JPH1036397A - Canine interleukin 12 and its production - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new compound acting on canine leukocyte to induce an antiviral activity factor and an MHC expression promoting factor of canine tumor cell and activating the gemmtated canine lymphocyte and leukocyte. SOLUTION: This new canine interleukin 12 is composed of P40 subunit and P35 subunit expressed by the formula and has at least one potency such as a potency to induce an antiviral activity factor and a class II MHC expression promoting factor of canine tumor cell by acting on canine leukocyte, a potency to activate the proliferation of gemmated canine lymphocyte and a potency to activate canine leukocyte and suppress canine tumor cell. The compound is useful e.g. as an animal drug (antitumor, antiviral and vaccine adjuvant), etc. The compound can be produced by separating mRNA from lymphocyte originating from virus-treated canine spleen, preparing a cDNA library from the mRNA by conventional method, cloning the library and expressing the obtained gene in a host cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a canine interleukin 12 whose primary structure is derived from canine genetic information.
Plasmid, transformant, CaIL12 and method for producing the same for the purpose of mass-producing (hereinafter abbreviated as CaIL12) by a genetic engineering technique and thereby producing an animal drug (anti-tumor / anti-virus / vaccine adjuvant) About.

[0002]

2. Description of the Related Art Interleukin 12 has a molecular weight of about 40.
a cytokine comprising a heterodimer of kD protein (hereinafter abbreviated as P40) and about 35 kD protein (hereinafter abbreviated as P35) and having a physiologically active action such as activating natural killer cells and type 1 helper T cells; This is abbreviated as IL12, and several documents such as Document 1 have been published. In addition to human IL12, mouse (Reference 2) and bovine (GenBank database registration number U1181)
5 and U14416) have also been cloned and are being studied for use as therapeutic agents for tumors and viral diseases.

[0003]

SUMMARY OF THE INVENTION However, dog IL
12 have not yet been reported.

[0004] In dogs, a number of tumors such as mammary gland tumors, a number of viral diseases such as parvovirus infection and distembar infection, and allergic dermatitis are known.

[0005] Therefore, if canine IL12 becomes readily available, it is expected that its use as a canine antitumor agent, antiallergic agent and antiviral agent will be opened.

[0006]

Means for Solving the Problems In view of such circumstances, the present inventors aimed at cloning CaIL12 cDNA and mass-producing it using it, and made an ingenuity, encoding P40 and P35 of CaIL12 from canine cDNA. Successfully cloned each gene,
Furthermore, cells that produce CaIL12 were successfully produced using two plasmids ligated to an expression vector, thereby establishing a method for easily producing CaIL12 in large quantities, and thus completing the present invention. Was.

That is, the present invention relates to a plasmid for producing CaIL12, a transformant of Escherichia coli having these plasmids, an animal cell transformed with the plasmid, and a plasmid obtained from these transformants.
aIL12 is provided. Further, the present invention relates to Ca
Also provided are genes encoding each of the two subunits of the IL12 protein.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION The CaIL12 protein of the present invention
Plasmids incorporating DNAs encoding the three subunits can be produced, for example, as follows. That is, after poly (A) RNA is extracted from dog cells, cDNA is synthesized, and the polymerase chain reaction (hereinafter referred to as "the primer") is performed using primers based on the gene sequences respectively encoding the two subunits of bovine and human IL12. By carrying out PCR (abbreviated as PCR), two genes each encoding two subunits exhibiting CaIL12 activity can be cloned. In addition, a phage library was prepared from the synthesized cDNA recombinant, and plaque hybridization was performed with the two gene fragments obtained by PCR to obtain CaIL.
The full length of 12P40 cDNA and CaIL12P35 cDNA can be cloned.

[0009] RNA from dog organs and cells, such as dog mononuclear cells and lymphocytes stimulated with mitogen, etc.
As a method for obtaining, there can be mentioned, for example, a method using polysome separation, sucrose density gradient centrifugation and electrophoresis. RNA from the above dog organs and dog cells
As a method for extracting guanidine thiocyanate, a guanidine thiocyanate-cesium chloride method (Reference 3) in which CsCl density gradient centrifugation is performed, followed by treatment with a surfactant using a vanadium complex in the presence of a ribonuclease inhibitor, followed by phenol extraction Method (Reference 4), guanidine thiocyanate-hot phenol method, guanidine thiocyanate-guanidine hydrochloride method, guanidine thiocyanate-phenol-chloroform method, treatment with guanidine thiocyanate, and treatment with lithium chloride to precipitate RNA An appropriate method can be selected from the methods and the like.

MRNA is isolated from dog mononuclear cells or lymphocytes stimulated with canine organs or mitogens by a conventional method, for example, lithium chloride / urea method, guanidine / isothiocyanate method, oligo dT cellulose column method and the like. , From the obtained mRNA by a conventional method, for example, G
Ubler et al. (Reference 5); CDNA is synthesized by the method of Okayama et al. In order to synthesize cDNA from the obtained mRNA, basically, a method using a reverse transcriptase such as avian osteoblast virus (AMV) or the like and a method using a DNA polymerase using a partial primer may be used. It is convenient to use a commercially available synthesis or cloning kit.

Using this cDNA as a template, a primer was prepared based on human, mouse and bovine nucleotide sequences, and
By performing R, genes encoding the P40 subunit and the P35 subunit exhibiting CaIL12 activity can be cloned. Also, the synthesized c
After ligating the DNA to the λ phage vector, the phage particles are packaged in vitro by mixing with a λ phage coat protein and the like, and the resulting phage particles are infected to E. coli as a host. At this time, the E. coli infected with the λ phage is lysed, and each clone is recovered as a plaque. The plaque was transferred to a filter such as nitrocellulose, and Ca was subjected to hybridization using a gene obtained by radiolabeled PCR as a probe.
IL12P40 cDNA and CaIL12P35cD
The full length of NA can be cloned.

Prokaryote or eukaryote can be used as a host. As prokaryotes, bacteria, particularly Escherichia coli, Bacillus bacteria, such as Bacillus subtilis, can be used. As eukaryotes, yeasts, for example, yeasts of the genus Saccharomyces, such as Saccharomyces cerevisiae, are used.
es cerevisiae, eukaryotic microorganisms, insect cells, for example, yoga cells (Spodoptera f.
rugiperda), cabbage looper cells (Tri
choplusiani) and silkworm cells (Bombyx)
mori), animal cells such as human cells, monkey cells,
Mouse cells and the like can be used. In the present invention, an organism itself, for example, an insect, for example, a silkworm, a cabbage looper, or the like can also be used.

