JP2002275197A - Method for stabilizing interleukin 12 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for stabilizing interleukin 12. SOLUTION: The interleukin 12 is stabilized by mixing the interleukin 12 with a surfactant.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to an interleukin 12 for producing interleukin 12 as a pharmaceutical.
On stabilization.

[0002]

2. Description of the Related Art With the advancement of gene manipulation technology, not only human interleukins, but also various interleukins of animals such as cattle, horses and cats have been cloned one after another, resulting in viral diseases and tumors. Some researches have been conducted on the use of various interleukins as therapeutic agents. Cloning of various interleukins (hereinafter abbreviated as IL) has also been reported for dogs (References 1, 2, 3, and 11).

[0003]

It is known that dogs have a large number of tumors such as mammary gland tumors, a large number of viral diseases such as parvovirus infection and distemba infection, and a large number of skin diseases. Since canine IL12 is considered to be particularly effective as a therapeutic agent, it is expected that if it is mass-produced and readily available, the use of these dogs as therapeutic agents will be opened.

[0004] When a useful protein such as a cytokine is used as a drug, it must be produced with high purity. It is known that the stability of a useful protein decreases when it becomes highly pure. Therefore, in order to make a useful protein into a pharmaceutical product, it is an important subject to maintain stability under high purity.

[0005] Accordingly, if a method for inactivating the recombinant while maintaining the stability of interleukin 12 can be found, it is expected that the development of interleukin 12 as a drug will be opened.

[0006]

Means for Solving the Problems In view of this situation, the present inventor aims to stabilize interleukin 12 produced in various production systems, makes an ingenuity and uses a surfactant to generate a gene. Methods for stabilizing interleukin 12 produced in various production systems using recombinant techniques have been established, and thus the present invention has been completed.

That is, the present invention relates to “interleukin 1
2. A method for stabilizing interleukin 12, wherein 2 is mixed with a surfactant. ".

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.

The interleukin 12 to which the stabilization method of the present invention can be applied includes all animal species. In the present invention, it can be particularly preferably applied to dog IL12.

In the stabilization method of the present invention, interleukins can be stabilized by adding a surfactant to a solution containing high-purity interleukin 12. The surfactant to be used is not particularly limited,
Alkyl allyl polyether alcohol, higher alcohol sulfate, N-cocoyl-L-arginine ethyl ester DL-pyrrolidone carboxylate, N-cocoyl-N
-Sodium methylaminoethyl sulfonate, cholesterol, self-emulsifying glyceryl monostearate, sucrose fatty acid ester, squalane, stearic alcohol, polyoxyl stearate 40, sorbitan cetanol sesquioleate, cetomacrogol 1000, diethyl sebacate, sorbitan fatty acid Esters, sodium dodecylbenzenesulfonate, ammonium nonylphenoxypolyoxyethylene ethane sulfate, polyoxyethylene octyl phenyl ether, polyoxyethylene olein amine, polyoxyethylene hydrogenated castor oil 20, polyoxyethylene hydrogenated castor oil 60, polyoxyethylene Stearin ether, polyoxyethylene cetyl ether, polyoxyethylene sorbitan monolaurate, poly Carboxymethyl sorbit beeswax, polyoxyethylene nonylphenyl ether, polyoxyethylene (105) polyoxypropylene (5)
Glycol, polyoxyethylene (120) polyoxypropylene (40) glycol, polyoxyethylene (160) polyoxypropylene 30) glycol, polyoxyethylene (20) polyoxypropylene (2
0) Glycol, polysorbate 60, polysorbate 80, macrogol 400, sorbitan monooleate, glyceryl monostearate, sorbitan monostearate, sorbitan monolaurate, polyoxyethylene sorbitan monolaurate, sodium lauryl sulfate, diethanolamide laurate, lauroyl Sarcosine sodium, lauromacrogol, sodium polyoxyethylene lauryl ether phosphate, polyoxyethylene oleyl ether phosphate and the like are preferably described as pharmaceutical additives in the Japanese Pharmacopoeia, among which nonionic ones are preferable. Among them, polyoxyethylene hydrogenated castor oil 60 is particularly preferably used.

The concentration to be added is preferably 0.001 to 10% by weight. Further, various stabilizers may be added in addition to the surfactant. Further, by setting the pH and the storage temperature of the solution containing the high-purity interleukin 12 to which the surfactant is added to the most stable values, a higher stabilizing effect can be expected. For example, highly purified IL1
As for No. 2, the activity rapidly decreases at various concentrations in a short time. When a surfactant was added and stored, the decrease in activity observed here could be completely prevented. When the solution is stored stably for a long period of time, the activity is not reduced for 100 days by setting the pH value of the solution of interleukin 12 to which the surfactant is added to 4 to 10 and the storage temperature to 0 to 15 ° C.

Further, the composition of interleukin 12
Further, various stabilizers may be added. Known methods for stabilizing useful proteins include a method of mixing with other proteins, for example, gelatin, serum, albumin, collagen and the like (JP-A-2-2647285,
JP-A-2-49734, JP-A-54-80406
JP-A-56-68707), a method of mixing saccharides, especially monosaccharides, disaccharides, and polysaccharides such as dextran and hydroxyethyl starch (JP-A-59-68607).
JP-A-181223, JP-B-6-51641, JP-A-61-44826, JP-A-60-15513
No. 6) or a method using cyclodextrin or polysaccharide alcohol as a stabilizer (JP-A-58-9).
No. 2691, Japanese Patent Publication No. 3-500882).

By adding these stabilizers to the composition of interleukin 12 produced by the production method of the present invention, a longer-term stabilizing effect can be expected. The stabilizer to be added is not particularly limited.

A plasmid into which DNAs encoding the two subunits of the canine IL12 protein have been inserted can be produced, for example, as follows. That is,
After extraction of poly (A) RNA from canine cells, cDN
A is synthesized and polymerase chain reaction (hereinafter abbreviated as PCR) using primers based on gene sequences encoding two subunits of bovine and human IL12, respectively.
By performing the above, two genes respectively encoding two subunits exhibiting canine IL12 activity can be cloned. Further, a phage library was prepared from the synthesized cDNA recombinant, and plaque hybridization was performed with two gene fragments obtained by PCR to obtain a canine IL12P40 cDNA.
And the full length of canine IL12P35 cDNA can be cloned.

RNA from dog organs and cells, such as dog mononuclear cells and lymphocytes stimulated with mitogen, etc.
As a method for obtaining, there can be mentioned, for example, a method using polysome separation, sucrose density gradient centrifugation and electrophoresis. RNA from the above dog organs and dog cells
As a method of extracting guanidine thiocyanate, a guanidine thiocyanate-cesium chloride method (Reference 9) in which CsCl density gradient centrifugation is performed, followed by treatment with a surfactant using a vanadium complex in the presence of a ribonuclease inhibitor, followed by phenol extraction Method (Reference 1)
0), guanidine thiocyanate-hot phenol method, guanidine thiocyanate-guanidine hydrochloride method, guanidine thiocyanate-phenol-chloroform method, treatment with guanidine thiocyanate, and treatment with lithium chloride to precipitate RNA. And an appropriate method can be selected.

MRNA is isolated from dog mononuclear cells or lymphocytes stimulated with canine organs or mitogens by a conventional method, for example, lithium chloride / urea method, guanidine / isothiocyanate method, oligo dT cellulose column method and the like. , From the obtained mRNA by a conventional method, for example, G
Ubler et al. Okayayama
CDNA is synthesized by the method described in Reference 12 and the like. In order to synthesize cDNA from the obtained mRNA, basically, a method using a reverse transcriptase such as avian osteoblast virus (AMV) or the like and a method using a DNA polymerase using a partial primer may be used. It is convenient to use a commercially available synthesis or cloning kit.

Using this cDNA as a template, a primer was prepared based on the base sequences of human, mouse and bovine.
By performing R, genes encoding the P40 and P35 subunits exhibiting canine IL12 activity can be cloned. Also, the synthesized c
After ligating the DNA to the λ phage vector, the phage particles are packaged in vitro by mixing with a λ phage coat protein and the like, and the resulting phage particles are infected to E. coli as a host. At this time, the E. coli infected with the λ phage is lysed, and each clone is recovered as a plaque. The plaque was transferred to a filter such as nitrocellulose, and hybridization was performed using a gene obtained by radiolabeled PCR as a probe to obtain a canine IL12P40 cDNA and a canine IL12P35cD.
The full length of NA can be cloned.

Prokaryote or eukaryote can be used as a host. As prokaryotes, bacteria, particularly Escherichia coli, Bacillus bacteria, such as Bacillus subtilis, can be used. As eukaryotes, yeasts, for example, yeasts of the genus Saccharomyces, such as Saccharomyces cerevisiae, are used.
es cerevisiae, eukaryotic microorganisms, insect cells, for example, yoga cells (Spodoptera f.
rugiperda), cabbage looper cells (Tri
choplusiani), silkworm cells (Bombyx)
mori), animal cells such as human cells, monkey cells,
Mouse cells and the like can be used. In the present invention, an organism itself, for example, an insect, for example, a silkworm, a cabbage looper, or the like can also be used.

As expression vectors, plasmids, phages, phagemids, viruses (baculo (insects), vaccinia (animal cells)) and the like can be used. The promoter in the expression vector is selected depending on the host organism. For example, a lac promoter, a trp promoter or the like is used as a bacterial promoter, and an adh1 promoter or pqk is used as a yeast promoter.
A promoter or the like is used. Insect promoters include the baculovirus polyhedrin promoter and p10 promoter.
an Virus 40 early or late promoter, but is not limited thereto. When a virus is used as an expression vector, the addition of the surfactant of the present invention also has the effect of inactivating the virus.

Transformation of a host with an expression vector can be performed by conventional methods well known in the art. These methods are described, for example, in the current protocol.
Immolecular Biology (Current P
rotocols inMolecular Biol
oggy), John Wheely and Sands (Joh)
n Wiley & Sons). Culture of the transformant can also be performed according to a conventional method.

The produced dog IL12 has an apparent molecular weight of about 70 to 80 kD as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under non-reducing conditions.

