JP3624391B2 - Dog interleukin 12 and method for producing the same - Google Patents

Description

【００３３】

【００３４】

【００３５】

【００３６】

【００３７】

【００３８】

【００３９】

【００４０】

【００４１】

【００４２】

【００４３】
配列番号：１２配列の長さ：６６９配列の型：核酸鎖の数：二本鎖トポロジー：直鎖状配列の種類：ｃＤＮＡ ｔｏ ｍＲＮＡ起源生物名：イヌ配列の特徴特徴を表わす記号：ｐｅｐｔｉｄｅ存在位置：１．．６６６特徴を決定した方法：Ｓ配列ＡＴＧ ＴＧＣ ＣＣＧ ＣＣＧ ＣＧＣ ＧＧＣ ＣＴＣ ＣＴＣ ＣＴＴ ＧＴＧ ＡＣＣ ＡＴＣ ＣＴＧ ＧＴＣ ＣＴＧ ＣＴＡ ４８Ｍｅｔ Ｃｙｓ Ｐｒｏ Ｐｒｏ Ａｒｇ Ｇｌｙ Ｌｅｕ Ｌｅｕ Ｌｅｕ Ｖａｌ Ｔｈｒ Ｉｌｅ Ｌｅｕ Ｖａｌ Ｌｅｕ ＬｅｕＡＧＣ ＣＡＣ ＣＴＧ ＧＡＣ ＣＡＣ ＣＴＴ ＡＣＴ ＴＧＧ ＧＣＣ ＡＧＧ ＡＧＣ ＣＴＣ ＣＣＣ ＡＣＡ ＧＣＣ ＴＣＡ ９６Ｓｅｒ Ｈｉｓ Ｌｅｕ Ａｓｐ Ｈｉｓ Ｌｅｕ Ｔｈｒ Ｔｒｐ Ａｌａ Ａｒｇ Ｓｅｒ Ｌｅｕ Ｐｒｏ Ｔｈｒ Ａｌａ ＳｅｒＣＣＡ ＡＧＣ ＣＣＡ ＧＧＡ ＡＴＡ ＴＴＣ ＣＡＧ ＴＧＣ ＣＴＣ ＡＡＣ ＣＡＣ ＴＣＣ ＣＡＡ ＡＡＣ ＣＴＧ ＣＴＧ １４４Ｐｒｏ Ｓｅｒ Ｐｒｏ Ｇｌｙ Ｉｌｅ Ｐｈｅ Ｇｌｎ Ｃｙｓ Ｌｅｕ Ａｓｎ Ｈｉｓ Ｓｅｒ Ｇｌｎ Ａｓｎ Ｌｅｕ ＬｅｕＡＧＡ ＧＣＣ ＧＴＣ ＡＧＣ ＡＡＣ ＡＣＧ ＣＴＴ ＣＡＧ ＡＡＧ ＧＣＣ ＡＧＡ ＣＡＡ ＡＣＴ ＣＴＡ ＧＡＡ ＴＴＡ １９２Ａｒｇ Ａｌａ Ｖａｌ Ｓｅｒ Ａｓｎ Ｔｈｒ Ｌｅｕ Ｇｌｎ Ｌｙｓ Ａｌａ Ａｒｇ Ｇｌｎ Ｔｈｒ Ｌｅｕ Ｇｌｕ ＬｅｕＴＡＴ ＴＣＣ ＴＧＣ ＡＣＴ ＴＣＣ ＧＡＡ ＧＡＧ ＡＴＴ ＧＡＴ ＣＡＴ ＧＡＡ ＧＡＴ ＡＴＣ ＡＣＡ ＡＡＧ ＧＡＴ ２４０Ｔｙｒ Ｓｅｒ Ｃｙｓ Ｔｈｒ Ｓｅｒ Ｇｌｕ Ｇｌｕ Ｉｌｅ Ａｓｐ Ｈｉｓ Ｇｌｕ Ａｓｐ Ｉｌｅ Ｔｈｒ Ｌｙｓ Ａｓｐ