As expression vectors, plasmids, phages, phagemids, viruses (baculo (insects), vaccinia (animal cells)) and the like can be used. The promoter in the expression vector is selected depending on the host bacterium. For example, a lac promoter, t
The rp promoter and the like are used, and as the yeast promoter, for example, the adh1 promoter, the pqk promoter and the like are used. Insect promoters include baculovirus polyhedrin promoter, p10
Simian Vi for animal cells such as promoters
rus40 early or late promoter, but is not limited thereto. Transformation of a host with an expression vector can be performed by conventional methods well known in the art, and these methods are described, for example, in Current Protocols in Mo.
rectangular Biology, John Wile
y & Sons. Culture of the transformant can also be performed according to a conventional method.

The produced CaIL12 has an apparent molecular weight of about 70 to 80 kD as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under non-reducing conditions.

In SDS-PAGE, a band of 70 to 80 kD shows a molecular weight of about 40 kD and about 35 kD under reducing conditions.
This gives rise to two subunits of D. As shown in Example 2 below, CaIL12 is mainly characterized by its ability to induce canine interferon gamma from canine leukocytes and its effect of promoting the proliferation of canine lymphocytes stimulated with phytohemagglutinin (hereinafter abbreviated as PHA). Is done. In addition, NK cells and cytotoxic T cells are activated to activate their target cells,
For example, it has the activity of lysing cell lines derived from tumors or fibroblasts infected with viruses.

[0016]

The present invention will now be described more specifically with reference to examples.

Example 1 Cloning of CaIL12P40 and P35 Genes (1) Preparation of Canine cDNA Canine liver, dog peripheral blood mononuclear cells stimulated with LPS (50 μg / ml) for 48 hours, and chicken Newcastle disease virus were treated for 7 hours ( 10 ⁷ pfu / ml) lymphocytes from dog spleen ISOGEN (Nippon Gene)
Was used to prepare total RNA. 1 mM of the obtained RNA
10 mM Tris-HCl buffer containing EDTA (pH
7.5) (hereinafter abbreviated as TE), treated at 70 ° C. for 5 minutes, and added the same amount of TE containing 1 M LiCl. The RNA solution was applied to an oligo dT cellulose column equilibrated with TE containing 0.5 M LiCl, and washed with the same buffer. After washing with TE containing 0.3 M LiCl, 2 mM ED containing 0.01% SDS was used.
The poly (A) RNA adsorbed by TA (pH 7.0) was eluted. Using the poly (A) RNA thus obtained, a single-stranded cDNA was synthesized. That is, sterilized 0.5 ml
5 μg of poly (A) RNA and 0.5 μg of oligo dT primer (12-18 me
r) was added thereto, sterilized water treated with diethylpyrocarbonate was added to make 12 μl, and the mixture was incubated at 70 ° C. for 10 minutes and then placed on ice for 1 minute. 200 μM Tris-HCl (pH 8.4) and 500 mM KCl solution
1, ₂ mM of 25 mM MgCl 2, 10 mM dNT
After adding 1 μl of P and 2 μl of 0.1 M DTT, respectively, and incubating at 42 ° C. for 5 minutes, 200 units of SuperScript manufactured by GibcoBRL were added.
1 μl of II RT was added, and the mixture was further incubated at 42 ° C. for 50 minutes to perform a cDNA synthesis reaction. 7 more
The reaction was stopped by incubating at 0 ° C. for 15 minutes and placed on ice for 5 minutes. 1 μl of E. coli was added to the reaction solution. coli
RNaseH (2 units / ml) was added and incubated at 37 ° C for 20 minutes.

(2) Preparation of canine cDNA phage library Using 1 μg of the poly (A) RNA obtained in the above (1), an oligo dT primer was used according to the attached manual using a time saver cDNA synthesis kit of Pharmacia. To synthesize a double-stranded cDNA, and furthermore, EcoRI /
NotI adapter was ligated. Using this, the cDNA Rapid cloning module of Amersham-λ
gt10 according to the attached manual according to the recombinant λgt1
0 vector was prepared, and a recombinant phage was prepared using an in vitro packaging module of Amersham according to the attached manual. (3) Cloning of CaIL12P40 gene 5′ATGTGTCACCAGCAGTTGGTCAT based on the N-terminal and C-terminal nucleotide sequences of human IL12P40 (Reference 1)
CTCTTGGTTT3 '(SEQ ID NO: 3) and 5' CTAACTGCAGGGCACAGATGGCCC
Two kinds of primers of A3 '(SEQ ID NO: 4) were synthesized with a DNA synthesizer. 2 μl of the cDNA obtained from the dog liver and the peripheral blood of the LPS-stimulated dog in (1) above was placed in a separate 0.5 ml microcentrifuge tube, and each primer was prepared at 20 pm.
ol, 20 mM Tris-HCl buffer (pH 8.0), 1.
5 mM MgCl ₂ , 25 mM KCl, 100 μg /
ml gelatin, 50 μM each dNTP, 4 units Taq
Add each reagent so that it becomes DNA polymerase.
Make it 00 μl. DNA denaturation conditions were 94 ° C for 1 minute, primer annealing conditions were 55 ° C for 2 minutes, and primer extension conditions were 72 ° C for 3 minutes.
Using a DNA thermal cycler manufactured by Elmer Cetus, the reaction was performed for 35 cycles. This was electrophoresed on a 1% agarose gel, and a DNA fragment of about 990 bp was prepared according to a conventional method (Reference 7).