In SDS-PAGE, the band of 70-80 kD shows a molecular weight of about 40 kD and about 35 kD under reducing conditions.
This gives rise to two subunits of D.

As shown in Reference Example 2 below, canine IL12 is capable of inducing interferon γ (hereinafter abbreviated as IFNγ) from dog leukocytes and phytohemagglutinin (hereinafter abbreviated as PHA) in vitro from canine leukocytes. Characterized primarily by the pro-proliferative effect of canine lymphocytes stimulated with. In addition, it has the activity of activating NK cells and cytotoxic T cells and lysing their target cells, such as tumor-derived cell lines or virus-infected fibroblasts.

In the present invention, as an ion exchange carrier used for high-purity purification, agarose, cellulose, synthetic polymer gel, etc.
ethylaminoethyl), Quaternary aminoethyl (Quatern)
ary aminoethyl), quatenary ammonium (Quaterna)
ry ammonium), carboxymethyl (Carboxymethyl),
Examples thereof include those into which a functional group such as sulfopropyl or methyl sulphonate is introduced. Preferably sulfopropyl has been introduced,
SP Sepharose High Performance (Amersham
Pharmacia), SP Sepharose First Flow (Amersham Pharmacia), etc.
P carrier (abbreviated as P-sepharose carrier). Elution from the SP Sepharose carrier is determined by the pH value, ionic strength and the like of the eluent. Proteins composed of the combination of P40 and P35 have different charges, respectively, and can be fractionated using the carrier according to the difference between the charges. For example, in the case of canine IL12 and canine P40 homodimer produced in insect cells, each can be fractionated under a pH value of 7.

Further, as the dye carrier, a carrier to which a blue dye is bound (hereinafter abbreviated as a blue carrier) is preferably used. The following are used as the blue carrier. The blue dye has the generic name CI Reactive Blue 2
For example, blue pigments available from CIBA-GEIGY under the trade name of dibaclon blue F3GA or dibaclon blue 3GA may be mentioned. As a carrier used for actual chromatography, Blue Sepharose CL-6B (manufactured by Amersham Pharmacia), Blue Sepharose 6 First Flow (manufactured by Amersham Pharmacia), Blue Sepharose 6 High Performance (manufactured by Amersham Pharmacia),
Blue agarose gel commercially available under trade names such as Matrex Gel Blue A (manufactured by Amicon), Affigel Blue (manufactured by Biorat), or Blue Trisacryl-M (manufactured by LKB) Blue Cellulofine (manufactured by Chisso) Blue Sepharose gel, which is commercially available under the trade name such as (product name), is suitable and can be easily obtained. Elution from the blue carrier is determined by the pH value, ionic strength, hydrophobicity, etc. of the eluent. For example, dog I
In the case of L12 and canine P40 homodimers, each can be separated and eluted at near neutral pH to purify with high purity.

Although the purification operation using a column carrier can be performed to purify the canine IL12 and the canine P40 homodimer even if they are performed independently, it is more effective to combine them. For example, a solution containing canine IL12 and canine P40 homodimer produced in a silkworm living body contains a very large number of silkworm-derived contaminants and a plurality of combinations of canine P40 and canine P35. It is preferred to combine carriers. In the production of canine IL12 and canine P40 homodimers produced in insect cells and silkworm organisms, it is preferable to use a sulfopropyl carrier for the first-stage purification and a blue carrier for the second-stage purification.

In the purification operation using each column carrier, the composition and amount of the eluent are not particularly limited, and the optimal separation conditions are determined by the amounts of the contaminating proteins, canine IL12 and canine P40 homodimer. And the dimensions of the column.

Further, in order to simultaneously produce IL12 and P40 homodimer in large amounts, respectively, the gene encoding P40 is ligated under a promoter having higher expression, and the gene encoding P35 is ligated under a promoter having lower expression. To produce recombinants containing these at the same time, and to express each gene.
12 and P40 homodimers can be produced simultaneously. For example, in a baculovirus expression system, canine P40 can be placed under the polyhedrin promoter of a vector containing both the polyhedrin promoter and the P10 promoter.
Was added to the dog P under the P10 promoter.
By linking the genes encoding 35, respectively, to produce a recombinant virus and expressing it in insect cells,
Both canine IL12 and canine P40 homodimers can be produced in large quantities simultaneously.

The IL12 produced by the production method of the present invention is
It shows surprisingly remarkable therapeutic and preventive effects on canine and feline immune diseases as compared with conventional canine and feline immunological diseases. Among immune diseases in dogs and cats, tumors, dermatitis, allergic diseases, diseases with reduced immunity such as infectious diseases, etc., or humoral immune responses were mainly biased compared to cellular immune responses Some diseases show an immune response. Dog and cat tumors include mammary tumors, eosinophilic granuloma, epidermoid tumors, skin tumors, lipomas, ear hematomas, pulmonary edema, cutaneous pedicled soft tissue or anal tumors, and dog and cat tumors. Dermatitis includes allergic dermatitis, immune-mediated dermatitis, neoplastic dermatitis, parasitic dermatitis, bacterial dermatitis, fungal dermatitis, endocrine diseases, keratinization disorders, and the like. Allergic dermatitis includes, for example, atopic dermatitis, contact dermatitis, fleas dermatitis, tick dermatitis, and the like, and immune-mediated dermatitis includes, for example, lupus, pemphigus, acanthosis, epidermis Necrosis, cutaneous vasculitis, uveitis, malignant alopecia, scleroderma,
Examples include eosinophilic dermatitis, and parasite dermatitis include flea dermatitis, tick dermatitis, maggot dermatitis, filaria dermatitis, and the like. For example, pyoderma and the like can be mentioned, and fungal dermatitis includes, for example, epidermal dermatitis and systemic dermatitis, and endocrine diseases include, for example, thyroid dermatitis, growth hormone responsive dermatitis, estrogenic Dermatitis and the like, as keratinization, for example, essential seborrheic dermatitis, fatty acid deficiency dermatitis, zinc deficiency dermatitis,
Vitamin A deficiency dermatitis and the like. Dog and cat infections include canine parvovirus infection, distembar infection, cat AIDS and cat leukemia, and allergic diseases include canine and cat pollinosis.

The therapeutic drug / prophylactic drug for canine and feline immune diseases can contain other components in addition to dog IL12. The components added to tolvaptan are mainly determined depending on the mode of administration of tolvaptan. When this drug is used as an individual, for example, a filler such as lactose, a binder such as carboxymethylcellulose and gelatin, a coloring agent, a coating agent and the like can be used.
Such agents are suitable for oral administration. Further, as a carrier or an activator, for example, white petrolatum, a cellulose derivative, a surfactant, polyethylene glycol, silicone, olive oil, or the like may be added and creams, emulsions, lotions and the like may be applied to the affected area as an external medicine and used. . Also, if the drug is administered as a liquid,
It may contain the usual physiologically acceptable solvents, and emulsifiers and stabilizers. Water, P as solvent
Examples of the emulsifier include polyoxyethylene-based surfactants, fatty acid-based surfactants, and silicones. Examples of the stabilizers include polyols such as dog serum albumin and gelatin. Or saccharides such as sorbitol and trehalose. Although there is no particular limitation on the method of administration of the therapeutic and prophylactic agents of the present invention, the most therapeutic effect can be expected by injection administration. The injection administration method is not limited to any of intravenous administration, intramuscular administration, subcutaneous administration, intraperitoneal administration, and intrathoracic administration.

The dose will be determined depending on the size of the individual, the method of administration, the type of the disease, the symptoms, etc., but it is sufficient to administer a sufficient amount to show the therapeutic and preventive effects. For example, from 0.1 pg to 1 dose per day per day
A sufficient effect can be obtained by administration of 00 μg / kg dog IL12.

In adoptive immunotherapy, lymphocytes separated from 1-100 ml of dog or cat blood are
Sufficient effects can be obtained by stimulating with 0.001 pg to 1 μg of canine IL12 for 12 hours to 6 days and then returning to the body again.

[0033]

The present invention will now be described more specifically with reference to examples.

Reference Example 1 Cloning of Canine IL12P40 and P35 Genes (1) Preparation of Canine cDNA Canine liver, canine peripheral blood mononuclear cells stimulated with LPS (50 μg / ml) for 48 hours and chicken Newcastle disease virus were treated for 7 hours. Total RNA was prepared from (10 ⁷ pfu / ml) dog spleen-derived lymphocytes using ISOGEN (Nippon Gene). The obtained RNA is
10 mM Tris-HCl buffer containing 10 mM EDTA (p
H7.5) (hereinafter abbreviated as TE), treated at 70 ° C. for 5 minutes, and added the same amount of TE containing 1 M LiCl. The RNA solution was applied to an oligo dT cellulose column equilibrated with TE containing 0.5 M LiCl, and washed with the same buffer. After washing with TE containing 0.3 M LiCl, 2 mM ED containing 0.01% SDS was used.
The poly (A) RNA adsorbed by TA (pH 7.0) was eluted. Using the poly (A) RNA thus obtained, a single-stranded cDNA was synthesized. That is, sterilized 0.5 ml
5 μg of poly (A) RNA and 0.5 μg of oligo dT primer (12-18 me
r) was added thereto, sterilized water treated with diethylpyrocarbonate was added to make 12 μl, and the mixture was incubated at 70 ° C. for 10 minutes and then placed on ice for 1 minute. 200 μM Tris-HCl (pH 8.4) and 500 mM KCl solution
1, ₂ μl of 25 mM MgCl 2, 10 mM dNT
After adding 1 μl of P and 2 μl of 0.1 M DTT, respectively, and incubating at 42 ° C. for 5 minutes, 200 units of SuperScript manufactured by GibcoBRL were added.
1 μl of II RT was added, and the mixture was further incubated at 42 ° C. for 50 minutes to perform a cDNA synthesis reaction. 7 more
The reaction was stopped by incubating at 0 ° C. for 15 minutes and placed on ice for 5 minutes. 1 μl of E. coli was added to the reaction solution. coli
RNaseH (2 units / ml) was added and incubated at 37 ° C for 20 minutes.