【００４４】

【００４５】

【００４６】

【００４７】

[0001]
BACKGROUND OF THE INVENTION
The present invention mass-produces canine interleukin 12 (hereinafter abbreviated as CaIL12) whose primary protein structure is derived from canine genetic information by genetic engineering technology, and thus has veterinary drugs (antitumor / antivirus / vaccine adjuvants). The present invention relates to a plasmid, a transformant, CaIL12, and a method for producing the same.
[0002]
[Prior art]
Interleukin 12 is a heterodimer of a protein with a molecular weight of about 40 kD (hereinafter abbreviated as P40) and a protein of about 35 kD (hereinafter abbreviated as P35), and activates natural killer cells and type 1 helper T cells. It is a cytokine having an active action and is abbreviated as IL12. For example, as in Reference 1, several documents have been published so far. In addition to human IL12, IL12 cDNA from mouse (Reference 2) and bovine (GenBank database registration numbers U11815 and U14416) has also been cloned by gene manipulation techniques, and application development research has been conducted as a therapeutic agent for tumors and viral diseases. Yes.
[0003]
[Problems to be solved by the invention]
However, there are no reports that canine IL12 has been cloned.
[0004]
Dogs are known to have numerous tumors such as breast tumors, numerous viral diseases such as parvovirus infection, distemper infection, and allergic dermatitis.
[0005]
Therefore, if canine IL12 becomes readily available, it is expected that the use as canine antitumor agents, antiallergic agents, and antiviral agents will be opened.
[0006]
[Means for Solving the Problems]
In view of such circumstances, the present inventor has succeeded in cloning the respective genes encoding P40 and P35 of CaIL12 from canine cDNA for the purpose of cloning of CaIL12 cDNA and mass production using the same. In addition, the inventors succeeded in producing a cell that produces CaIL12 using two plasmids in which they are linked to an expression vector, thereby establishing a method for easily producing CaIL12 in large quantities, thus completing the present invention. It came to.
[0007]
That is, the present invention provides plasmids for producing CaIL12, transformants of E. coli having these plasmids, animal cells transformed with this plasmid, and CaIL12 obtained from these transformants. Furthermore, the present invention also provides a gene encoding each of the two subunits of the CaIL12 protein.
[0008]
DETAILED DESCRIPTION OF THE INVENTION
A plasmid incorporating DNAs encoding the two subunits of the CaIL12 protein of the present invention can be produced, for example, as follows. That is, after extracting poly (A) RNA from canine cells, cDNA was synthesized and polymerase chain reaction (hereinafter referred to as “polymerase chain reaction”) using primers based on gene sequences encoding two subunits of bovine and human IL12, respectively. (Abbreviated as PCR), two genes each encoding two subunits exhibiting CaIL12 activity can be cloned. Moreover, a full length of CaIL12P40 cDNA and CaIL12P35 cDNA can be cloned by preparing a phage library from the synthesized cDNA recombinant and performing plaque hybridization with two gene fragments obtained by PCR.
[0009]
As a method for obtaining RNA from dog furniture or cells, such as canine mononuclear cells or lymphocytes stimulated with mitogen, etc., conventional methods such as polysome separation, sucrose density gradient centrifugation and electrophoresis are used. The method that I did. As a method for extracting RNA from the above canine apparatus and canine cells, a guanidine thiocyanate-cesium chloride method in which CsCl density gradient centrifugation is performed after guanidine thiocyanate treatment (Reference 3) is used in the presence of a ribonuclease inhibitor in the presence of a ribonuclease inhibitor. Method of phenol extraction after treatment with activator (Reference 4), guanidine / thiocyanate-hot / phenol method, guanidine / thiocyanate / guanidine hydrochloride method, guanidine / thiocyanate / phenol / chloroform method, guanidine / thiocyanate and chlorination An appropriate method can be selected from the method of precipitating RNA by treatment with lithium.
[0010]