This DNA fragment was transferred to T-Vector of Invitrogen and DNA Liga of Takara Shuzo Co., Ltd.
Tion Kit Ver. 1 and ligated. Using this, Escherichia coli was transformed according to a conventional method, and a plasmid DNA was prepared from the obtained transformant by a conventional method. Next, it was confirmed that the PCR fragment was inserted into this plasmid by PCR under the same conditions as described above.
s2000 DNAanalysis system
Using (Dupont), the base sequence of one of the P40 subunit DNAs of the two subunits likely to exhibit CaIL12 activity was determined by the dideoxy method (Reference 9). This sequence is shown in SEQ ID NO: 1. Also, a 990 bp DNA fragment containing this sequence was added to Ra from Takara Shuzo Co., Ltd.
ndom Primer DNA Labeling
³² P was labeled using Kit to prepare a probe. The recombinant phage library prepared from the canine liver cDNA obtained in the above (2) was formed as a plaque on Escherichia coli NM514, and Hybond-N of Amersham was used.
+ Was transferred according to a conventional method. Hybond-N + is 5
× SSPE (0.9 M NaCl, 50 mM NaH ₂
PO ₄ , 5 mM EDTA, pH 7.4), 5 × Denhardt's solution (0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.1% SD
S, incubated in 100 μg / ml salmon sperm DNA at 65 ° C. for 2 hours, and then hybridized in the same solution with 1 × 10 ⁶ cpm / ml of the labeled probe prepared as described above. After overnight incubation at 65 ° C., Hybond-N + was added to 0.2 × SSC (30 mM
NaCl, 3 mM sodium citrate), 0.1% SD
After washing in S for 15 minutes three times, the film was exposed to a Fuji Imaging Plate of Fuji Photo Film Co., Ltd. for 12 hours and analyzed with a bio-imaging analyzer of Fuji Photo Film Co., Ltd. Plaques having a positive signal were rescreened according to a conventional method. As a result of the three screenings, one recombinant phage having a positive signal was obtained. A phage DNA was extracted from the recombinant phage according to a conventional method and cut with a restriction enzyme EcoRI.
A DNA fragment obtained by 1% agarose gel electrophoresis was prepared according to a conventional method, and DNA Ligat of Takara Shuzo Co., Ltd. was used.
ion Kit Ver. 2 using pUC118BAP-treated DNA (EcoRI / BAP) from Takara Shuzo Co., Ltd.
And connected. Using this, a plasmid DNA was prepared by a conventional method, and obtained using a fluorescent DNA sequencer (DNA sequencer 373S manufactured by PerkinElmer) and according to the attached protocol using a dye terminator cycle sequencing kit manufactured by PerkinElmer. The nucleotide sequence of the DNA fragment was determined. Of these, Ca
The sequence encoding IL12P40 is shown in SEQ ID NO: 11.

(4) Cloning of CaIL12P35 gene N-terminal of human IL12P35 (Reference 1) and bovine IL
Based on the C-terminal base sequence of 12P35, 5′AGCATGTGTCCAGCGCGCAGCCT
CCTCCTTGTCGCCTACCCTG 3 '(SEQ ID NO: 5) and 5' CTAGGAAGAACTCAGATAGCTCA
Two primers, TCATTCTGTCGATGGT3 '(SEQ ID NO: 6), were synthesized using a DNA synthesizer. Using a cDNA obtained from canine spleen-derived lymphocytes treated with chicken Newcastle disease virus in the above (1) as a template, a DNA fragment of about 670 bp was obtained in the same manner as in the above (3), inserted into T-Vector, and CaIL12 activity was obtained. P3 of one of the two subunits
The nucleotide sequence of the 5-subunit DNA was determined. This sequence is shown in SEQ ID NO: 2. Also, about 670b containing this sequence
A labeled probe was prepared using the p DNA fragment. A recombinant phage library prepared from cDNA obtained from canine spleen-derived lymphocytes treated with chicken Newcastle disease virus obtained in (2) above was hybridized with a labeled probe in the same manner as in (3) above. Screening was performed. DNA was extracted from one recombinant phage having a positive signal obtained as a result, cut with a restriction enzyme NotI, and a DNA fragment of about 1.2 kb obtained by 1% agarose gel electrophoresis was subjected to STRATAG.
It was ligated to the NotI site of pBluescriptII from ENE according to a conventional method. Using this, plasmid DN
A was prepared, and the nucleotide sequence of the obtained DNA fragment was determined using a fluorescent DNA sequencer. Of these, CaI
The sequence encoding L12P35 is shown in SEQ ID NO: 12.

Example 2 Production of CaIL12 (1) Preparation of CaIL12 Expression Vector The expression vector pCDL-SRα296 (Reference 9) was digested with the restriction enzyme EcoRI, and the end was dephosphorylated with bacterial alkaline phosphatase. This was subjected to 1% agarose gel electrophoresis to prepare a DNA fragment of about 3.6 kb according to a conventional method. On the other hand, the CaIL12P40 DNA fragment is 5′GGGGAATTCATGTGTTCACCAGCA
GTTGGTCATCTCTTGG3 '(SEQ ID NO: 7) and 5'CCCGATATTCCTAACTGCAGGGCA
A primer to which two types of EcoRI cleavage sites of CAGATGCCCAGTCGCT3 ′ (SEQ ID NO: 8) were added was prepared, and two subunits which are considered to exhibit CaIL12 activity inserted into the T-Vector prepared in Example 1 (2) were prepared. Using one of the P40 subunit DNAs as a template, PCR was performed under the conditions of DNA denaturation of 94 ° C. for 1 minute, primer annealing conditions of 55 ° C. for 2 minutes, primer extension conditions of 72 ° C. for 3 minutes, and a cycle number of 30. ,
After ethanol precipitation, digestion with restriction enzyme EcoRI and 1%
A DNA fragment of about 990 bp was prepared by agarose gel electrophoresis. Also, 5'GGGGAATTCATGCATCCTCAGCA
GTTGGTCATCTCCTGG3 ′ (SEQ ID NO: 1
3) and 5 'CCCGAATTCCTAACTGCAGGACA
CAGATGCCCAGTCGCT3 '(SEQ ID NO: 1
4) A primer to which the two types of EcoRI cleavage sites were added was prepared, PCR was performed using the CaIL12P40 DNA inserted into pUC118 prepared in Example 1 (2) as a template, and the PCR was performed, followed by digestion with EcoRI, and a DNA fragment of about 990 bp. Prepared. Each of the obtained CaIL12P40D
The NA fragment was ligated to pCDL-SRα296 prepared as described above using T4 DNA ligase. Escherichia coli was transformed therewith, plasmid DNA was prepared from the resulting transformant, and FOCaIL12P40 and FOCaIL12P4 expressing CaIL12P40.
0FL was obtained. After pCDL-SRα296 was digested with the restriction enzyme PstI and dephosphorylated, it was electrophoresed to about 3.
A 6 kb DNA fragment was prepared. CaIL12P35D
The NA fragment is 5'GGGCTGCAGATGGTTCCCAGCGCG
CAGCCTCCTCCCTTGTTC3 '(SEQ ID NO: 9) and 5' GGGCTGCAGCTAGGAAGAACTCA
GATAGCTCATCATCTCT3 '(SEQ ID NO: 1
0), a primer to which two types of PstI cleavage sites were added was prepared, and one of the two subunits, which is considered to exhibit CaIL12 activity, inserted into the T-Vector prepared in Example 1 (3), the P35 subunit Using DNA as a template, 94 ° C, 1 minute, 55 ° C, 2 minutes, 72 ° C, 3 minutes, 3
PCR was performed in 0 cycles, and after ethanol precipitation, it was cut with the restriction enzyme PstI. This was subjected to 1% agarose gel electrophoresis to prepare a DNA fragment of about 670 bp. Also, 5′GGGCTGCAGATGTGCCCCGCCGCG
CGGCCTCCCTCCTTGTG3 ′ (SEQ ID NO: 1
5) and 5'GGGCTGCAGTTAGGAAGAATTCA
GATAACTCATCATCTCT3 '(SEQ ID NO: 1
6) A primer to which two types of PstI cleavage sites were added was prepared, PCR was carried out using the CaIL12P35 DNA inserted into pUC118 prepared in Example 1 (2) as a template, and cut with PstI to obtain a DNA fragment of about 670 bp. Prepared. Obtained CaIL12P35 DNA
The fragment was purified using T4 DNA ligase as described above for Ps
Ligation to pCDL-SRα296 prepared by cutting with tI,
After performing E. coli transformation and plasmid DNA preparation, CaI
FOCaIL12P35 and FOCaIL12P35FL expressing L12P35 were obtained.