(2) Preparation of canine cDNA phage library Using 1 μg of the poly (A) RNA obtained in the above (1), an oligo dT primer was used according to the attached manual using a time saver cDNA synthesis kit of Pharmacia. To synthesize a double-stranded cDNA, and furthermore, EcoRI /
NotI adapter was ligated. Using this, the cDNA Rapid cloning module of Amersham-λ
gt10 according to the attached manual according to the recombinant λgt1
0 vector was prepared, and a recombinant phage was prepared using an in vitro packaging module of Amersham according to the attached manual.

(3) Cloning of Canine IL12P40 Gene Based on the N-terminal and C-terminal nucleotide sequences of human IL12P40 (Reference 1), 5'ATGTGTTCACCAGGC
AGTTGGTCATCTCTTGGTTT3 '(SEQ ID NO: 3) and 5'CTAACTGCAGGGCACAGA
Two kinds of primers of TGCCCA3 ′ (SEQ ID NO: 4) were synthesized with a DNA synthesizer. CDN obtained from dog liver and LPS-stimulated dog peripheral blood of (1) above
A in a separate 0.5 ml microcentrifuge tube, take 2 μl each, and add each primer to 20 pmol, 20 mM Tris-HCl buffer (pH 8.0), 1.5 mM MgCl ₂ ,
25 mM KCl, 100 μg / ml gelatin, 50
Add each reagent to make each μM dNTP, 4 units Taq DNA polymerase to make a total volume of 100 μl. DN
The denaturation condition of A was 94 ° C for 1 minute, the annealing condition of the primer was 55 ° C for 2 minutes, and the extension condition of the primer was 72 minutes.
Perkin Elmer Cetus (Per)
The reaction was performed for 35 cycles using a DNA thermal cycler (kin-Elmer Cetus). This one
% Agarose gel, about 990 bp of DN
The A fragment was prepared according to a conventional method (Reference 13).

This DNA fragment was transferred to T-Vector of Invitrogen and DNA Liga of Takara Shuzo Co., Ltd.
Tion Kit Ver. 1 and ligated. Using this, Escherichia coli was transformed according to a conventional method, and a plasmid DNA was prepared from the obtained transformant by a conventional method. Next, it was confirmed that the PCR fragment was inserted into this plasmid by PCR under the same conditions as described above.
s2000 DNAanalysis system
(Made by DuPont) using the dideoxy method (Reference 1)
In 4), the base sequence of the P40 subunit DNA of one of the two subunits which seem to show canine IL12 activity was determined. This sequence is shown in SEQ ID NO: 1.

A 990 bp DN containing this sequence
Random Primer of Takara Shuzo Co., Ltd.
³² P was labeled using a DNA Labeling Kit to prepare a probe. The recombinant phage library prepared from the canine liver cDNA obtained in the above (2) was formed as a plaque on Escherichia coli NM514, and transcribed to Hybond-N + of Amersham in a conventional manner.

Hybond-N + is 5 × SSPE
(0.9 M NaCl, 50 mM NaH ₂ PO ₄ , 5 m
M EDTA, pH 7.4), 5x Denhardt's solution (0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.1% SDS,
The cells were incubated at 65 ° C. for 2 hours in 100 μg / ml salmon sperm DNA, and then hybridized in the same solution with 1 × 10 ⁶ cpm / ml of the labeled probe prepared as described above. After overnight incubation at 65 ° C, H
ybond-N + was added to 0.2 × SSC (30 mM NaC
1, 3 mM sodium citrate), 1 in 0.1% SDS
After washing for 5 minutes and 3 times, the film was exposed to a Fuji Imaging Plate of Fuji Photo Film Co., Ltd. for 12 hours, and analyzed by a bio-imaging analyzer of Fuji Photo Film Co., Ltd. Plaques having a positive signal were rescreened according to a conventional method. As a result of the three screenings, one recombinant phage having a positive signal was obtained. From this recombinant phage, phage D
After extracting NA and cutting with restriction enzyme EcoRI, 1%
About 1.5 kb of D obtained by agarose gel electrophoresis
An NA fragment was prepared according to a conventional method, and DNA of Takara Shuzo Co., Ltd. was prepared.
Ligation Kit Ver. 2 using Takara Shuzo Co., Ltd. pUC118BAP-treated DNA (EcoRI
/ BAP). Using this, plasmid DNA
Was prepared by a conventional method, and using a fluorescent DNA sequencer (DNA sequencer 373S manufactured by PerkinElmer),
According to the attached protocol, the nucleotide sequence of the obtained DNA fragment was determined using a dye terminator cycle sequencing kit manufactured by PerkinElmer. Among them, the sequence encoding canine IL12P40 is shown in SEQ ID NO: 11.

(4) Cloning of canine IL12P35 gene N-terminus of human IL12P35 (Reference 1) and bovine IL
Based on the C-terminal base sequence of 12P35, 5'AGCA
TGTGTCCAGCGCGCAGCCTCCTCCT
TGTCGCTACCCTG 3 '(SEQ ID NO: 5) and 5'
CTAGGAAGAACTCAGATAGCTCATC
2 of ATTCTGTCGATGGT3 '(SEQ ID NO: 6)
Various primers were synthesized using a DNA synthesizer. Using a cDNA obtained from canine spleen-derived lymphocytes treated with chicken Newcastle disease virus in (1) above as a template, a DNA fragment of about 670 bp was obtained in the same manner as in (3) above, inserted into T-Vector, and cloned into canine IL12. P35 of one of the two subunits that appear to be active
The nucleotide sequence of the subunit DNA was determined. This sequence is shown in SEQ ID NO: 2.

A 670 bp DNA containing this sequence
A labeled probe was prepared using the fragment. A recombinant phage library prepared from cDNA obtained from canine spleen-derived lymphocytes treated with chicken Newcastle disease virus obtained in (2) above was hybridized with a labeled probe in the same manner as in (3) above. Screening was performed. DNA was extracted from one of the resulting recombinant phages having a positive signal, cut with the restriction enzyme NotI, and the approximately 1.2 kb DNA fragment obtained by 1% agarose gel electrophoresis was subjected to Strata. Gene (STRA
TAGENE) pBluescript II No
It was connected to the tI site according to a conventional method. Using this, plasmid DNA was prepared, and the nucleotide sequence of the obtained DNA fragment was determined using a fluorescent DNA sequencer. Of these, the sequence encoding canine IL12P35 was
It is shown in FIG.

Reference Example 2 Production of Canine IL12 (1) Preparation of Canine IL12 Expression Vector The expression vector pCDL-SRα296 (Reference 15) was digested with the restriction enzyme EcoRI, and the end was dephosphorylated with bacterial alkaline phosphatase. This was subjected to 1% agarose gel electrophoresis to prepare a DNA fragment of about 3.6 kb according to a conventional method. On the other hand, CaIL12P40 DNA
The fragment is 5'GGGGAATTCATGTGTTCACCA
GCAGTTGGTCCATCTCTTGG3 '(SEQ ID NO: 7) and 5' CCCGATTCCTAACTGCAG
A primer to which two types of EcoRI cleavage sites of GGCACAGATGCCCAGTCGCT3 ′ (SEQ ID NO: 8) were added was prepared, and T-Vec prepared in Reference Example 1 (2) was prepared.
2 which seems to show canine IL12 activity inserted into tor2
P40 subunit DN of one subunit
Using A as a template, the DNA was denatured at 94 ° C for 1 minute, the primer annealing condition was 55 ° C for 2 minutes, the primer extension condition was 72 ° C for 3 minutes, and the PCR was performed at cycle number 30.
After ethanol precipitation, digestion with restriction enzyme EcoRI was carried out, and about 990 bp of D was detected by 1% agarose gel electrophoresis.
NA fragments were prepared. Also, 5'GGGGAATTCA
TGCATCCTCCAGCAGTTGGTCCATTCC
CTGG3 '(SEQ ID NO: 13) and 5' CCCGAATT
CCTAACTGCAGGACACAGATGCCCA
Two kinds of EcoR of GTCGCT3 '(SEQ ID NO: 14)
A primer to which an I cleavage site was added was prepared, and Reference Example 1
Dog IL12 inserted into pUC118 prepared in (2)
PCR was performed using P40 DNA as a template, and EcoRI was performed.
And a DNA fragment of about 990 bp was prepared. Each of the obtained canine IL12P40 DNA fragments was subjected to T4D
PCD prepared as above using NA ligase
L-SRα296. Using this, Escherichia coli was transformed, a plasmid DNA was prepared from the resulting transformant, and FOCaIL1 expressing canine IL12P40.
2P40 and FOCaIL12P40FL were obtained.

Further, pCDL-SRα296 was cleaved with a restriction enzyme PstI, dephosphorylated, and then electrophoresed to about 3.6.
A kb DNA fragment was prepared. Dog IL12P35 D
The NA fragment is 5'GGGCTGCAGATGTGTCCA.
GCGCGCAGCCCTCCCTCTGTC3 '(SEQ ID NO: 9) and 5' GGGCTGCAGGCTAGGAAG
AACTCAGATAGCTCATCATCTCT3 '
A primer to which two types of PstI cleavage sites of (SEQ ID NO: 10) were added was prepared, and T-prepared in Reference Example 1 (3) was prepared.
Using the P35 subunit DNA of one of the two subunits considered to show canine IL12 activity inserted into the Vector as a template, 94 ° C., 1 minute, 55 ° C., 2 minutes,
PCR was performed at 72 ° C. for 3 minutes for 30 cycles, followed by ethanol precipitation, followed by digestion with the restriction enzyme PstI. This was subjected to 1% agarose gel electrophoresis to prepare a DNA fragment of about 670 bp. Also, 5'GGGCTGCAGATGTGGC
CCGCCGCGCGGCCTCCTCCTTGTG3
'(SEQ ID NO: 15) and 5' GGGCTGCAGGTTAG
GAAGAATTCAGATAACTCATCATTC
A primer to which two types of PstI cleavage sites of T3 ′ (SEQ ID NO: 16) were added was prepared, PCR was performed using the canine IL12P35 DNA inserted into pUC118 prepared in Reference Example 1 (2) as a template, and cut with PstI. About 67
A 0 bp DNA fragment was prepared. PCDL prepared by cutting each of the obtained canine IL12P35 DNA fragments with PstI as described above using T4 DNA ligase.
Ligation to SRα296, E. coli transformation, plasmid D
NA preparation and FOC expressing canine IL12P35
aIL12P35 and FOCaIL12P35FL were obtained.