It can be obtained by isolating mRNA from canine mononuclear cells and lymphocytes stimulated with canine utensils, mitogens, etc. by conventional methods such as lithium chloride / urea method, guanidine isothiocyanate method, oligo dT cellulose column method, etc. From mRNA, a conventional method such as the method of Gubler et al. CDNA is synthesized by the method of Okayama et al. (Reference 6). In order to synthesize cDNA from the obtained mRNA, basically, a reverse transcriptase such as avian osteoblast virus (AMV) or the like may be used, or a method using a DNA polymerase or the like using a one-part primer may be combined. It is convenient to use a commercially available synthesis or cloning kit.
[0011]
By performing PCR using this cDNA as a template and primers based on the base sequences of human, mouse and bovine, genes encoding P40 subunit and P35 subunit exhibiting CaIL12 activity can be cloned. Further, the synthesized cDNA is linked to a λ phage vector, and then packaged by mixing with a coat protein of λ phage in vitro, and the generated phage particles are infected with E. coli serving as a host. At this time, Escherichia coli infected with λ phage is lysed, and each clone is recovered as a plaque. The plaques are transferred to a filter such as nitrocellulose, and the full lengths of CaIL12P40 cDNA and CaIL12P35 cDNA can be cloned by hybridization using a gene obtained by radiolabeled PCR as a probe.
[0012]
Prokaryotes or eukaryotes can be used as the host. As prokaryotes, bacteria, particularly Escherichia coli, Bacillus bacteria, such as Bacillus subtilis, and the like can be used. As eukaryotes, yeasts such as yeasts belonging to the genus Saccharomyces, e.g. eukaryotic microorganisms such as Saccharomyces cerevisiae, insect cells, for example, Yotoga Cells (Spodoptera frugiperda), cabbage looper cells (Trichoplusiani), silkworm cells (Bombyx mori), animal cells such as human cells, monkey cells, mouse cells and the like can be used. In the present invention, the organism itself, for example, an insect such as a silkworm, a cabbage looper, or the like can also be used.
[0013]
As expression vectors, plasmids, phages, phagemids, viruses (baculo (insects), vaccinia (animal cells)) and the like can be used. The promoter in the expression vector is selected depending on the host bacterium. For example, a lac promoter, a trp promoter or the like is used as a bacterial promoter, and an adh1 promoter, a pqk promoter, or the like is used as a yeast promoter. Examples of the promoter for insects include baculovirus polyhedrin promoter and p10 promoter, and examples of animal cells include, but are not limited to, the early or late promoter of Simian Virus 40. Transformation of a host with an expression vector can be carried out by conventional methods well known in the art, and these methods are described in, for example, Current Protocols in Molecular Biology, John Wiley & Sons. The transformant can be cultured according to a conventional method.
[0014]
The produced CaIL12 has an apparent molecular weight of about 70-80 kD as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under non-reduction.
[0015]
In SDS-PAGE, the 70-80 kD band produces two subunits with molecular weights of about 40 kD and about 35 kD under reducing conditions.
As shown in Example 2 below, CaIL12 is mainly characterized by the ability to induce canine interferon γ from canine leukocytes and the effect of promoting proliferation of canine lymphocytes stimulated with phytohemagglutinin (hereinafter abbreviated as PHA). Is done. In addition, it has the activity of activating NK cells and cytotoxic T cells to thaw their target cells, such as tumor-derived cell lines or virus-infected fibroblasts.
[0016]
【Example】
Hereinafter, the present invention will be described more specifically with reference to examples.
[0017]
Example 1
Cloning of CaIL12P40 and P35 genes
(1) Preparation of canine cDNA
Treated with canine liver, canine peripheral blood mononuclear cells stimulated with LPS (50 μg / ml) for 48 hours and chicken Newcastle disease virus for 7 hours (10 ⁷ pfu / ml) Total RNA was prepared from canine spleen-derived lymphocytes using ISOGEN (Nippon Gene). The obtained RNA was dissolved in 10 mM Tris-HCl buffer (pH 7.5) (hereinafter abbreviated as TE) containing 1 mM EDTA, treated at 70 ° C. for 5 minutes, and then the same amount of TE containing 1 M LiCl was added. . The RNA solution was applied to an oligo dT cellulose column equilibrated with TE containing 0.5 M LiCl and washed with the same buffer. Further, after washing with TE containing 0.3 M LiCl, the poly (A) RNA adsorbed with 2 mM EDTA (pH 7.0) containing 0.01% SDS was eluted. Single-stranded cDNA was synthesized using the poly (A) RNA thus obtained. Specifically, 5 μg of poly (A) RNA and 0.5 μg of oligo dT primer (12-18mer) were placed in a sterilized 0.5 ml microcentrifuge tube, and diethylpyrocarbonate-treated sterilized water was added to make 12 μl. Incubated for 10 minutes and then placed on ice for 1 minute. To this, 2 μl of 200 mM Tris-HCl (pH 8.4), 500 mM KCl solution, 25 mM MgCl ₂ 2 μl, 10 μm dNTP 1 μl and 0.1 M DTT 2 μl, respectively, and incubated at 42 ° C. for 5 minutes. Then, 200 μl of GibcoBRL SuperScript II RT was added and incubated at 42 ° C. for an additional 50 minutes for cDNA synthesis. Reaction was performed. The reaction was stopped by further incubation at 70 ° C. for 15 minutes and placed on ice for 5 minutes. In this reaction solution, 1 μl of E. coli was added. E. coli RNase H (2 units / ml) was added and incubated at 37 ° C. for 20 minutes.
[0018]
(2) Preparation of canine cDNA phage library
Using 1 μg of the poly (A) RNA obtained in (1) above, a double-stranded cDNA was synthesized using an oligo dT primer using a Pharmacia Time Saver cDNA synthesis kit according to the attached manual, and EcoRI / NotI. The adapter was connected. Using this, a recombinant λgt10 vector was prepared in accordance with the attached manual with Amersham cDNA Rapid Cloning Module-λgt10, and a recombinant phage was prepared with an in vitro packaging module of Amersham according to the attached manual. .
(3) Cloning of CaIL12P40 gene
Based on the base sequences of N-terminal and C-terminal of human IL12P40 (Reference 1),
5'ATGTGTCACCAGCAGTGTGTCATCTCTTGGTTT3 '(SEQ ID NO: 3)
When
5 ′ CTAACTGCAGGGGCACAGTGCCCA3 ′ (SEQ ID NO: 4)
These two types of primers were synthesized with a DNA synthesizer. 2 μl of cDNA obtained from dog liver and LPS-stimulated canine peripheral blood (1) above was taken in separate 0.5 ml microcentrifuge tubes, and each primer was 20 pmol, 20 mM Tris-HCl buffer (pH 8.0), 1 .5 mM MgCl ₂ 25 mM KCl, 100 μg / ml gelatin, 50 μM each dNTP, 4 units Each reagent is added to make Taq DNA polymerase to make a total volume of 100 μl. 35 cycles using a DNA thermal cycler from Perkin-Elmer Cetus under conditions of DNA denaturation at 94 ° C for 1 minute, primer annealing at 55 ° C for 2 minutes, and primer extension at 72 ° C for 3 minutes. Reacted. This was electrophoresed on a 1% agarose gel, and a DNA fragment of about 990 bp was prepared according to a conventional method (Reference 7).
[0019]
This DNA fragment was transferred to T-Vector of Invitrogen by Takara Shuzo Co., Ltd. DNA Ligation Kit Ver. 1 was used for ligation. Using this, Escherichia coli was transformed according to a conventional method, and plasmid DNA was prepared from the obtained transformant by a conventional method. Next, it was confirmed by PCR under the same conditions as described above that the PCR fragment had been inserted into this plasmid, and CaIL12 activity was expected by the dideoxy method (Reference 9) using Genesis 2000 DNA analysis system (DuPont). The base sequence of one P40 subunit DNA was determined. This sequence is shown in SEQ ID NO: 1. In addition, a 990 bp DNA fragment containing this sequence was used using Takara Shuzo's Random Primer DNA Labeling Kit. ³² P was labeled to prepare a probe. The recombinant phage library prepared from the canine liver cDNA obtained in (2) above was formed as a plaque on E. coli NM514, and transcribed into Abondham's Hybond-N + according to a conventional method. Hybond-N + is 5 × SSPE (0.9 M NaCl, 50 mM NaH ₂ PO ₄ , 5 mM EDTA, pH 7.4), 5 × Denhardt's solution (0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.1% SDS, 100 μg / ml salmon sperm DNA, Incubate for 2 hours at 65 ° C., then 1 × 10 labeled probe prepared as described above in the same solution ⁶ Hybridized with cpm / ml. After overnight incubation at 65 ° C., Hybond-N + was washed three times for 15 minutes in 0.2 × SSC (30 mM NaCl, 3 mM sodium citrate), 0.1% SDS, and Fuji Photo Film Co., Ltd. The sample was exposed to an imaging plate for 12 hours and analyzed with a bioimaging analyzer from Fuji Photo Film Co., Ltd. Plaques with a positive signal were rescreened according to conventional methods. As a result of screening three times, one recombinant phage having a positive signal was obtained. Phage DNA was extracted from this recombinant phage according to a conventional method and cleaved with the