Furthermore, CaIL12P40 DNA and CaIL12 in these four expression plasmids were prepared.
The nucleotide sequence of P35 DNA was confirmed.

(2) Production of CaIL12 in monkey COS cells 5 μg each of FOCaIL1 obtained in (1) above
2P40 and FOCaIL12P35 were mixed with 50 mM Tris-HCl buffer (pH 7.5), 400 μg / ml DE.
AE dextran (Pharmacia) and 100 μM
ERDF medium (manufactured by Far East Pharmaceutical Co., Ltd.) containing chloroquine (Sigma). On the other hand, diameter 10c
using an ERDF medium containing 10% fetal bovine serum (Gibco, hereinafter abbreviated as FBS).
After washing the COS-1 cells (ATCC CRL-1650) once grown to% confluence with PBS once, 4 ml of the DNA mixture obtained above was added and 5% C
The cells were cultured under conditions of O ₂ and 37 ° C. After 4 hours, the cells are
After washing with S, the cells were cultured in 10 ml of 10% FBS-ERDF medium under conditions of 5% CO ₂ and 37 ° C. for 4 days.
A culture supernatant from which IL12 was produced was obtained.

(3) Measurement of activity of CaIL12 The activity of CaIL12 produced in the above (2) was measured as follows. Canine intact from canine lymphocytes
For the feron γ-inducing activity assay, the antiviral activity and the activity of enhancing the expression of class II MHC in dog cells were measured.

Lymphocytes were isolated from dog spleen, and 10% F
The cells were suspended at a cell density of 10 ⁶ cells / ml with BS-ERDF, and 2.5 ml of the cells was added to a 6 cm dish. 2.5 ml of the culture supernatant obtained in (2) above
And cultured for 2 days under conditions of 5% CO ₂ and 37 ° C., and as a virus, Vesicular Stimati.
s Virus, MDCK (ATCC
The antiviral activity of this culture was measured using CCL-34) according to the CPE method of Reference 10. As a result, 1
0 ⁵ dilution units / ml or more antiviral activity was confirmed. On the other hand, in the control cell culture in which 10 μg of pCDL-SRα296 was introduced into COS-1 cells in the same manner as in (2) above, no ability to induce antiviral activity was observed.

Using the canine mammary gland tumor tissue-derived cell line FCBR1 which expressed class II MHC, the activity of enhancing the expression of class II MHC in the above-mentioned culture supernatant of dog spleen lymphocytes was measured. 10 ⁵ cells F on 6cm dish
5 ml of dog spleen lymphocyte culture supernatant stimulated with CaIL12 was added thereto, and 5% CO ₂ ,
The cells were cultured overnight at 37 ° C. After the culture, the cells were detached with trypsin and centrifuged in a 1.5 ml microcentrifuge tube. 10 μl of rat anti-dog MHC class I
I monoclonal antibody (Stratagene) was added, and the suspension was further suspended in 50 μl of 10% FBS-ERDF, and left still on ice for 1 hour. After washing with PBS, 5
of FITC-labeled rabbit anti-rat monoclonal antibody (Stratagene) and 50 μl of 10
The cells were suspended in% FBS-ERDF and left on ice for 1 hour.
After washing with PBS, Fecton Dickinson
Analysis was performed using ACSScan. As a result, the culture supernatant of canine spleen lymphocytes stimulated with CaIL12 increased the expression of class II MHC on FCBR1 by about 20%.
From these results, it was found that CaIL12 acts on canine lymphocytes and has an activity of inducing canine interferon-γ.

Further, the proliferation promoting activity of the blasted dog lymphocytes was measured. Separating lymphocytes from dog peripheral blood,
The cells were suspended at a cell density of 10 ⁶ cells / ml in 0% FBS-ERDF, and 5 ml of the suspension was added to a 6 cm dish. PHA (manufactured by ICN) was added thereto at a concentration of 5 μg / ml, and the cells were cultured for 3 days under conditions of 5% CO ₂ and 37 ° C. to make lymphocytes blast. This blast cell lymphocyte
Suspend the cells at a cell density of 10 ⁶ cells / ml with 0% FBS-ERDF, and add 5
0 μl was added. To this, 50 μl of the culture supernatant obtained in the above (2) was added per well. In addition, 50 μl of 10% FBS-ERDF was added per well as a control. These were further cultured under conditions of 5% CO ₂ and 37 ° C. for 3 days.
The blast-forming lymphocyte proliferation promoting activity of IL12 was measured. That is, a 5 mg / ml MTT (Sigma) solution was added to 1
10 μl was added per well, and the cells were further cultured for 6 hours.
After adding 150 μl of a 0.04 N isopropanol hydrochloride solution, the cells were crushed by ultrasonic waves, and the absorbance at a wavelength of 595 nm was measured with a micro pre-trider (Model 3550 manufactured by BIO-RAD). As a result, while the absorbance of the control was 0.69 on average, Ca
IL12 had an average of 1.52, indicating that the blast-producing lymphocyte proliferation promoting activity was about twice as high.