Further, canine IL12P40 DNA and canine IL12
The nucleotide sequence of P35 DNA was confirmed.

(2) Production of canine IL12 in monkey COS cells 5 μg of FOCaIL1 obtained in (1) above
2P40 and FOCaIL12P35 were mixed with 50 mM Tris-HCl buffer (pH 7.5), 400 μg / ml DE.
AE Dextran (Pharmacia) and 100μ
4 ml of ERDF containing M chloroquine (Sigma)
It is added to a culture medium (manufactured by Far East Pharmaceutical Co., Ltd.). On the other hand, COS-1 cells (ATCC) grown in a 10 cm diameter dish with 10% fetal bovine serum (manufactured by Gibco, hereinafter abbreviated as FBS) to 50% confluency.
CRL-1650) was washed once with PBS, and then 4 ml of the DNA mixture obtained above was added, and 5% CO ₂ , 37 ° C.
Cultured under the following conditions. After 4 hours, the cells were washed with PBS and cultured in 20 ml of ERDF medium at 5% CO ₂ and 37 ° C. for 4 days to obtain a culture supernatant in which canine IL12 was produced.

(3) Preparation of canine IL12-producing recombinant baculovirus Baculovirus transfer vector pAcAB3
The P40 and P35 subunit cDNAs were ligated to restriction enzyme XbaI and SmaI cleavage sites downstream of the promoter (manufactured by Pharmingen) in accordance with a conventional method to obtain a recombinant transfer vector. Further, a recombinant baculovirus was prepared using a baculovirus transfection kit of Pharmingen in accordance with the attached manual.

(4) Production of Canine IL12 in Insect Cells The recombinant baculovirus obtained in the above (3) was purified using BaculoGold Protein-F (Pharmingen).
After infecting Sf21 cells (derived from Spondopta Flugiperda, obtained from Pharmingen) which had been cultured to a confluent state in a 75 cm ² flask with a free Insert Medium, the cells were cultured for 4 days, and a culture supernatant from which canine IL12 was produced was obtained. .

Reference Example 3 Detection of canine IL12 and canine P40 homodimer by western blotting (1) Preparation of anti-dog P40 and anti-dog P35 polyclonal antibodies The amino acid sequence deduced from the gene sequence of dog P40 obtained in Reference Example 1 Of which, SEQ ID NO: 17 to SEQ ID NO: 2
The peptide fragment shown in No. 0 was synthesized using a peptide sequencer, and all the fragments were mixed to prepare a conjugate with BSA. Similarly, of the amino acid sequence deduced from the gene sequence of dog P35, peptide fragments represented by SEQ ID NOS: 21 to 24 were synthesized by a peptide sequencer, and all the fragments were mixed and conjugated with BSA. A gate was made.

After injection of 5 mg of each conjugate into the peritoneal cavity of one rabbit, 4 weeks later, sera in which a polyclonal antibody against dog P40 and a polyclonal antibody against dog P35 were produced were obtained.

(2) Western Blotting Canine IL12 and canine P40 homodimer in the culture supernatant of the insect cells obtained in Reference Example 2 (4) were detected by Western blotting. The culture supernatant was subjected to SDS-PAGE in a gel of Atto Co., Ltd. Thereafter, blotting was performed on a clear blot membrane of Atto Co., Ltd. according to a conventional method, and the membrane was subjected to Block Ace (manufactured by Dainippon Pharmaceutical Co., Ltd.) containing rabbit serum containing the anti-dog P40 polyclonal antibody obtained in (1) above. The solution was allowed to react for 6 hours, and P containing 0.02% Tween 20
The plate was washed three times with BS, further reacted with a block ace solution containing a peroxidase-labeled goat anti-rabbit IgG (manufactured by Bio Rat Co., Ltd.) for 6 hours, washed similarly, and then washed with Konica Immunostain HRP1000 of Konica Co., Ltd. Color was developed. As a result, about 75 kD and about 85 kD
Book bands were detected. Further, using a rabbit serum containing an anti-dog P35 polyclonal antibody,
As a result of analyzing the culture supernatant of the insect cells obtained in Reference Example 2, only a band of about 75 kD was detected. From this, it was found that the band at about 75 kD was canine IL12 composed of a heterodimer of dogs P40 and P35, and the band at about 85 kD was a canine P40 homodimer. Therefore, according to the method of Reference Example 2, canine I
Both L12 and canine P40 homodimers were produced simultaneously.

Reference Example 4 Activity Measurement of Canine IL12 The activity of dog IL12 produced in Reference Examples 2 (2) and (4) was measured as follows. For the assay of canine IFNγ-inducing activity from canine lymphocytes, the antiviral activity and the activity of enhancing canine cell class II MHC expression were measured. Lymphocytes were isolated from dog spleen and 10% FBS-E
Suspended in RDF at a cell density of 10 ⁶ cells / ml,
Of these, 2.5 ml and human IL2 from Genzyme were added to a 250 U, 6 cm dish. To this, 2.5 ml of the culture supernatant obtained in the above (2) and 250 U of human IL2 (Zenzyme) were added, and 5% C
The cells were cultured under conditions of O ₂ and 37 ° C. for 2 days.
esicular Stomatis Viru
s, MDCK (ATCC CCL-3) as a sensitive cell
Using 4), the antiviral activity of this culture was measured according to the CPE method of Reference 16. As a result, an antiviral activity of 2 × 10 ⁵ dilution units / ml or more was confirmed. Also,
As a result of similarly measuring the antiviral activity of the culture supernatant obtained in the above (4), an antiviral activity of 10 ⁷ dilution units / ml or more was detected. On the other hand, 10 μg of pCDL-
No antiviral activity was observed in the control cell culture in which SRα296 was introduced into COS-1 cells in the same manner as in (2) above and in the culture in which Sf21 cells were cultured for 3 days.

Using the canine mammary tumor tissue-derived cell line FCBR1 that expressed class II MHC, the activity of enhancing the expression of class II MHC in each of the above culture solutions was measured.
10 ⁵ FCBR1 were adhered to a 6 cm dish, and ⁵ ml of each of the above culture solutions was added thereto.
The cells were cultured overnight at 37 ° C. and O ₂ . After the culture, the cells were detached with trypsin and centrifuged in a 1.5 ml microcentrifuge tube. To this, 10 μl of a rat anti-canine class II MHC monoclonal antibody from Stratagene was added, further suspended in 50 μl of 10% FBS-ERDF, and allowed to stand on ice for 1 hour. After washing with PBS, 5μ
l FITC-labeled rabbit anti-rat monoclonal antibody (Serotech) and 50 μl 10% FBS-E
The cells were suspended in RDF and left on ice for 1 hour. After washing with PBS, analysis was performed with FACScan of Becton Dickinson Co., Ltd. As a result, canine IL12 produced on COS1 and Sf21 was a class IIMH on FCBR1.
The expression level of C was increased by about 20% and 60%, respectively. From these results, it was found that canine IL12 acts on canine lymphocytes and has an activity of inducing canine IFNγ.

The proliferation promoting activity of the blasted dog lymphocytes was measured. Separating lymphocytes from dog peripheral blood,
The cells were suspended in 0% FBS-ERDF at a cell density of 10 ⁶ cells / ml, and 5 ml of the suspension was added to a 6 cm dish. To this, PHA was added at a concentration of 5 μg / ml,
The cells were cultured for 3 days under conditions of 5% CO ₂ and 37 ° C. to make the lymphocytes blast. The blastized lymphocytes were converted to 10% FBS-E.
Suspended in RDF at a cell density of 10 ⁶ cells / ml,
50 μl was added per well of a 96-well microplate. To this, 50 μl of the culture supernatant obtained in the above (2) was added per well. Also, 10% FB as a control
50 μl of S-ERDF alone was added per well. After further culturing them under conditions of 5% CO ₂ and 37 ° C. for 3 days, the proliferation promoting activity of canine IL12 on blast-forming lymphocytes was measured by the MTT assay described in Reference 11. That is, 5m
g / ml MTT (Sigma) solution per well
Each μl was added, and the cells were further cultured for 6 hours. After adding 150 μl of a 0.01 N isopropanol hydrochloride solution, the cells were disrupted by ultrasonic waves, and the wavelength was 595 n using a microplate reader (Model 13550 manufactured by Biorat).
m was measured. As a result, the absorbance of the control was 0.69 on average, whereas the canine IL12 produced by COS-1 was 1.52 on average, indicating that the proliferation promoting activity of blast-converted lymphocytes was about twice or more. Was done.

Further, the antitumor effect of canine IL12 on canine tumors was examined. Lymphocytes were isolated from dog peripheral blood, and 5 × 10 ⁶ cells / m in 10% FBS-ERDF.
The cells were suspended at a cell density of 1 l, of which 5 ml was added to a 6 cm dish. To this, 500 U of recombinant human IL2 from Boehringer Mannheim Co., Ltd. was added,
The cells were cultured under conditions of 5% CO ₂ and 37 ° C. for 3 days. On the other hand, canine tumor cells FCBR1 and A72 (ATCC CRL)
−1542) with 10% FBS-ERDF for 10
The cells were suspended at a cell density of 5 cells / ml and added to a 96-well plate in an amount of 50 μl per well to adhere to the plate. 50 μl of dog lymphocytes stimulated with human IL2
And further expressing canine IL12 (2)
100 μl of the culture supernatant obtained in the above or 100 μl of 10% FBS-ERDF as a control was added, and 5%
The cells were cultured under the conditions of CO ₂ and 37 ° C. for 2 days. After the culture, the supernatant was completely removed, and an MTT assay was performed. % Cytotoxicity was calculated by the following equation.