restriction enzyme EcoRI, and then a DNA fragment obtained by 1% agarose gel electrophoresis was prepared according to a conventional method, and DNA Ligation from Takara Shuzo Co., Ltd. Kit Ver. 2 was used to ligate with pUC118BAP-treated DNA (EcoRI / BAP) from Takara Shuzo Co., Ltd. Using this, a plasmid DNA was prepared by a conventional method, and obtained using a fluorescent DNA sequencer (DNA sequencer 373S manufactured by PerkinElmer Co.) and using a dye terminator cycle sequencing kit manufactured by PerkinElmer Co. according to the attached protocol. The base sequence of the DNA fragment was determined. Among these, the sequence encoding CaIL12P40 is shown in SEQ ID NO: 11.
[0020]
(4) Cloning of the CaIL12P35 gene
Based on the nucleotide sequence of the N-terminus of human IL12P35 (Reference 1) and the C-terminus of bovine IL12P35,
5 'AGCATGTGTCCAGCGCGCAGCCTCCTCTCCTGTCGCTACCCTTG3' (SEQ ID NO: 5)
When
5 ′ CTAGGAAGAACTCAGATAGAGCTCATCATTCTGTCGATGGT3 ′ (SEQ ID NO: 6)
These two types of primers were synthesized with a DNA synthesizer. Using the cDNA obtained from canine spleen-derived lymphocytes treated with chicken Newcastle disease virus of (1) above as a template, a DNA fragment of about 670 bp was obtained in the same manner as in (3) above, inserted into T-Vector, and CaIL12 activity The base sequence of one P35 subunit DNA was determined. This sequence is shown in SEQ ID NO: 2. Also, a labeled probe was prepared using a DNA fragment of about 670 bp containing this sequence. A recombinant phage library prepared from cDNA obtained from canine spleen-derived lymphocytes treated with chicken Newcastle disease virus obtained in (2) above was hybridized with a labeled probe in the same manner as in (3) above, Screening was performed. As a result, DNA was extracted from one recombinant phage having a positive signal, cleaved with restriction enzyme NotI, and then a DNA fragment of about 1.2 kb obtained by 1% agarose gel electrophoresis was subjected to STRATAGENE. It was linked to the NotI site of pBluescript II of the company according to a conventional method. Plasmid DNA was prepared using this, and the base sequence of the obtained DNA fragment was determined using a fluorescent DNA sequencer. Among these, the sequence encoding CaIL12P35 is shown in SEQ ID NO: 12.
[0021]
Example 2
Production of CaIL12
(1) Preparation of CaIL12 expression vector
The expression vector pCDL-SRα296 (Reference 9) was cleaved with the restriction enzyme EcoRI, and the end was dephosphorylated with bacterial alkaline phosphatase. This was prepared by 1% agarose gel electrophoresis and a DNA fragment of about 3.6 kb was prepared according to a conventional method. On the other hand, the CaIL12P40 DNA fragment is
5 ′ GGGGAATTCATGTTCACCAGCAGTGTGTCATCTCTTG3 ′ (SEQ ID NO: 7)
When
5 'CCCGAATTCCTAACTGCAGGGCACAGATGGCCCAGTCCGCT 3' (SEQ ID NO: 8)
A primer added with the two types of EcoRI cleavage sites was prepared, and one P40 subunit DNA of the two subunits considered to exhibit CaIL12 activity inserted into the T-Vector prepared in Example 1 (2) was obtained. As a template, PCR was performed at 94 ° C. for 1 minute for DNA denaturation conditions, 55 ° C. for 2 minutes for primer annealing conditions, 72 ° C. for 3 minutes for primer extension conditions, 30 minutes for cycles, and after ethanol precipitation, restriction enzyme After cleaving with EcoRI, a DNA fragment of about 990 bp was prepared by 1% agarose gel electrophoresis. Also,
5 ′ GGGGAATTCATGCATCCCTCAGCAGTTGGTCCATCTCTGG3 ′ (SEQ ID NO: 13)
When
5 ′ CCCGAATTCCTAACTGCAGGACACAGATGGCCCAGTCCGCT 3 ′ (SEQ ID NO: 14)
PCR was performed using the CaIL12P40 DNA inserted into pUC118 prepared in Example 1 (2) as a template, and digested with EcoRI to prepare a DNA fragment of about 990 bp. . Each of the obtained CaIL12P40 DNA fragments was ligated to pCDL-SRα296 prepared as described above using T4 DNA ligase. Escherichia coli was transformed using this, plasmid DNA was prepared from the obtained transformant, and FOCaIL12P40 and FOCaIL12P40FL expressing CaIL12P40 were obtained. Further, pCDL-SRα296 was cleaved with the restriction enzyme PstI, dephosphorylated, and a DNA fragment of about 3.6 kb was prepared by electrophoresis. CaIL12P35
DNA fragments
5′GGGCTGCAGAGTGTCCAGCGCGGCAGCCTCCCTCTGTGTC3 ′ (SEQ ID NO: 9)
When
5 ′ GGGCTGCAGCTAGGAGAGAACTCAGATAGAGCTCATCATCTCT 3 ′ (SEQ ID NO: 10)