Further, the antitumor effect of CaIL12 on dog tumors was examined. Lymphocytes were separated from canine peripheral blood, and 5 × 10 ⁶ cells / 10% FBS-ERDF were used.
The cells were suspended at a cell density of ml, and 5 ml of the suspension was added to a 6 cm dish. To this, 500 U of recombinant human IL2 from Boehringer Mannheim KK was added,
The cells were cultured under conditions of 5% CO ₂ and 37 ° C. for 3 days. On the other hand, the dog tumor cell lines FCBR1 and A72 (ATCC CR
L-1542) with 10% FBS-ERDF for each 1
0 ⁵ was suspended in a cell density of cells / ml, 96 well plate - sheet 1 was added 50μl increments per hole, pre - adhered to and. 50 μL of dog lymphocytes stimulated with human IL2
and 100 μl of the culture supernatant obtained in the above (2) expressing CaIL12 or 100 μl of 10% FBS-ERDF as a control, followed by culturing at 5% CO ₂ at 37 ° C. for 2 days. did. After the culture, the supernatant was completely removed, and an MTT assay was performed.
% Cytotoxicity was calculated by the following equation.

% Cytotoxicity = (1-OD ₂ / OD ₁ ) × 100 where OD ₁ = absorbance at 595 nm wavelength of canine tumor cells cultured in medium alone OD ₂ = of canine tumor cells cultured with canine lymphocytes It represents the absorbance at a wavelength of 595 nm.

As a result, control was 34% for FCBR1, whereas CaIL12 was 75% cytotoxic. In A72, the control is 22
%, Whereas CaIL12 showed 83% cytotoxicity. From these results, it was found that CaIL12 activates canine lymphocytes and exerts an antitumor effect on canine tumor cells.

References 1. Wolf et al. Immunol. 146,307
4-3081 (1991). 2. Schoenhout et al. Immunol. 1
48, 3433-3440 (1992). 3. Chirgwin et al .: Biochemistry
18, 5294-5304 (1979). 4. Berger et al .: Biochemistry 1
8, 5143-5149 (1979). 5. Gubler et al .: Gene 25, 236-269.
(1983). 6. Okayama et al .: Mol. Cell. Biol.
2,161-170 (1982) & 3,280-2
89 (1983). 7. Molecular Cloning. Cold
Spring Harbor Laboratory.
New York. 1982. 8. Prober et al .: Science 238, 336
-341 (1987). 9. Takebe et al .: Mol. Cell. Biol.
8, 466-472 (1988). 10. F. L. Grabam et al .: Virology 5
4,536-539 (1973). 11. Mosmann et al. Immunol. Met
hods 65, 55-63 (1983)

[0032]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 990 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: cDNA to mRNA Origin Organism: Canine Sequence characteristics Characteristic symbol: peptide Location : 1..987 Method for determining characteristics: S sequence ATG TGT CAC CAG CAG TTG GTC ATC TCT TGG TTT TCC CTC GTT TTG CTG 48 Met Cys His Gln Gln Leu Val Ile Ser Trp Phe Ser Leu Val Leu Leu GCG TCT CCC CTC ATG GCC ATA TGG GAA CTG GAG AAA GAT GTT TAT GTT 96 Ala Ser Pro Leu Met Ala Ile Trp Glu Leu Glu Lys Asp Val Tyr Val GTA GAG TTG GAC TGG CAC CCT GAT GCC CCC GGA GAA ATG GTG GTC CTC 144 Val Glu Leu Asp Trp His Pro Asp Ala Pro Gly Glu Met Val Val Leu ACC TGC CAT ACC CCT GAA GAA GAT GAC ATC ACT TGG ACC TCA GCG CAG 192 Thr Cys His Thr Pro Glu Glu Glu Asp Asp Ile Thr Trp Thr Ser Ala Gln AGC AGT GAA GTC CTA GGT TCT GGT AAA ACT CTG ACC ATC CAA GTC AAA 240 Ser Ser Glu Val Leu Gly Ser Gly Lys Thr Leu Thr Ile Gln Val Lys GAA TTT GGA GAT GCT GGC CAG TAT ACC TGC CAT AAA GGA GGC AAG GT T 288 Glu Phe Gly Asp Ala Gly Gln Tyr Thr Cys His Lys Gly Gly Lys Val CTG AGC CGC TCA CTC CTG TTG ATT CAC AAA AAA GAA GAT GGA ATT TGG 336 Leu Ser Arg Ser Leu Leu Leu Ile His Lys Lys Glu Asp Gly Ile Trp TCC ACT GAT ATC TTA AAG GAA CAG AAA GAA TCC AAA AAT AAG ATC TTT 384 Ser Thr Asp Ile Leu Lys Glu Gln Lys Glu Ser Lys Asn Lys Ile Phe CTG AAA TGT GAG GCA AAG AAT TAT TCT GGA CGT TTC ACA TGC TGG TGG 432 Leu Lys Cys Glu Ala Lys Asn Tyr Ser Gly Arg Phe Thr Cys Trp Trp CTG ACG GCA ATC AGT ACT GAT TTG AAA TTC AGT GTC AAA AGT AGC AGA 480 Leu Thr Ala Ile Ser Thr Asp Leu Lys Phe Ser Val Lys Ser Ser Arg GGC TTC TCT GAC CCC CAA GGG GTG ACA TGT GGA GCA GTG ACA CTT TCA 528 Gly Phe Ser Asp Pro Gln Gly Val Thr Cys Gly Ala Val Thr Leu Ser GCA GAG AGG GTC AGA GTG GAC AAC AGG GAT TAT AAG AAG TAC ACA GTG 576 Ala Glu Arg Val Arg Val Asp Asn Arg Asp Tyr Lys Lys Tyr Thr Val GAG TGT CAG GAG GGC AGT GCC TGC CCC TCT GCC GAG GAG AGC CTA CCC 624 Glu Cys Gln Glu Gly Ser Ala Cys Pro Ser Ala Glu Glu Glu Ser Leu Pro ATC GA G GTC GTG GTG GAT GCT ATT CAC AAG CTC AAG TAT GAA AAC TAC 672 Ile Glu Val Val Val Asp Ala Ile His Lys Leu Lys Tyr Glu Asn Tyr ACC AGC AGC TTC TTC ATC AGA GAC ATC ATC AAA CCA GAC CCA CCC ACA 720 Thr Ser Ser Phe Phe Ile Arg Asp Ile Ile Lys Pro Asp Pro Pro Thr AAC CTG CAG CTG AAG CCA TTG GAA AAT TCT CGG CAC GTG GAG GTC AGC 768 Asn Leu Gln Leu Lys Pro Leu Glu Asn Ser Arg His Val Glu Val Ser TGG GAA TAC CCC GAC ACC TGG AGC ACC CCA CAT TCC TAC TTC TCC CTG 816 Trp Glu Tyr Pro Asp Thr Trp Ser Thr Pro His Ser Tyr Phe Ser Leu ACA TTT TGC ATA CAG GCC CAG GGC AAG AAC AAT AGA GAA AAG AAA GAT 864 Thr Phe Cys Ile Gln Ala Gln Gly Lys Asn Asn Arg Glu Lys Lys Asp AGA CTC TGC GTG GAC AAG ACC TCA GCC AAG GTC GTG TGC CAC AAG GAT 912 Arg Leu Cys Val Asp Lys Thr Ser Ala Lys Val Val Cys His Lys Asp GCC AAG ATC CGC GTG CAA GCC CGA GAC CGC TAC TAT AGT TCA TCC TGG 960 Ala Lys Ile Arg Val Gln Ala Arg Asp Arg Tyr Tyr Ser Ser Ser Trp AGC GAC TGG GCA TCT GTG CCC TGC AGT TAG 990 Ser Asp Trp Ala Ser Val Pro Cys Ser ** *