% Cytotoxicity = (1−OD2 / OD1) × 100 where OD1 = absorbance at 595 nm wavelength of canine tumor cells cultured in medium alone OD2 = absorbance at 595 nm wavelength of canine tumor cells cultured with canine lymphocytes Represent.

As a result, control was 34% in FCBR1, whereas dog I produced in COS-1 was
L12 showed about 75% cytotoxicity. Also, A72
Control was 22%, whereas dog IL
12 showed about 83% cytotoxicity. Canine IL12 was found to activate canine lymphocytes and exert an antitumor effect on canine tumor cells.

Reference Example 5 Dog IL12 and Dog P40
Purification of homodimer Using the cell culture supernatant obtained in Reference Example 2 (4), fractionation of canine IL12 and canine P40 homodimer with a sulfopropyl carrier was examined. Purification was performed at pH: 7.
After applying the culture supernatant to a column packed with a sulfopropyl carrier, a sufficient amount of a 20 mM phosphate buffer (pH:
The column was washed in 7). Elution was performed at a NaCl concentration of 1M.
Up to 5 mM steps. As a result, canine IL12
At 350-550 mM, canine P40 homodimer is 6
It was detected in the eluted fraction at each NaCl concentration of 00 to 750 mM (Western blotting). No canine IL12 or canine P40 homodimer was detected in the other eluted fractions and the alkali-washed fraction.

Each fraction from which canine IL12 and canine P40 homodimer were eluted was further applied to a column packed with a blue sepharose carrier, and a sufficient amount of 20
After washing the column with mM phosphate buffer (pH: 7),
Elution was performed at a Cl concentration of 500 mM to 2 M in 5 mM steps. As a result, canine IL12 was 1.1-1.2M.
The canine P40 homodimer is 1.5-2 M of each Na
Cl was detected in the eluted fraction (Western blotting). According to SDS-PAGE analysis, canine IL1
The purity of canine IL12 and canine P40 homodimer in each fraction on the Blue Sepharose carrier from which 2 and canine P40 homodimer were eluted was 98% or more, respectively.

Reference Example 6 Purified dog IL12 and dog P
Activity of 40 homodimers Purified canine IL12 and canine P40 obtained in Reference Example 5
The activity of the homodimer in vitro was measured as follows. For the assay of the activity of purified canine IL12 to induce canine IFNγ from canine lymphocytes, the antiviral activity was measured. Lymphocytes were isolated from canine peripheral blood and 10 ⁶ FBS-ERDF in 96-well microplates.
100 μl per well at a cell density of cells / ml, 250 μg of recombinant human IL2 from Genzyme was added to each well, and purified dog IL12 (1 to 10 ³ pg / ml) alone and purified dog IL12 (1 to 10 ³ pg) and dog P40 homodimer (1 ng / ml) were simultaneously added, and 5% CO 2 was added.
_{2. The} cells were cultured at 37 ° C. for 72 hours. The antiviral activity in 100 μl of each culture supernatant after the culture was measured. Vesicular Stomatis as a virus
Virus, FCBR1 was used as a susceptible cell, and the antiviral activity of this culture was measured according to the CPE method of Reference 16. As a result, purified canine IL12 (1 to 10 ³ p
g / ml) of the culture supernatant added alone, 2 × 10 ³ to 10 ⁵
A unit / ml antiviral activity was confirmed. On the other hand, the purified canine IL12 (1 to 10 ³ pg) dog P40 homodimer (1 ng / ml) supernatants were simultaneously added cultured, antiviral activity is 10 ² to 10 ³ units / ml, dog P40 homodimers, Dog I of dog IL12
It was revealed that the compound had an activity of inhibiting FNγ-inducing activity.

Example 1 Dog IL1 Using Surfactant
Stabilization of 2 Using the high-purity dog IL12 obtained in Reference Example 5, stability in a solution was examined. A purified solution of canine IL12 was added to a vial bottle of Fuji Glass Co., Ltd. White V-TR2C
S was charged with 1 × 10 ⁵ U and stored at 4 ° C., and the activity was measured over time. As a result, 9
More than 0% of the activity was lost. For stabilization, dog IL
No. 12 were added to the prepared solution to which 1% of gum arabic (manufactured by Sanei Pharmaceutical Co., Ltd.), 0.5% of polyethylene glycol, and 10 mM of glycine were added as final stabilizers, and the activity was measured. However, after preparation 1
Activity fell within 0 hours, in which case about 35% of the activity was lost.

To determine whether this loss of activity was due to adsorption to the storage container or to protein deactivation, dog IL12 in the storage solution was quantified by enzyme immunoassay.

The enzyme immunoassay was performed for dog IL1.
2 using two antibodies (polyclonal and monoclonal). The polyclonal antibody used was prepared by adding 70% by weight of ammonium sulfate to a rabbit antiserum containing an anti-dog IL12 polyclonal antibody to precipitate and purify the anti-dog IL12 polyclonal antibody. In addition, a monoclonal antibody was used to immunize a mouse with the high-purity canine IL12 prepared in Reference Example 6 and fuse its spleen cells with mouse myeloma cells according to a standard method.
From these cells, cloned cells producing an antibody against canine IL12 were isolated, and the cells were transplanted intraperitoneally into nude mice according to a standard method, and 70% by weight of ammonium sulfate was added to ascites obtained by adding the anti-canine IL12 monoclonal antibody. The precipitate was used after purification. Plate used for enzyme immunoassay, blocking agent, label 3
The secondary antibody and the reaction substrate were Immuno by Nunc
Plate F96.Maxisorp (Cat. No. 439454), Block Ace of Dainippon Pharmaceutical Co., Ltd., POD-labeled anti-mouse antibody (Cat. No. 55566) of Cappel Co., Ltd., and TMB One of DAKO Co., Ltd. -st
The ep Substrate System (Code No. S1600) was used. After each reaction, the plates were washed three or more times with PBS containing 0.05% Tween 20. The measurement procedure was performed as follows.

1) An anti-dog IL12 polyclonal antibody (primary antibody) was added to a 50 ng / well plate and immobilized at 4 ° C. overnight.

2) A blocking agent was added to a 200 μg / well plate, and the plate was allowed to stand for 2 hours.

3) An anti-canine IL12 monoclonal antibody (secondary antibody) was added to a 250 ng / well plate and allowed to stand for 1 hour.

4) A POD-labeled anti-mouse antibody was added to the plate (5000-fold dilution) and allowed to stand for 1 hour.

5) The reaction substrate was added to a 100 μl / well plate and allowed to stand for 20 minutes.

6) 3N H ₂ SO ₄ / 1N was added to the reaction solution of 5).
The reaction was stopped by adding 100 μl / well of HCl solution to the plate, and the absorbance was measured at a wavelength of 490-595 nm.
L12 was quantified.

As a result of quantification of canine IL12 in the preservation solution by enzyme immunoassay, at least 85% of canine IL12 was adsorbed to the preservation container in the solution to which no stabilizer was added. Among them, it was found that 30% or more was adsorbed on the storage container. Therefore, it was found that the main factor for the loss of activity of dog IL12 in the solution was adsorption to the storage container.

To prevent loss of activity of dog IL12 in solution, a surfactant, polyoxyethylene hydrogenated castor oil 60 (manufactured by Nippon Surfactant Industry Co., Ltd.)
Was added at a concentration of 0.01% by weight to a solution charged with 1 × 10 ⁵ U of a canine IL12 in the same manner as described above, stored at 4 ° C., and the activity was measured over time. As a result, the activity was maintained at 100% with the stabilizer-free solution for 7 days after the preparation. Therefore, polyoxyethylene hydrogenated castor oil 60
Can significantly prevent loss of activity in solution of canine IL12. Further detailed examination of the pH value revealed that when the pH value was maintained at 5.5 to 8, there was no decrease in activity for 20 weeks or more, and stable storage was possible.

Example 2 Preparation of Canine IL12 Preparation Purified canine IL12 obtained in Reference Example 5 and canine P40
Each solution of the homodimer (containing 0.01% by weight of polyoxyethylene hydrogenated castor oil 60) was desalted by dialysis, and a saline solution for injection and a low molecular gelatin for injection (manufactured by Nitta Gelatin Co., Ltd.) Sorbitol, gelatin final concentration 0.5%, sorbitol final concentration 30%
Was prepared. Further, the mixture was treated with Posidyne (manufactured by Pall Corporation) to remove the pyrogen, and then 1 ml at a time was dispensed into glass vials sterilized by dry heat at 250 ° C. for 2 hours. Thereafter, 1 pg to 5 μg of canine IL12 and canine P40 in one vial by lyophilization aseptically.
Canine IL12 formulation containing homodimer and canine P40
A homodimer formulation was obtained. Each of these preparations was stable under room temperature conditions and dissolved well in distilled water or physiological saline.

Example 3 Evaluation of Drug Efficacy of Canine IL12 Preparation at Cell Level (1) Tumor In order to observe the antitumor effect of the canine IL12 preparation, a tumor-bearing mouse was prepared, and canine lymphocytes stimulated with the canine IL12 preparation were transferred. Then, the effect of reducing the tumor was examined. Ten 6-week-old female nude mice (BALB / C nu / nu) were purchased from CLEA Japan. The canine mammary gland tumor cell line FCBR1 was transplanted under the skin of 10 ⁸ cells subcutaneously on each back, and about one month later, a cancer-bearing mouse having a tumor of 33 mm × 25 mm on average was prepared. On the other hand, when FCBR1 was established, 10 ⁸ cells of tumor-infiltrating lymphocytes (hereinafter abbreviated as TIL) separated by the method of Whiteside et al. (Reference 17) were added to 20 ml of 10% FBS-ER.
Canine IL12 preparation 1 suspended in DF and prepared in Reference Example 4
0 ng was added, and the cells were cultured for 2 days under conditions of 5% CO ₂ and 37 ° C. to obtain TIL stimulated with a canine IL12 preparation. As a control, 10 ⁸ cells of TIL cultured under the same conditions without adding the canine IL12 preparation were prepared. These two kinds of TILs were transferred from the tail vein of cancer-bearing nude mice at 10 ⁷ cells per mouse and 5 mice each. Seven days after the transfer, the weight of the tumor was measured with a caliper, and TIL
The change in tumor weight before transfer was examined. The tumor weight was calculated by the following formula.