A primer added with two types of PstI cleavage sites was prepared, and one of the two P35 subunit DNAs, which was considered to exhibit CaIL12 activity, was inserted into the T-Vector prepared in Example 1 (3). As a template, PCR was performed at 94 ° C., 1 minute, 55 ° C., 2 minutes, 72 ° C., 3 minutes, 30 cycles, ethanol precipitation, and then digestion with restriction enzyme PstI. About 670 bp DNA fragment was prepared from this by 1% agarose gel electrophoresis. Also,
5 ′ GGGCTGCAGATGTGCCCGCCGCGCGGGCCTCCTCTTGTG3 ′ (SEQ ID NO: 15)
When
5 ′ GGGCTGCAGGTTAGGAAGAATTCAGATAACTCATCATCTCT 3 ′ (SEQ ID NO: 16)
PCR was performed using the CaIL12P35 DNA inserted into pUC118 prepared in Example 1 (2) as a template, and digested with PstI to prepare a DNA fragment of about 670 bp. . Each of the obtained CaIL12P35 DNA fragments was ligated to pCDL-SRα296 prepared by cutting with PstI using T4 DNA ligase as described above, E. coli transformation and plasmid DNA preparation were performed to obtain FOCaIL12P35 and FOCaIL12P35FL expressing CaIL12P35. .
[0022]
Furthermore, the base sequences of CaIL12P40 DNA and CaIL12P35 DNA in these four expression plasmids prepared were confirmed.
[0023]
(2) Production of CaIL12 in monkey COS cells
4 ml of ERDF medium containing 5 μg of FOCaIL12P40 and FOCaIL12P35 obtained in (1) above each containing 50 mM Tris-HCl buffer (pH 7.5), 400 μg / ml DEAE dextran (Pharmacia) and 100 μM chloroquine (Sigma) (Add to Far East Pharmaceutical Co., Ltd.) On the other hand, COS-1 cells (ATCC CRL-1650) grown to 50% confluent in ERDF medium containing 10% fetal bovine serum (Gibco, hereinafter abbreviated as FBS) using a dish having a diameter of 10 cm are used as PBS. After washing once with 4% of the DNA mixture obtained above, add 5% CO2. ₂ The cells were cultured at 37 ° C. After 4 hours, the cells were washed with PBS and then 5% CO in 10 ml of 10% FBS-ERDF medium. ₂ And culture at 37 ° C. for 4 days to obtain a culture supernatant in which CaIL12 was produced.
[0024]
(3) Measurement of CaIL12 activity
The activity of CaIL12 produced in the above (2) was measured as follows. For assay of canine inter-feron γ-inducing activity from canine lymphocytes, antiviral activity and canine cell class II MHC expression enhancing activity were measured.
[0025]
Lymphocytes are isolated from canine spleen and 10% with 10% FBS-ERDF. ⁶ It was suspended at a cell density of cells / ml, and 2.5 ml of this was added to a 6 cm dish. To this was added 2.5 ml of the culture supernatant obtained in (2) above, and 5% CO 2 was added. ₂ The culture solution was cultured at 37 ° C. for 2 days, and the antiviral activity of this culture solution was measured according to the CPE method of Reference 10 using vesicular Stomatis virus as virus and MDCK (ATCC CCL-34) as sensitive cells. As a result, 10 ⁵ Antiviral activity of dilution unit / ml or more was confirmed. On the other hand, the ability to induce antiviral activity was not observed in the control cell culture medium in which 10 μg of pCDL-SRα296 was introduced into COS-1 cells in the same manner as in (2) above.
[0026]
In addition, using the canine mammary tumor tissue-derived cell line FCBR1 expressing class II MHC, the class II MHC expression enhancing activity of the above canine spleen lymphocyte culture supernatant was measured. 10 in a 6cm dish ⁵ 5 ml of 5% CO2 was added to 5 ml of the supernatant of cultured spleen lymphocytes of dog spleen lymphocytes stimulated with CaIL12. ₂ And cultured overnight at 37 ° C. After culturing, the cells were detached with trypsin and centrifuged in a 1.5 ml microcentrifuge tube. To this was added 10 μl of rat anti-canine MHC class II monoclonal antibody (Stratagene), suspended in 50 μl of 10% FBS-ERDF, and allowed to stand on ice for 1 hour. After washing with PBS, the suspension was suspended in 5 μl of FITC-labeled rabbit anti-rat monoclonal antibody (Stratagene) and 50 μl of 10% FBS-ERDF, and left on ice for 1 hour. After washing with PBS, analysis was performed with FACScan from Becton Dickinson. As a result, the culture supernatant of canine spleen lymphocytes stimulated with CaIL12 increased the expression level of class II MHC on FCBR1 by about 20%. From these results, it was found that CaIL12 has an activity of inducing canine inter-feron γ by acting on canine lymphocytes.
[0027]