SEQ ID NO: 2 Sequence length: 669 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA origin Organism: dog Sequence characteristics Characteristic symbols: peptide Location: 1..666 Method for determining characteristics: S sequence ATG TGT CCA GCG CGC AGC CTC CTC CTT GTC GCT ACC CTG GTC CTG CTA 48 Met Cys Pro Ala Arg Ser Leu Leu Leu Val Ala Thr Leu Val Leu Leu AGC CAC CTG GAC CAC CTT ACT TGG GCC AGG AGC CTC CCC ACA GCC TCA 96 Ser His Leu Asp His Leu Thr Trp Ala Arg Ser Leu Pro Thr Ala Ser CCA AGC CCA GGA ATA TTC CAG TGC CTC AAC CAC TCC CAA AAC CTG CTG 144 Pro Ser Pro Gly Ile Phe Gln Cys Leu Asn His Ser Gln Asn Leu Leu AGA GCC GTC AGC AAC ACG CTT CAG AAG GCC AGA CAA ACT CTA GAA TTA 192 Arg Ala Val Ser Asn Thr Leu Gln Lys Ala Arg Gln Thr Leu Glu Leu TAT TCC TGC ACT TCC GAA GAG ATT GAT CAT GAA GAT ATC ACA AAG GAT 240 Tyr Ser Cys Thr Ser Glu Glu Ile Asp His Glu Asp Ile Thr Lys Asp AAA ACC AGC ACA GTG GAG GCC TGC TTA CCA CTG GAA TTA ACC ATG AAT 288 Lys Thr Ser Thr Val Glu Ala Cys Leu Pro Leu Glu Leu Thr Met Asn GAG AGT TGC CTG GCT TCC AGA GAG ATC TCT TTG ATA ACT AAC GGG AGT 336 Glu Ser Cys Leu Ala Ser Arg Glu Ile Ser Leu Ile Thr Asn Gly Ser TGC CTG GCC TCT GGA AAG GCC TCT TTT ATG ACG GTC CTG TGC CTT AGC 384 Cys Leu Ala Ser Gly Lys Ala Ser Phe Met Thr Val Leu Cys Leu Ser AGC ATC TAT GAG GAC TTG AAG ATG TAC CAG ATG GAA TTC AAG GCC ATG 432 Ser Ile Tyr Glu Asp Leu Lys Met Tyr Gln Met Glu Phe Lys Ala Met AAC GCA AAG CTT TTA ATG GAT CCC AAG AGG CAG ATC TTT CTG GAT CAA 480 Asn Ala Lys Leu Leu Met Asp Pro Lys Arg Gln Phe Leu Asp Gln AAC ATG CTG ACG GCT ATC GAT GAG CTG TTA CAG GCC CTG AAT TTC AAC 528 Asn Met Leu Thr Ala Ile Asp Glu Leu Leu Gln Ala Leu Asn Phe Asn AGT GTG ACT GTG CCA CAG AAA TCC TCC CTT GAA GAG CC GAT TTT TAT 576 Ser Val Thr Val Pro Gln Lys Ser Ser Leu Glu Glu Pro Asp Phe Tyr AAA ACT AAA ATC AAG CTC TGC ATA CTT CTT CAT GCT TTC AGA ATT CGT 624 Lys Thr Lys Ile Lys Leu Cys Ile Leu Leu His Ala PheArg Ile Arg GCG GTG ACC ATC GAC AGA ATG ATG AGC TAT CTG AGT TCT TCC TAG 669 Ala Val Thr Ile Asp Arg Met Met Ser Tyr Leu Ser Ser Ser ***

SEQ ID NO: 3 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence ATGTGTCACC AGCAGTTGGT CATCTCTTGG TTT 33

SEQ ID NO: 4 Sequence length: 24 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CTAACTGCAG GGCACAGATG CCCA 24

SEQ ID NO: 5 Sequence length: 42 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence AGCATGTGTC CAGCGCGCGCAG CCTCCTCCTT GTCGCTACCC TG 42

SEQ ID NO: 6 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CTAGGAAGAA CTCAGATAGC TCATCATTCT GTCGATGGT 39

SEQ ID NO: 7 Sequence length: 39 Sequence type: number of nucleic acid strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGGGAATTCA TGTGTCTCCA GCAGTTGGTC ATCTCTTGG 39