[0073] Tumor weight = (long diameter x short diameter ^2/2) As a result, tumor-bearing nude mice transfected with TIL stimulated with dog IL12 preparations complete tumor regression in three out of five, two dogs The relative tumor weight was 0.2 or less when the tumor weight before TIL transfer was set to 1. On the other hand, the tumor-bearing nude mice to which the control TIL was transferred all had increased tumors, and the relative tumor weights were all 1.25 or more. From the above, in the system using the cancer-bearing mouse,
The canine IL12 formulation was found to activate TIL and exert a tumor reducing effect.

(2) Allergy In order to observe the anti-allergic effect of the canine IL12 preparation, lymphocytes derived from dogs with allergies were stimulated with the canine IL12 preparation, and the presence or absence of regulation of expression of factors causing allergy such as IgE was examined. . 10 ml of blood was collected from each of five dogs diagnosed with atopic dermatitis. Lymphocytes were immediately separated therefrom, and immobilized with an anti-human CD3 polyclonal antibody (manufactured by Zenzyme) at 10 cm.
Dog IL12 with 10% FBS-ERDF in the dish
Each preparation was added in an amount of 10 ng and cultured for 3 days. As a control, dog lymphocytes cultured under the same conditions without adding the CaIL12 preparation were prepared. After culture
Some lymphocytes in each dish were collected, cDNA was synthesized by the method described in Reference Example 1, PCR was performed using primers specific for canine IgE and canine IgE receptor genes, and the expression of those genes was determined. Examined. As a result, the expression of these genes in dog lymphocytes cultured with the addition of the canine IL12 preparation was suppressed as compared with those without the canine IL12 preparation. From this, it was found that the canine IL12 preparation acts on canine lymphocytes and suppresses the expression of IgE and IgE receptor, which is one of the causative factors of allergy. In addition, a CD consisting mainly of a helper T cell population from the remaining lymphocytes in each dish by a panning method using an anti-human CD4 polyclonal antibody (manufactured by Zenzyme) (Reference 18).
4 positive cells were obtained. Using this, cDNA was synthesized, PCR was performed using primers specific to the canine IL5 and canine IFNγ genes, and the expression of those genes was examined. As a result, the expression of the canine IL5 gene was all suppressed by the addition of the canine IL12 preparation. On the other hand, regarding the expression of the canine IFNγ gene, canine I
In all cases, the expression was enhanced by the addition of the L12 preparation. IL5 is produced from type 2 helper T cells that cause a humoral immune response such as an allergic reaction, while IFNγ
Is produced from type 1 helper T cells that cause cellular immunity and suppress humoral immunity. From this, canine IL1
It was suggested that the two preparations have the effect of suppressing type 2 helper T cells in dog lymphocytes and activating type 1 helper T cells. From the above, it was found that the canine IL12 preparation was promising for treating allergic diseases in dogs.

Example 4 Toxicity test of dog IL12 preparation and dog P40 homodimer preparation on dogs The toxicity of the dog IL12 preparation was tested. Three beagle dogs were used as test animals. The test was performed as follows.

(1) Method of administration A total of five administrations were performed every two days. The dose was gradually increased (first time: 1 ng / kg body weight, 5 ng / kg body weight,
25 ng / kg body weight, 250 ng / kg body weight, 5th time:
1 μg / kg body weight). The administration route was intravenous.

(2) Observation examination period, observation examination items, observation points The observation period was from one week before the start of administration to three weeks after the start of administration. Observational test items are clinical symptoms (respiratory style, energy, appetite,
Activity, visible mucosa, casting, vomiting, bowel movements, somnolence, body temperature, heart rate, weight, hematology (blood cell system (white blood cell count,
Hematocrit, platelet count, blood image, electrolytes (Na,
K, Cl), biochemical tests (BUN, Crea., GO)
T, GPT, CPK, Glucose, TP, Alb,
Glob, A / G), urine findings, cardiovascular and autonomic nervous system findings. Observation points were measured once every 7 days from the day of administration for body weight, and
1 week before, immediately before administration on the day of administration, 10 minutes after administration, 30 minutes after administration,
Hour, 1.5 hours, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, administration start 2
Measurements were made after one week and three weeks after the start of administration.

As a result of conducting the test in the above manner, dog I
At least 1 μg of canine IL12 formulation was observed, as no significant changes were observed with administration of the L12 formulation.
It was found that there was no toxicity to dogs up to a dose of / kg body weight.

The same administration was carried out for the canine P40 homodimer preparation. As a result, it was found that there was no toxicity to dogs up to a dose of 1 μg / kg body weight.

Example 5 Canine IL12 Formulation and Canine P
Treatment and Prevention of Canine Diseases with 40 Homodimer Formulation Dog IL12 for a total of 12 dogs with epidermal mass
The formulation was administered topically and intravenously. There were multiple tumors of various sizes in each dog. 12
For 8 of the heads, 10 ng-1 μm per mass
g of canine IL12 was injected 3-10 times at 3-4 day intervals directly into the tumor site. As a result, 90% of the tumors administered with the canine IL12 preparation completely disappeared, and all the remaining tumors were reduced to less than half. Four of them had masses of 100 cm ³ or more in size, and all had already spread to internal organs such as lungs, liver, and kidneys. Immediately after excision of the epidermal mass in these three animals, a dog IL12 preparation was intravenously administered at 10 ng / kg and thereafter 500 ng / k.
Dosing was continued at a dose of g for 7 consecutive days. As a result, all the tumors metastasized to the internal organs disappeared, and the tumor was observed for 6 months thereafter, but no recurrence was observed.

Further, a canine IL12 preparation was intravenously administered to seven dogs diagnosed with atopic dermatitis.
In these dogs, clinical symptoms such as erythema, eczema and alopecia were observed on the skin, and a large amount of IgE was detected in the blood, and the leukocyte fraction contained IL4, IL5, IL10, I
Each mRNA of L13 was highly expressed. The intravenous administration of the canine IL12 preparation at a dose of 0.1-100 ng / kg per dose 3-5 times at 3 day intervals resulted in a rapid improvement in clinical symptoms with a single dose. It was completely cured in times.

Further, a canine IL12 preparation was intravenously administered to three dogs diagnosed with hay fever. A single dose of 0.1 to 10 pg / kg immediately improved clinical symptoms such as sneezing and runny nose.

For the canine P40 homodimer preparation,
For intractable dermatitis of unknown cause, the symptoms of which were worsened by administration of the canine IL12 preparation, 0.1-100 per dose
As a result of intravenous and subcutaneous injection of ng / kg at a dose of 3-5 times daily, clinical symptoms were rapidly improved with one administration, and the drug was completely cured after 3-5 times.

Example 6 Treatment of Canine Disease by Adoptive Immunotherapy Using Canine IL12 Preparation 25 ml of each of 5 dogs having a tumor on the epidermis, 2 cats, and 3 dogs diagnosed with atopic dermatitis. Blood was collected. Lymphocytes were immediately separated therefrom, and 10% FBS-ERD in a 10 cm dish immobilized with an anti-human CD3 polyclonal antibody (manufactured by Zenzyme).
F with human IL2 (Zenzyme) 50U and dog IL1
100 ng of the two preparations was added and cultured for 4 days. After culture, lymphocytes were collected and injected intravenously into each dog and cat. As a result, all three dogs with atopic dermatitis were completely cured, and all the dogs and cats with tumors also tended to shrink the mass, and the same operation was performed 3 to 5 times every other week. Upon repetition, all tumors completely regressed. References: 1. Wolf et al. Immunol. 14
6,3074-3081 (1991). 2. Shoenhout et al. Immunol. 14
8, 3433-3440 (1992). 3. Nastala et al. Immunol. 153,
1697-1706 (1994). 4. Gazzinelli et al .: Proc. Natl. A
cad. Sci. USA. 90, 6115-6119
(1993). 5. Gazzinelli et al. Exp. Med. 1
80, 2199-2208 (1994). 6. Okano et al. Interferon & Cy
Tokyo Res. , 17, 713-718 (19
97). 7. Virgil et al .: Immunogenetics
45, 462-463 (1997). 8. Dante et al .: Biochim. Biophys.
Acta 1270, 215-217 (1995). 9. Chirgwin et al .: Biochemistry
18, 5294 (1979). 10. Berger et al .: Biochemistry 1
8, 5143 (1979). 11. Gubler et al .: Gene 25, 236-26.
9 (1983). 12. Okayama et al .: Mol. Cell. Bio
l. , 2,161, (1982) & 3,280,
(1983). 13. Molecular Cloning. Cold
Spring Harbor Robotator
y. New York. 1982. 14． Prober et al .: Science 238, 33
6-341 (1987). 15. Takebe et al .: M
ol. Cell. Biol. 8,446-472 (19
88). 16. F. L. Grabam et al .: Virology 5
4,536 (1973). 17． Wheteside et al. Immunol.
Methods 90, 221-223 (1986). 18. Seed et al .: Proc. Natl. Acad. S
ci. USA 84, 3365-3369 (198
6).