In addition, the proliferation promoting activity of blasted canine lymphocytes was measured. Lymphocytes are isolated from canine peripheral blood and 10% with 10% FBS-ERDF. ⁶ It was suspended at a cell density of cells / ml, and 5 ml of this was added to a 6 cm dish. PHA (manufactured by ICN) was added to this at a concentration of 5 μg / ml, and 5% CO 2 was added. ₂ The cells were cultured at 37 ° C. for 3 days to allow lymphocytes to blast. The blasted lymphocytes were 10% with 10% FBS-ERDF. ⁶ The cells were suspended at a cell density of cells / ml, and 50 μl was added per well of a 96-well microplate. To this, 50 μl of the culture supernatant obtained in (2) above was added per well. As a control, 50 μl of 10% FBS-ERDF was added per well. These are further 5% CO ₂ After culturing at 37 ° C. for 3 days, CaIL12's blastogenic lymphocyte proliferation promoting activity was measured by the MTT assay method of Reference 11. That is, 10 μl of a 5 mg / ml MTT (Sigma) solution was added per well and further cultured for 6 hours. After adding 150 μl of 0.04N isopropanolic hydrochloric acid solution, the cells were disrupted with ultrasonic waves, and the absorbance at a wavelength of 595 nm was measured with a microplate reader (Model 3550 manufactured by BIO-RAD). As a result, the absorbance of the control was 0.69 on average, whereas CaIL12 was 1.52 on average, and about twice as much blastogenic lymphocyte proliferation promoting activity was observed.
[0028]
Furthermore, the antitumor effect of CaIL12 on canine tumors was examined. Lymphocytes are isolated from canine peripheral blood and 5 × 10% with 10% FBS-ERDF ⁶ It was suspended at a cell density of cells / ml, and 5 ml of this was added to a 6 cm dish. This is Berin
Add 500 U of recombinant human IL2 from Garmanheim Co., Ltd. and add 5% CO ₂ The cells were cultured at 37 ° C. for 3 days. Meanwhile, the canine tumor cell lines FCBR1 and A72 (ATCC CRL-1542) were each 10% FBS-ERDF 10 ⁵ The cells were suspended at a cell density of cells / ml, and 50 μl per well of 96-well plate was added to adhere to the plate. To this was added 50 μl of canine lymphocytes stimulated with human IL2, and then 100 μl of the culture supernatant obtained in (2) above expressing CaIL12 or 100 μl of 10% FBS-ERDF as a control was added. ₂ The cells were cultured at 37 ° C. for 2 days. After incubation, the supernatant was completely removed and MTT assay was performed. % Cytotoxicity was calculated by the following formula.
[0029]
% Cytotoxicity = (1-OD ₂ / OD ₁ ) × 100
Where OD ₁ = Absorbance at wavelength 595 nm of canine tumor cells cultured only in medium
OD ₂ = Represents absorbance at a wavelength of 595 nm of canine tumor cells cultured with canine lymphocytes.
[0030]
As a result, FCBR1 showed 34% control, whereas CaIL12 showed 75% cytotoxicity. In addition, the control of A72 was 22%, whereas CaIL12 showed 83% cytotoxicity. From these results, it was found that CaIL12 activates canine lymphocytes and exerts an antitumor effect on canine tumor cells.
[0031]
References
1. Wolf et al. Immunol. 146, 3074-3081 (1991).
2. Schoenhaut et al. Immunol. 148, 3433-3440 (1992).
3. Chirgwin et al .: Biochemistry 18, 5294-5304 (1979).
4). Berger et al .: Biochemistry 18, 5143-5149 (1979).
5. Gubler et al .: Gene 25, 236-269 (1983).
6). Okayama et al .: Mol. Cell. Biol. 2, 161-170 (1982) & 3,280-289 (1983).
7). Molecular Cloning. Cold Spring Harbor Laboratory. New York. 1982.
8). Probe et al .: Science 238, 336-341 (1987).
9. Takebe et al .: Mol. Cell. Biol. 8, 466-472 (1988).
10. F. L. Grabam et al .: Virology 54, 536-539 (1973).
11. Mosmann et al. Immunol. Methods 65, 55-63 (1983)
[0032]
[Sequence Listing]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]
SEQ ID NO: 12 Sequence length: 669 Sequence type: Number of nucleic acid strands: Double-stranded topology: Type of linear sequence: cDNA to mRNA Origin organism name: Symbol representing the characteristic features of the canine sequence: Peptide location : 1. . 666 Method of characterizing: S sequence ATG TGC CCG CCG CGC GGC CTC CTC CTT GTG ACC ATC CTG GTC CTG CTA 48 Met Cys Pro Pro ArG Gly Leu Leu Leu Leu AGC CTC CCC ACA GCC TCA 96Ser His Leu Asp His Leu Thr Trp Ala Arg Ser Leu Pro Thr Ala SerCCA AGC CCA GGA ATA TTC CAG TGC CTC AAC CAC TCC CAA AAC CTG CTG 144Pro Ser Pro Gly Ile Phe Gln Cys Leu Asn His Ser Gln A sn Leu LeuAGA GCC GTC AGC AAC ACG CTT CAG AAG GCC AGA CAA ACT CTA GAA TTA 192Arg Ala Val Ser Asn Thr Leu Gln Lys Ala Arg Gln Thr Leu Glu LeuTAT TCC TGC ACT TCC GAA GAG ATT GAT CAT GAA GAT ATC ACA AAG GAT 240Tyr Ser Cys Thr Ser Glu Glu Ile Asp His Glu Asp Ile Thr Lys Asp

