panelists, and the case where Thermophilus strain Y was combined with Bulgarian strain B and mixed and started was set to the standard 0.00 (zero).
Compared to the case where Thermophilus strain Y was combined with Bulgarian strain B and mixed starter, Thermophilus candidate strain 6, candidate strain 7 and candidate strain 19 were combined with Bulgarian strain OLL1171 to form a mixed starter. In some cases, the acidity of the fermented milk was significantly lower.

Furthermore, when the thermophilus candidate strain 19 is combined with the Bulgarian OLL1171 strain to form a mixed starter (frozen bacterium), and the thermophilus strain Y is combined with the Bulgarian strain B, the mixed starter (frozen bacterium) In this case, after skim milk was fermented, aloe sauce was blended (mixed) therein to prepare fermented milk (yogurt).
And the result of the sensory test immediately after each manufacture (1st day) and after low-temperature storage (5 degreeC, 14 days) was compared. The results are shown in FIG. 7 and FIG.
This sensory test was carried out by five specialist panelists, and the case where Thermophilus strain Y was combined with Bulgarian strain B and mixed and started was set to the standard 0.00 (zero).
Compared with the case where Thermophilus strain Y is combined with Bulgarian strain B and used as a mixed starter, Thermophilus candidate strain 19 is combined with Bulgarian strain OLL1171 and used as a mixed starter. The degree of was significantly lower.

[Experimental Example 3] Comparison of flavor after fermentation (low temperature) storage of fermented milk using various starters (2)
When the thermophilus candidate strain 6, candidate strain 7, and candidate strain 19 are combined with the Bulgarian OLL1171 strain as a mixed starter, and when the thermophilus strain Y is combined with the Bulgarian bacterial strain B as the mixed starter The fermented milk (yogurt) was manufactured (prepared) by fermenting reduced skim milk (10% aqueous solution of skim milk powder).
And the result of the analysis of the aroma component in each immediately after manufacture (1st day) was compared. The results are shown in Table 6.
Here, the aroma component contained in the headspace of the fermented milk container is analyzed by GC-MS (n = 2), and the thermophilus strain Y is combined with the Bulgarian strain B to form a mixed starter. The reference was set to 0.00 (zero).

  Compared to the case where Thermophilus strain Y is combined with Bulgarian strain B to make a mixed starter, Thermophilus candidate strain 6, candidate strain 7, and candidate strain 19 are combined with Bulgarian strain OLL1171, In this case, when the aroma components were compared in terms of the composition ratio, there was a tendency that the amount of acetaldehyde was small and diacetyl was produced in a large amount, sour taste was suppressed, and the milk fat feeling and rich taste were emphasized. In addition, compared to the case where Thermophilus strain Y is combined with Bulgarian strain B to make a mixed starter, Thermophilus candidate strain 6, candidate strain 7 and candidate strain 19 are combined with Bulgarian strain OLL1171 and mixed. In the case of the starter, a large amount of diacetyl was produced, and there was a tendency to emphasize milk fat feeling and rich taste.

[Experimental Example 4] Production of Drink Yogurt A candidate yoghurt of Thermophilus 19 and Bulgarian strain OLL1171 were combined to form a mixed starter, and reduced skim milk (SNF 14%) was fermented for 3 hours to produce a drink yogurt. As a comparative example, using a starter for Meiji Bulgaria yogurt (plain drink type), reduced skim milk (SNF 14%) was fermented for 3 hours to produce a drink yogurt.

Changes in acidity and pH during the fermentation period are shown in Table 7. In the present invention, a necessary increase in acidity was obtained in the fermentation process, and drink yogurt could be obtained.

Table 8 shows the changes in acidity and pH after 1 day, 8 days, 16 days and 25 days after low temperature storage (10 ° C.) after completion of fermentation. In the drink yogurt of the present invention, an increase in acidity was suppressed.

After completion of fermentation, sensory evaluation after 10 days of low-temperature storage (10 ° C.) was performed. The evaluation is the degree of sweetness, sourness, fragrance, richness, refreshing feeling, and overall evaluation, and the relative evaluation when the comparative example is 0 is evaluated as superior or strong. 1, 0, -1, -2, and -3. The number of samples is 19, and the results are shown in Table 9.

  The drink yogurt of the present invention showed a significant difference in sweetness and sourness at a risk rate of 1% with respect to the comparative example after 10 days of low-temperature storage. Moreover, the tendency which felt that a rich feeling increased with respect to the comparative example was recognized.

  In the above experiments, candidate strain 6, candidate strain 7 and candidate strain 19 that were found to be particularly useful were deposited as useful thermophilus bacteria at a depository organization based on the Budapest Treaty, and received a deposit number as shown below. Yes.

  Candidate strain 6 was founded in Streptococcus thermophilus OLS3290 (Incorporated Administrative Agency, National Institute of Technology and Evaluation, Patent Biological Depositary Center (Room 2-5-8 Kazusa Kamashi, Kisarazu City, 292-0818, Japan), January 19, 2004. (Deposited on the day of domestic deposit), transferred to international deposit on September 6, 2013, and deposited internationally as deposit number: FERM BP-19638).