[0085]

[Sequence List] <110> Toray Industries, Inc. <120> Stabilization method of interleukin 12 <130> 51E16020 <160> 24 <210> 1 <211> 990 <212> DNA PRT <213> dog <220> <221 > CDS <222> (1) ... (987) <220> <221> mat # peptide <222> (67) ... (987) <400> atg tgt cac cag cag ttg gtc atc tct tgg ttt tcc ctc gtt ttg ctg 48 Met Cys His Gln Gln Leu Val Ile Ser Trp Phe Ser Leu Val Leu Leu gcg tct ccc ctc atg gcc ata tgg gaa ctg gag aaa gat gtt tat gtt 96 Ala Ser Pro Leu Met Ala Ile Trp Glu Leu Glu Asp Val Tyr Val gta gag ttg gac tgg cac cct gat gcc ccc gga gaa atg gtg gtc ctc 144 Val Glu Leu Asp Trp His Pro Asp Ala Pro Gly Glu Met Val Val Leu acc tgc cat acc cct gaa gaa gat gac atc act tgg acc tca gcg cag 192 Thr Cys His Thr Pro Glu Glu Asp Asp Ile Thr Trp Thr Ser Ala Gln agc agt gaa gtc cta ggt tct ggt aaa act ctg acc atc caa gtc aaa 240 Ser Ser Glu Val Leu Gly Ser Gly Lys Thr Leu Thr Ile Gln Val Lys gaa ttt gga gat gct ggc cag tat acc tgc cat aaa gga ggc aag gtt 288 Glu Phe Gly Asp Ala Gly Gln T yr Thr Cys His Lys Gly Gly Lys Val ctg agc cgc tca ctc ctg ttg att cac aaa aaa gaa gat gga att tgg 336 Leu Ser Arg Ser Leu Leu Leu Ile His Lys Lys Glu Asp Gly Ile Trp tcc act gat atc tta aag ga aaa gaa tcc aaa aat aag atc ttt 384 Ser Thr Asp Ile Leu Lys Glu Gln Lys Glu Ser Lys Asn Lys Ile Phe ctg aaa tgt gag gca aag aat tat tct gga cgt ttc aca tgc tgg tgg 432 Leu Lys Cys Glu Ayr Lys Ser Gly Arg Phe Thr Cys Trp Trp ctg acg gca atc agt act gat ttg aaa ttc agt gtc aaa agt agc aga 480 Leu Thr Ala Ile Ser Thr Asp Leu Lys Phe Ser Val Lys Ser Ser Arg ggc ttc tct gac ccc caa ggg gtca tgt gga gca gtg aca ctt tca 528 Gly Phe Ser Asp Pro Gln Gly Val Thr Cys Gly Ala Val Thr Leu Ser gca gag agg gtc aga gtg gac aac agg gat tat aag aag tac aca gtg 576 Ala Glu Arg Val Arg Val Asp Asn Arg Asp Tyr Lys Lys Tyr Thr Val gag tgt cag gag ggc agt gcc tgc ccc tct gcc gag gag agc cta ccc 624 Glu Cys Gln Glu Gly Ser Ala Cys Pro Ser Ala Glu Glu Ser Leu Pro atc gag gtc gtg gtg gat gct attac c tc aag tat gaa aac tac 672 Ile Glu Val Val Val Asp Ala Ile His Lys Leu Lys Tyr Glu Asn Tyr acc agc agc ttc ttc atc aga gac atc atc aaa cca gac cca ccc aca 720 Thr Ser Ser Phe Phe Ile Arg Asp Ile Ile Lys Pro Asp Pro Pro Thr aac ctg cag ctg aag cca ttg gaa aat tct cgg cac gtg gag gtc agc 768 Asn Leu Gln Leu Lys Pro Leu Glu Asn Ser Arg His Val Glu Val Ser tgg gaa tac ccc gac acc tgg agc acc cca cat tcc tac ttc tcc ctg 816 Trp Glu Tyr Pro Asp Thr Trp Ser Thr Pro His Ser Tyr Phe Ser Leu aca ttt tgc ata cag gcc cag ggc aag aac aat aga gaa aag aaa gat 864 Thr Phe Cys Ile Gln Ala Gln Gly Lys Asn Asn Arg Glu Lys Lys Asp aga ctc tgc gtg gac aag acc tca gcc aag gtc gtg tgc cac aag gat 912 Arg Leu Cys Val Asp Lys Thr Ser Ala Lys Val Val Cys His Lys Asp gcc aag atc cgc gtg caa gcc cga gacg agt tca tcc tgg 960 Ala Lys Ile Arg Val Gln Ala Arg Asp Arg Tyr Tyr Ser Ser Ser Trp agc gac tgg gca tct gtg ccc tgc agt tag 990 Ser Asp Trp Ala Ser Val Pro Cys Ser *** <210> 2 <211 > 669 <212> DNA PRT < 213> dog <220> <221> CDS <222> (1) ... (666) <220> <221> peptide <222> (1) ... (666) <220> <221> mat # peptide <222> (76) ... (666) <400> atg tgt cca gcg cgc agc ctc ctc ctt gtc gct acc ctg gtc ctg cta 48 Met Cys Pro Ala Arg Ser Leu Leu Leu Val Ala Thr Leu Val Leu Leu agc cac ctg gac cac ctt act tgg gcc agg agc ctc ccc aca gcc tca 96 Ser His Leu Asp His Leu Thr Trp Ala Arg Ser Leu Pro Thr Ala Ser cca agc cca gga ata ttc cag tgc ctc aac cac tcc caa aac ctg ctg 144 Pro Ser Pro Gly Ile Phe Gln Cys Leu Asn His Ser Gln Asn Leu Leu aga gcc gtc agc aac acg ctt cag aag gcc aga caa act cta gaa tta 192 Arg Ala Val Ser Asn Thr Leu Gln Lys Ala Arg Gln Thr Leu Glu Leu tat tcc tgc act tcc gaa gag att gat cat gaa gat atc aca aag gat 240 Tyr Ser Cys Thr Ser Glu Glu Ile Asp His Glu Asp Ile Thr Lys Asp aaa acc agc aca gtg gag gcc tgc tta cca ctg gaa tta acc atg aat 288 Lys Thr Ser Thr Val Glu Ala Cys Leu Pro Leu Glu Leu Thr Met Asn gag agt tgc ctg gct tcc aga gag atc tct ttg ata act aac ggg agt 336 Glu Ser Cys Leu Ala Ser Arg Glu Ile Ser Leu Ile Thr Asn Gly Ser tgc ctg gcc tct gga aag gcc tct ttt atg acg gtc ctg tgc ctt agc 384 Cys Leu Ala Ser Gly Lys Ala Ser Phe Met Thr Val Leu Cys Leu Ser agc atg tat g gac ttg aag atg tac cag atg gaa ttc aag gcc atg 432 Ser Ile Tyr Glu Asp Leu Lys Met Tyr Gln Met Glu Phe Lys Ala Met aac gca aag ctt tta atg gat ccc aag agg cag atc ttt ctg gat caa Leu Asn Leu Met Asp Pro Lys Arg Gln Ile Phe Leu Asp Gln aac atg ctg acg gct atc gat gag ctg tta cag gcc ctg aat ttc aac 528 Asn Met Leu Thr Ala Ile Asp Glu Leu Leu Gln Ala Leu Asn Phe Asgt ggt act cag aaa tcc tcc ctt gaa gag ccg gat ttt tat 576 Ser Val Thr Val Pro Gln Lys Ser Ser Leu Glu Glu Pro Asp Phe Tyr aaa act aaa atc aag ctc tgc ata ctt ctt cat gct ttc aga att cgt 624 Lys Thr Lys Ile Lys Leu Cys Ile Leu Leu His Ala Phe Arg Ile Arg gcg gtg acc atc gac aga atg atg agc tat ctg agt tct tcc tag 669 Ala Val Thr Ile Asp Arg Met Met Ser Tyr Leu Ser Ser Ser *** <210> 3 <211 > 33 <212> DNA <213> Artificial Sequence <400> atgtgtcacc agcagttggt catctcttgg ttt 33 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <400> ctaactgcag ggcacagatg ccca 24 <210> 5 <211> 42 <212> DNA <213> Artificial Sequence <400> agcatgtgtc cagcgcgcag cctcctcctt gtcgctaccc tg 42 <210> 6 <211> 39 <212> DNA <213> Artificial Sequence <400> ctaggaagaa ctcagatagc tcatcattct gtcgatggt 39 <210> 7 <211> 39 <212> DNA <213> Artificial Sequence <400> ggggaattca tgtgtcacca gcagttggtc atctcttgg 39 <210> 8 <211> 39 <212> DNA <213> Artificial Sequence <400> cccgaattcc taactgcagg gcacagatgc ccagtcgct 39 <210> 9 <211> 39 <212> DNA <213> Artificial Sequence <400> gggctgcaga tgtgtccagc gcgcagcctc ctccttgtc 39 <210> 10 <211> 39 <212> DNA <213> Artificial Sequence <400> gggctgcagc taggaagaac tcagatagct catcattct 39 <210> 11 <211> 990 <212> DNA PRT <213 > dog <220> <221> CDS <222> (1) ... (987) <220> <221> mat # peptide <222> (67) ... (987) <400> atg cat cct cag cag ttg gtc atc tcc tgg ttt tcc ctc gtt ttg ctg 48 Met His Pro Gln Gln Leu Val Ile Ser Trp Phe Ser Leu Val Leu Leu gcg tct ccc ctc atg gcc ata tgg gaa ctg gag aaa gat gtt tat gtt 96 Ala Ser Pro Leu Met Ala Ile Trp Glu Leu Glu Lys Asp Val Tyr Val gta gag ttg gac tgg cac cct gat gcc ccc gga gaa atg gtg gtc ctc 144 Val Glu Leu Asp Trp His Pro Asp Ala Pro Gly Glu Met Val Val Leu acc tgc cat acc cct gaa gaa gat gac atc act tgg acc tca gcg cag 192 Thr Cys His Thr Pro Glu Glu Asp Asp Ile Thr Trp Thr Ser Ala Gln agc agt gaa gtc cta ggt tct ggt aaa act ctg acc atc caa gtc aaa 240 Ser Ser Glu Val Leu Gly Ser Gly Lys Thr Leu Thr Ile Gln Val Lys gaa ttt gga gat gct ggc cag tat acc tgc cat aaa gga ggc aag gtt 288 Glu Phe Gly Asp Ala Gly Gln Tyr Thr Cys His Lys Gly Gly Lys Val ctg agc cgc tca ctc ctg ttg att cac aaa aaa gaa gat gga att tgg 336 Leu Seru Serg