[0044]

[0045]

[0046]

[0047]

Claims (12)

The a dog leukocyte activates have the ability of damaging canine tumor cells, and SEQ ID NO: 1 or SEQ ID NO: P40 subunit and SEQ ID NO: having the amino acid sequence shown in 11: 2 or SEQ ID NO: 12 Canine interleukin 12 consisting of a P35 subunit having an amino acid sequence. DNA sequence shown in SEQ ID NO: 1 obtained by P40 subunit using the DNA sequence shown in SEQ ID NO: 3 and the DNA sequence shown in SEQ ID NO: 4 as a primer and performing a polymerase chain reaction using canine cDNA as a template SEQ ID NO: 11 obtained by hybridizing a probe labeled with a DNA fragment comprising the amino acid sequence encoded by SEQ ID NO: 1 or SEQ ID NO: 1 with a filter obtained by forming a phage library prepared from canine cDNA as a plaque and transferring it. The canine interleukin 12 according to claim 1, which has an amino acid sequence encoded by the DNA sequence shown in FIG. DNA sequence shown in SEQ ID NO: 2 obtained by P35 subunit using the DNA sequence shown in SEQ ID NO: 5 and the DNA sequence shown in SEQ ID NO: 6 as a primer and performing a polymerase chain reaction using canine cDNA as a template SEQ ID NO: 12 obtained by hybridizing a probe labeled with a DNA fragment comprising the amino acid sequence encoded by SEQ ID NO: 2 or SEQ ID NO: 2 to a filter obtained by forming a phage library prepared from canine cDNA as plaques and transcribed. The canine interleukin 12 according to claim 1, which has an amino acid sequence encoded by the DNA sequence shown in FIG. The DNA sequence shown in SEQ ID NO: 1 or SEQ ID NO: 11 encoding the P40 subunit according to claim 1 or 2. The DNA sequence shown in SEQ ID NO: 2 or SEQ ID NO: 12 encoding the P35 subunit according to claim 1 or 3 A recombinant vector comprising the DNA sequence shown in SEQ ID NO: 1 or SEQ ID NO: 11. A recombinant vector comprising the DNA sequence shown in SEQ ID NO: 2 or SEQ ID NO: 12. A recombinant vector comprising the DNA sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 simultaneously. A recombinant vector comprising the DNA sequence shown in SEQ ID NO: 11 and the DNA sequence shown in SEQ ID NO: 12 simultaneously. A transformant obtained by transforming a host cell with the recombinant vector according to any one of claims 6 to 9. A transformant obtained by transforming a host cell with the recombinant vector according to claim 6 and the recombinant vector according to claim 7. A method for producing canine interleukin 12, which comprises culturing or raising the transformant according to claim 10 or 11 and collecting canine interleukin 12.