SEQ ID NO: 8 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CCCGAATTCC TAACTGCAGG GCACAGATGC CCAGTCGCT 39

SEQ ID NO: 9 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGGCTGCAGA TGTGTCCAGC GCGCAGCCTC CTCCTTGTC 39

SEQ ID NO: 10 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGGCTGCAGC TAGGAAGAAC TCAGATAGCT CATCATTCT 39

SEQ ID NO: 11 Sequence length: 990 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin Organism name: Canine Sequence characteristics Characteristic symbols: Position of peptide: 1..987 Method for determining characteristics: S sequence ATG CAT CCT CAG CAG TTG GTC ATC TCC TGG TTT TCC CTC GTT TTG CTG 48 Met His Pro Gln Gln Leu Val Ile Ser Trp Phe Ser Leu Val Leu Leu GCG TCT CCC CTC ATG GCC ATA TGG GAA CTG GAG AAA GAT GTT TAT GTT 96 Ala Ser Pro Leu Met Ala Ile Trp Glu Leu Glu Lys Asp Val Tyr Val GTA GAG TTG GAC TGG CAC CCT GAT GCC CCC GGA GAA ATG GTG GTC CTC 144 Val Glu Leu Asp Trp His Pro Asp Ala Pro Gly Glu Met Val Val Leu ACC TGC CAT ACC CCT GAA GAA GAT GAC ATC ACT TGG ACC TCA GCG CAG 192 Thr Cys His Thr Pro Glu Glu Asp Asp Ile Thr Trp Thr Ser Ala Gln AGC AGT GAA GTC CTA GGT TCT GGT AAA ACT CTG ACC ATC CAA GTC AAA 240 Ser Ser Glu Val Leu Gly Ser Gly Lys Thr Leu Thr Ile Gln Val Lys GAA TTT GGA GAT GCT GGC CAG TAT ACC TGC CAT AAA GGA GGC AAG GTT 288 Glu Phe Gly Asp Ala Gly Gln Tyr Thr Cys His Lys Gly Gly Lys Val CTG AGC CGC TCA CTC CTG TTG ATT CAC AAA AAA GAA GAT GGA ATT TGG 336 Leu Ser Arg Ser Leu Leu Leu Ile His Lys Lys Glu Asp Gly Ile Trp TCC ACT GAT ATC TTA AAG GAA CAG AAA GAA TCC AAA AAT AAG ATC TTT 384 Ser Thr Asp Ile Leu Lys Glu Gln Lys Glu Ser Lys Asn Lys Ile Phe CTG AAA TGT GAG GCA AAG AAT TAT TCT GGA CGT TTC ACA TGC TGG TGG 432 Leu Lys Cys Glu Ala Lys Asn Tyr Ser Gly Arg Phe Thr Cys Trp Trp CTG ACG GCA ATC AGT ACT GAT TTG AAA TTC AGT GTC AAA AGT AGC AGA 480 Leu Thr Ala Ile Ser Thr Asp Leu Lys Phe Ser Val Lys Ser Ser Arg GGC TTC TCT GAC CCC CAA GGG GTG ACA TGT GGA GCA GTG ACA CTT TCA 528 Gly Phe Ser Asp Pro Gln Gly Val Thr Cys Gly Ala Val Thr Leu Ser GCA GAG AGG GTC AGA GTG GAC AAC AGG GAT TAT AAG AAG TAC ACA GTG 576 Ala Glu Arg Val Arg Val Asp Asn Arg Asp Tyr Lys Lys Tyr Thr Val GAG TGT CAG GAG GGC AGT GCC TGC CCC TCT GCC GAG GAG AGC CTA CCC 624 Glu Cys Gln Glu Gly Ser Ala Cys Pro Ser Ala Glu Glu Ser Leu Pro ATC GAG GTC GTG GTG GAT GCT ATT CAC AAG CTC AAG TAT GAA AAC TAC 672 Ile Glu Val Val Val Asp Ala Ile His Lys Leu Lys Tyr Glu Asn Tyr ACC AGC AGC TTC TTC ATC AGA GAC ATC ATC AAA CCA GAC CCA CCC ACA 720 Thr Ser Ser Phe Phe Ile Arg Asp Ile Ile Lys Pro Asp Pro Pro Thr AAC CTG CAG CTG AAG CCA TTG AAA AAT TCT CGG CAC GTG GAG GTC AGC 768 Asn Leu Gln Leu Lys Pro Leu Lys Asn Ser Arg His Val Glu Val Ser TGG GAA TAC CCC GAC ACC TGG AGC ACC CCA CAT TCC TAC TTC TCC CTG 816 Trp Glu Tyr Pro Asp Thr Trp Ser Thr Pro His Ser Tyr Phe Ser Leu ACA TTT TGC ATA CAG GCC CAG GGC AAG AAC AAT AGA GAA AAG AAA GAT 864 Thr Phe Cys Ile Gln Ala Gln Gly Lys Asn Asn Arg Glu Lys Lys Asp AGA CTC TGC GTG GAC AAG ACC TCA GCC AAG GTC GTG TGC CAC AAG GAT 912 Arg Leu Cys Val Asp Lys Thr Ser Ala Lys Val Val Cys His Lys Asp GCC AAG ATC CGC GTG CAA GCC CGA GAC CGC TAC TAT AGT TCA TCC TGG 960 Ala Lys Ile Arg Val Gln Ala Arg Asp Arg Tyr Tyr Ser Ser Ser Trp AGC GAC TGG GCA TCT GTG TCC TGC AGT TAG 990 Ser Asp Trp Ala Ser Val Ser Cys Ser ***