Leu Ile His Lys Lys Glu Asp Gly Ile Trp tcc act gat atc tta aag gaa cag aaa gaa tcc aaa aat aag atc ttt 384 Ser Thr Asp Ile Leu Lys Glu Gln Lys Glu Ser Lys Asn Lys Ile Phe ctg aaa tgt gag acaat t at tct gga cgt ttc aca tgc tgg tgg 432 Leu Lys Cys Glu Ala Lys Asn Tyr Ser Gly Arg Phe Thr Cys Trp Trp ctg acg gca atc agt act gat ttg aaa ttc agt gtc aaa agt agc aga 480 Leu Thr Ala Ile Thr Leu Lys Phe Ser Val Lys Ser Ser Arg ggc ttc tct gac ccc caa ggg gtg aca tgt gga gca gtg aca ctt tca 528 Gly Phe Ser Asp Pro Gln Gly Val Thr Cys Gly Ala Val Thr Leu Ser gca gag agg gtc aga gtg gac aac agg gat tat aag aag tac aca gtg 576 Ala Glu Arg Val Arg Val Asp Asn Arg Asp Tyr Lys Lys Tyr Thr Val gag tgt cag gag ggc agt gcc tgc ccc tct gcc gag gag agc cta ccc 624 Glu Cys Gln Glu Gly Ser Ala Pro Ser Ala Glu Glu Ser Leu Pro atc gag gtc gtg gtg gat gct att cac aag ctc aag tat gaa aac tac 672 Ile Glu Val Val Val Asp Ala Ile His Lys Leu Lys Tyr Glu Asn Tyr acc agc agc ttc ttc atc agac atc aaa cca gac cca ccc aca 720 Thr Ser Ser Phe Phe Ile Arg Asp Ile Ile Lys Pro Asp Pro Pro Thr aac ctg cag ctg aag cca ttg aaa aat tct cgg cac gtg gag gtc agc 768 Asn Leu Gln Leu Lys Pro Leu Lys Asn S er Arg His Val Glu Val Ser tgg gaa tac ccc gac acc tgg agc acc cca cat tcc tac ttc tcc ctg 816 Trp Glu Tyr Pro Asp Thr Trp Ser Thr Pro His Ser Tyr Phe Ser Leu aca ttt tgc ata cag gcc cag ggc aag aac aat aga gaa aag aaa gat 864 Thr Phe Cys Ile Gln Ala Gln Gly Lys Asn Asn Arg Glu Lys Lys Asp aga ctc tgc gtg gac aag acc tca gcc aag gtc gtg tgc cac aag gat 912 Arg Leu Cys Val Asp Lys Thr Val Val Cys His Lys Asp gcc aag atc cgc gtg caa gcc cga gac cgc tac tat agt tca tcc tgg 960 Ala Lys Ile Arg Val Gln Ala Arg Asp Arg Tyr Tyr Ser Ser Ser Trp agc gac tgg gca tct gtg tcc tgc agt tag 990 Ser Asp Trp Ala Ser Val Ser Cys Ser *** <210> 12 <211> 669 <212> DNA PRT <213> dog <220> <221> CDS <222> (1) ... (666) <220 > <221> peptide <222> (1) ... (666) <220> <221> mat # peptide <222> (76) ... (666) <400> atg tgc ccg ccg cgc ggc ctc ctc ctt ggt acc atc ctg gtc ctg cta 48 Met Cys Pro Pro Arg Gly Leu Leu Leu Val Thr Ile Leu Val Leu Leu agc cac ctg gac cac ctt act tgg gcc agg agc ctc ccc aca gcc tca 96 Ser His Leu Asp His Leu Thr Trp Ala Arg Ser Leu Pro Thr Ala Ser ccg agc cca gga ata ttc cag tgc ctc aac cac tcc caa aac ctg ctg 144 Pro Ser Pro Gly Ile Phe Gln Cys Leu Asn His Ser Gln Asn Leu Leu aga gcc gtc agc aac acg ctt cag aag gcc aga caa act cta gaa tta 192 Arg Ala Val Ser Asn Thr Leu Gln Lys Ala Arg Gln Thr Leu Glu Leu tat tcc tgc act tcc gaa gag att gat cat gaa gat atc aca aag gat 240 Tyr Ser Cys Thr Ser Glu Glu Ile Asp His Glu Asp Ile Thr Lys Asp aaa acc agc aca gtg gag gcc tgc tta cca ctg gaa tta acc atg aat 288 Lys Thr Ser Thr Val Glu Ala Cys Leu Pro Leu Glu Leu Thr Met Asn gag agt tgc ctg gct tcc aga gag atc tct ttg ata act aac ggg agt 336 Glu Ser Cys Leu Ala Ser Arg Glu Ile Ser Leu Ile Thr Asn Gly Ser tgc ctg gcc tct gga aag gcc tct ttt atg acg gtc ctg tgc ctt agc Ala Ser Gly Lys Ala Ser Phe Met Thr Val Leu Cys Leu Ser agc atc tat gag gac ttg aag atg tac cag atg gaa ttc aag gcc atg 432 Ser Ile Tyr Glu Asp Leu Lys Met Tyr Gln Met Glu Phe Lys Ala Met aac gag ctt tta atg gat ccc aag agg cag atc ttt ctg gat caa 480 Asn Ala Lys Leu Leu Met Asp Pro Lys Arg Gln Ile Phe Leu Asp Gln aac atg ctg aca gct atc gat gag ctg tta cag gcc ctg Aat Astc aet 528 Thr Ala Ile Asp Glu Leu Leu Gln Ala Leu Asn Phe Asn agt gtg act gtg cca cag aaa tcc tcc ctt gaa gag ccg gat ttt tat 576 Ser Val Thr Val Pro Gln Lys Ser Ser Leu Glu Glu Pro Asp Phe Tyr aaa act aaa atc aag ctc tgc ata ctt ctt cat gct ttc aga att cgt 624 Lys Thr Lys Ile Lys Leu Cys Ile Leu Leu His Ala Phe Arg Ile Arg gcg gtg acc atc gat aga atg atg agt tat ctg aat tct tcc taa 669 Ala Val Thr I Arg Met Met Ser Tyr Leu Asn Ser Ser *** <210> 13 <211> 39 <212> DNA <213> Artificial Sequence <400> ggggaattca tgcatcctca gcagttggtc atctcctgg 39 <210> 14 <211> 39 <212> DNA < 213> Artificial Sequence <400> cccgaattcc taactgcagg acacagatgc ccagtcgct 39 <210> 15 <211> 39 <212> DNA <213> Artificial Sequence <400> gggctgcaga tgtgcccgcc gcgcggcctc ctccttgtg 39 <210> 16 <211> 39 <212> DNA 213> Artific ial Sequence <400> gggctgcagt taggaagaat tcagataact catcattct 39 <210> 17 <211> 36 <212> PRT <213> Artificial Sequence <400> Ile Trp Glu Leu Glu Lys Asp Val Tyr Val Val Glu Leu Asp Trp His 5 10 15 Pro Asp Ala Pro Gly Glu Met Val Val Leu Thr Cys His Thr Pro Glu 20 25 30 Glu Asp Asp Ile 35 <210> 18 <211> 27 <212> PRT <213> Artificial Sequence <400> Ser Ser Phe Phe Ile Arg Asp Ile Ile Lys Pro Asp Pro Pro Thr Asn 5 10 15 Leu Gln Leu Lys Pro Leu Lys Asn Ser Arg His 20 25 <210> 19 <211> 30 <212> PRT <213> Artificial Sequence <400> Val Glu Val Ser Trp Glu Tyr Pro Asp Thr Trp Ser Thr Pro His Ser 5 10 15 Tyr Phe Ser Leu Thr Phe Cys Ile Gln Ala Gln Gly Lys Asn 20 25 30 <210> 20 <211> 27 <212> PRT <213> Artificial Sequence <400 > Lys Asp Ala Lys Ile Arg Val Gln Ala Arg Asp Arg Tyr Tyr Ser Ser 5 10 15 Ser Trp Ser Asp Trp Ala Ser Val Ser Cys Ser 20 25 <210> 21 <211> 30 <212> PRT <213> Artificial Sequence <400> Arg Ser Leu Pro Thr Ala Ser Pro Ser Pro Gly Ile Phe Gln Cys Leu 5 10 15 Asn His Ser Gln As n Leu Leu Arg Ala Val Ser Asn Thr Leu 20 25 30 <210> 22 <211> 30 <212> PRT <213> Artificial Sequence <400> Thr Ser Glu Glu Ile Asp His Glu Asp Ile Thr Lys Asp Lys Thr Ser 5 10 15 Thr Val Glu Ala Cys Leu Pro Leu Glu Leu Thr Met Asn Glu 20 25 30 <210> 23 <211> 27 <212> PRT <213> Artificial Sequence <400> Glu Leu Leu Gln Ala Leu Asn Phe Asn Ser Val Thr Val Pro Gln Lys 5 10 15 Ser Ser Leu Glu Glu Pro Asp Phe Tyr Lys Thr 20 25 <210> 24 <211> 30 <212> PRT <213> Artificial Sequence <400> Lys Thr Lys Ile Lys Leu Cys Ile Leu Leu His Ala Phe Arg Ile Arg 5 10 15 Ala Val Thr Ile Asp Arg Met Met Ser Tyr Leu Asn Ser Ser 20 25 30

[0086]

According to the present invention, interleukin 12
Can be stabilized for a long time.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C07K 1/14 A61K 37/02

Claims (6)

[Claims] 1. A method for stabilizing interleukin 12, comprising mixing interleukin 12 with a surfactant. 2. The method for stabilizing interleukin 12 according to claim 1, wherein the surfactant is mixed at a concentration of 0.001 to 10% by weight. 3. Interleukin 1 according to claim 1, wherein the surfactant is non-ionic.
2. Stabilization method. 4. The method for stabilizing interleukin 12 according to claim 3, wherein the nonionic surfactant is polyoxyethylene hydrogenated castor oil 60. 5. The method for stabilizing interleukin 12 according to claim 1, wherein the interleukin 12 is dog interleukin 12. 6. The pH of a solution containing interleukin 12
6. The method according to claim 1, wherein the value is from 4 to 10.
The method for stabilizing interleukin 12 according to any one of the above.