  Candidate 7 will be placed in Streptococcus thermophilus OLS3078 (National Institute of Technology and Evaluation, Patent Microorganism Depositary Center (Room 2-5-8 Kazusa, Kazusa, Kisarazu, 292-0818, Japan), August 23, 2013. Date, accession number: internationally deposited as NITE BP-01697) and a new strain.

  Candidate strain 19 was founded in Streptococcus thermophilus OLS3615 (Independent Administrative Institution, Japan Institute for Product Evaluation Technology, Patent Microorganism Depositary Center (Kazusa Kamashi, 2-5-8 122, Kisarazu, Japan 292-0818, Japan), August 23, 2013 Date, accession number: internationally deposited as NITE BP-01696) and a new strain.

Claims (23)

(A) After inoculating a skim milk powder medium adjusted to pH 4.2 to 4.3 by adding lactic acid, in the medium maintained at 35 to 47 ° C., 15 until the pH of 0.2 decreases. Lactobacillus delbrueckii subsp. Bulgaricus fungi, which takes more than time and has mycological properties, and
(B) including Streptococcus thermophilus having a mycological property that does not produce aggregates when inoculated into skim milk medium and cultured at 37-45 ° C. for 12-24 hours and then cooled at 1-10 ° C. , Lactic acid bacteria starter.   The lactic acid bacteria starter according to claim 1, wherein the Lactobacillus delbrueckii subsp. Bulgaricus bacterium is Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 (NITE BP-01569).   Streptococcus thermophilus is one or more selected from the group consisting of Streptococcus thermophilus OLS3615 (NITE BP-01696), Streptococcus thermophilus OLS3078 (NITE BP-01697) and Streptococcus thermophilus OLS3290 (FERM BP-19638), The lactic acid bacteria starter according to claim 1 or 2.   The lactic acid bacteria starter as described in any one of Claims 1-3 for manufacturing fermented milk by which the acidity rise was suppressed.   Streptococcus thermophilus OLS3615 (NITE BP-01696).   Streptococcus thermophilus OLS3078 (NITE BP-01697).   Fermented milk containing Streptococcus thermophilus OLS3615 (NITE BP-01696) or Streptococcus thermophilus OLS3078 (NITE BP-01697). (A) Lactobacillus delbrueckii subsp. Bulgaricus OLL1171 (NITE BP-01569),
(B) Fermentation comprising one or more selected from the group consisting of Streptococcus thermophilus OLS3615 (NITE BP-01696), Streptococcus thermophilus OLS3078 (NITE BP-01697) and Streptococcus thermophilus OLS3290 (FERM BP-19638) milk.   The manufacturing method of fermented milk including the process of adding the lactic acid bacteria starter as described in any one of Claims 1-4 to a raw material mix.   The manufacturing method of Claim 9 including the process of fermenting in 35-45 degreeC and any of 3 to 5 hours.   The production method according to claim 9 or 10, wherein the fermentation process is terminated when the acidity is 0.6 or more and 1.4 or less.   The manufacturing method as described in any one of Claims 9-11 including the deoxygenation process of a raw material mix.   Fermented milk manufactured with the manufacturing method as described in any one of Claims 9-12.   The fermented milk as described in any one of Claim 7, 8 or 13 whose pH is 4.1-4.7.   The fermented milk according to any one of claims 7, 8, 13 and 14, which is refrigerated and stored.   The fermented milk according to claim 15, wherein an increase in acidity is suppressed.   Fermented milk as described in any one of Claims 7, 8 or 13-16 whose acidity is 0.6-1.4. A method for screening Streptococcus thermophilus to produce fermented milk with suppressed acidity,
(A) a step of inoculating a non-fat dry milk medium with a candidate Streptococcus thermophilus;
(B) a step of cooling the skimmed milk powder medium inoculated with the Streptococcus thermophilus bacterium that is a candidate in (a), and then cooling the culture medium;
(C) confirming the formation of aggregates of skim milk powder medium cooled in (b), and
(D) including the step of determining the Streptococcus thermophilus bacterium as a candidate confirmed not to produce an aggregate in (c) as being a Streptococcus thermophilus bacterium for producing fermented milk with suppressed acidity, Said screening method.   The screening method according to claim 18, wherein the nonfat dry milk medium is 8 to 12% by weight of nonfat dry milk and 92 to 88% by weight of water based on 100% by weight of the whole.   The screening method according to claim 19, wherein the yeast extract is mixed with the skim milk powder medium in an amount of 0.05 to 0.15% by weight with respect to 100% by weight of the skim milk powder medium.   The screening method according to claim 20, wherein the candidate Streptococcus thermophilus bacterium is inoculated at 1 to 3% by weight with respect to 100% by weight of the skim milk medium.   The screening method according to any one of claims 18 to 21, wherein the culture in (b) is performed at 37 to 45 ° C for any of 12 to 24 hours.   The screening method according to any one of claims 18 to 22, wherein the cooling of (b) is performed at 1 to 10 ° C.