SEQ ID NO: 12 Sequence length: 669 Sequence type: Nucleic acid number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Origin Organism: Canine Sequence characteristics Characteristic symbols: peptide Location: 1..666 Method for determining characteristics: S sequence ATG TGC CCG CCG CGC GGC CTC CTC CTT GTG ACC ATC CTG GTC CTG CTA 48 Met Cys Pro Pro Arg Gly Leu Leu Leu Val Thr Ile Leu Val Leu Leu AGC CAC CTG GAC CAC CTT ACT TGG GCC AGG AGC CTC CCC ACA GCC TCA 96 Ser His Leu Asp His Leu Thr Trp Ala Arg Ser Leu Pro Thr Ala Ser CCA AGC CCA GGA ATA TTC CAG TGC CTC AAC CAC TCC CAA AAC CTG CTG 144 Pro Ser Pro Gly Ile Phe Gln Cys Leu Asn His Ser Gln Asn Leu Leu AGA GCC GTC AGC AAC ACG CTT CAG AAG GCC AGA CAA ACT CTA GAA TTA 192 Arg Ala Val Ser Asn Thr Leu Gln Lys Ala Arg Gln Thr Leu Glu Leu TAT TCC TGC ACT TCC GAA GAG ATT GAT CAT GAA GAT ATC ACA AAG GAT 240 Tyr Ser Cys Thr Ser Glu Glu Ile Asp His Glu Asp Ile Thr Lys Asp AAA ACC AGC ACA GTG GAG GCC TGC TTA CCA CTG GAA TTA ACC ATG AAT 288 Lys Thr Ser Thr Val Glu Ala Cys Leu Pro Leu Glu Leu Thr Met Asn GAG AGT TGC CTG GCT TCC AGA GAG ATC TCT TTG ATA ACT AAC GGG AGT 336 Glu Ser Cys Leu Ala Ser Arg Glu Ile Ser Leu Ile Thr Asn Gly Ser TGC CTG GCC TCT GGA AAG GCC TCT TTT ATG ACG GTC CTG TGC CTT AGC 384 Cys Leu Ala Ser Gly Lys Ala Ser Phe Met Thr Val Leu Cys Leu Ser AGC ATC TAT GAG GAC TTG AAG ATG TAC CAG ATG GAA TTC AAG GCC ATG 432 Ser Ile Tyr Glu Asp Leu Lys Met Tyr Gln Met Glu Phe Lys Ala Met AAC GCA AAG CTT TTA ATG GAT CCC AAG AGG CAG ATC TTT CTG GAT CAA 480 Asn Ala Lys Leu Leu Met Asp Pro Lys Arg Gln Phe Leu Asp Gln AAC ATG CTG ACA GCT ATC GAT GAG CTG TTA CAG GCC CTG AAT TTC AAC 528 Asn Met Leu Thr Ala Ile Asp Glu Leu Leu Gln Ala Leu Asn Phe Asn AGT GTG ACT GTG CCA CAG AAA TCC TCC CTT GAA GAG CC GAT TTT TAT 576 Ser Val Thr Val Pro Gln Lys Ser Ser Leu Glu Glu Pro Asp Phe Tyr AAA ACT AAA ATC AAG CTC TGC ATA CTT CTT CAT GCT TTC AGA ATT CGT 624 Lys Thr Lys Ile Lys Leu Cys Ile Leu Leu His Ala Phe Arg Ile Arg GCG GTG ACC ATC GAT AGA ATG ATG AGT TAT CTG AAT TCT TCC TAA 669 Ala Val Thr Ile Asp Arg Met Met Ser Tyr Leu Asn Ser Ser ***

SEQ ID NO: 13 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGGGAATTCA TGCATCCTCA GCAGTTGGTC ATCTCCTGG 39

SEQ ID NO: 14 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CCCGAATTCC TAACTGCAGG ACACAGATGC CCAGTCGCT 39

SEQ ID NO: 15 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGGCTGCAGA TGTGCCCGCC GCGCGGCCTC CTCCTTGTG 39

SEQ ID NO: 16 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GGGCTGCAGT TAGGAAGAAT TCAGATAACT CATCATTCT 39

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification code Agency reference number FI Technical indication location // (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1:91)

Claims (23)

[Claims] Claims: 1. The ability to act on canine leukocytes to induce antiviral activators and factors that enhance the expression of class II MHC in canine tumor cells, the ability to promote the growth of canine blastoid lymphocytes, and the ability to induce canine leukocytes. Canine interleukin 12 having at least one ability selected from the ability to activate and damage canine tumor cells, and comprising a P40 subunit and a P35 subunit. 2. The canine interleukin 12 according to claim 1, wherein the P40 subunit has an amino acid sequence that is the same as or a part of SEQ ID NO: 1 or SEQ ID NO: 11. 3. The canine interleukin 12 according to claim 1, wherein the P35 subunit has an amino acid sequence that is the same as or a part of SEQ ID NO: 2 or SEQ ID NO: 12. 4. A DNA sequence encoding the protein according to claim 2. 5. The DNA sequence according to claim 4, which is a DNA sequence having the DNA sequence shown in SEQ ID NO: 1 or SEQ ID NO: 11 or a part thereof. 6. A DNA sequence encoding the protein according to claim 3. 7. The DNA sequence according to claim 6, which is a DNA sequence having the DNA sequence shown in SEQ ID NO: 2 or SEQ ID NO: 12 or a part thereof. 8. A recombinant vector comprising the DNA sequence shown in SEQ ID NO: 1. 9. A recombinant vector comprising the DNA sequence shown in SEQ ID NO: 2. 10. A recombinant vector comprising the DNA sequence shown in SEQ ID NO: 11 or a DNA sequence having a part thereof. 11. A recombinant vector comprising the DNA sequence shown in SEQ ID NO: 12 or a DNA sequence having a part thereof. 12. A recombinant vector simultaneously containing the DNA sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. 13. A recombinant vector comprising the DNA sequence shown in SEQ ID NO: 11 or a part thereof and the DNA sequence shown in SEQ ID NO: 12 or a part thereof simultaneously. A transformant obtained by transforming a host cell with the recombinant vector according to claim 8. A transformant obtained by transforming a host cell with the recombinant vector according to claim 9. A transformant obtained by transforming a host cell with the recombinant vector according to claim 10. A transformant obtained by transforming a host cell with the recombinant vector according to claim 11. 18. A transformant obtained by transforming a host cell with the recombinant vector according to claim 8 and the recombinant vector according to claim 9. 19. A transformant obtained by transforming a host cell with the recombinant vector according to claim 10 and the recombinant vector according to claim 11. A transformant obtained by transforming a host cell with the recombinant vector according to claim 12. A transformant obtained by transforming a host cell with the recombinant vector according to claim 13. 22. A method for producing canine interleukin 12, comprising culturing or breeding the transformant according to claim 18 or 20, and collecting canine interleukin 12. 23. A method for producing canine interleukin 12, comprising culturing or breeding the transformant according to claim 19 or 21, and collecting canine interleukin 12.