JP2003284585A - Method for producing interleukin 12 - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To establish a method for producing interleukin 12 in a large amount and in a good efficiency. <P>SOLUTION: This method for producing the interleukin 12 by infecting insect cells with a gene recombinant virus encoding the interleukin 12 is provided by culturing the insect cells with agitation for making it possible to perform a large scale culture and to produce the interleukin 12 in a large amount. Also, in culturing the insect cells, it is preferable to add a surfactant, and that is especially effective in producing the interleukin 12. <P>COPYRIGHT: (C)2004,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to interleukin 1
The present invention relates to a method for producing interleukin 12 for the purpose of producing 2 as a drug by mass-producing 2 by genetic engineering technology.

[0002]

2. Description of the Related Art With the progress of gene manipulation technology, useful proteins such as cytokines existing in the living body, which are promising for the treatment of various diseases, have been discovered one after another, and researches for developing applications as pharmaceuticals have been actively conducted. Among them, interleukin 12 is a cytokine composed of two proteins, P40 and P35 (Reference 1), and can be produced by a method of infecting insect cells with a genetically modified virus. Insect cells are generally subjected to flat culture using a monolayer flask or the like. (Reference 2)

[0003]

Interleukin 12
In the case of producing the drug as a drug, it is necessary to culture a large amount of insect cells in order to efficiently produce the interleukin 12 in a large amount. However, large-scale culture was difficult in flat culture. If a method for culturing a large amount of insect cells can be found, a method for mass-producing interleukin 12 will be established, and development of interleukin 12 as a drug will be opened.

[0004]

DISCLOSURE OF THE INVENTION The present inventors aimed to establish a method for mass-cultivating insect cells, and made it possible to carry out mass-culturing by stirring culture when culturing insect cells.

That is, the present invention "manufactures interleukin 12 characterized by culturing an insect cell by stirring when the insect cell is infected with a gene recombinant virus encoding interleukin 12 to produce interleukin 12. Law. "

[0006]

BEST MODE FOR CARRYING OUT THE INVENTION Examples of the interleukin 12 obtained by the production method of the present invention include human interleukin 12 and mammalian interleukin 12, and the present invention is particularly preferably applied to the production of dog interleukin 12.

[0007] A plasmid incorporating DNAs encoding the two subunits of canine interleukin 12 can be produced, for example, as follows. That is, after extracting poly (A) RNA from canine cells, synthesizing cDNA and performing a polymerase chain reaction (hereinafter abbreviated as PCR) using a primer based on a gene sequence encoding each subunit. It is possible to obtain a gene encoding each of the two subunits of canine interleukin 12. As a method for obtaining RNA from dog cells, for example, dog lymphocytes stimulated with mitogen or the like, a conventional method,
For example, polysome separation, a method using sucrose density gradient centrifugation, or electrophoresis can be used. As a method for extracting RNA from the above dog cells, guanidine / thiocyanate-treated CsCl density gradient centrifugation is performed.
Thiocyanate-cesium chloride method (Reference 3) A method of treating with vanadium complex in the presence of a ribonuclease inhibitor with a surfactant and then performing phenol extraction (Reference 4), guanidine thiocyanate-hot phenol method, guanidine thiocyanate- An appropriate method can be selected from guanidine hydrochloride method, guanidine thiocyanate-phenol chloroform method, a method of treating with guanidine thiocyanate and then treating with lithium chloride to precipitate RNA.

[0008] From dog lymphocytes and the like, mRNA is isolated by a conventional method such as lithium chloride / urea method, guanidine isothiocyanate method, oligo dT cellulose method and the like, and the obtained mRNA is isolated by a conventional method such as Gu.
Bler et al. (5), H. CDNA is synthesized by the method of Okayama et al. (Reference 6). In order to synthesize cDNA from the obtained mRNA, basically, reverse transcriptase such as avian osteoblast virus (AMV) and the like may be used, and a method using a DNA polymerase or the like with a part of primer may be combined. It is convenient to use a commercially available synthetic or cloning kit. By using this cDNA as a template and performing PCR using a primer based on the nucleotide sequence of a gene encoding each of the two subunits of canine interleukin 12, DNA encoding each of the two subunits of canine interleukin 12 can be obtained. Obtainable.

Insect cells such as Spodoptera frugiperda, Cabbage looper cells (Trichoplusiani) are used as hosts.
Etc. can be used.

A virus (baculo (insect)) or the like can be used as the expression vector. Examples of insect promoters in the expression vector include baculovirus polyhedrin promoter and p10 promoter. Transformation of a host with an expression vector can be performed by a conventional method well known in the art, and these methods include, for example, Current Protocols in Molecular Biology (Current).
Protocols in Molecular Bi
Johnny Willy and Sons (J)
ohn W-iley & Sons). Cultivation of the transformant can also be performed according to a conventional method.

The dog interleukin 12 produced has an apparent molecular weight of approximately 70-80 kD as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under non-reducing conditions.

In SDS-PAGE, the band of 70-80 kD has a molecular weight of about 40 kD and about 35 kD under reducing conditions.
Results in two subunits of

Canine interleukin 12 is mainly characterized by its ability to induce interferon γ from canine leukocytes in vitro as shown in Reference Example 4 below.

In the present invention, it is important to carry out stirring culture of insect cells. By stirring and culturing the insect cells, a larger amount of interleukin 12 can be efficiently produced.

The culture vessel used in the method for culturing insect cells of the present invention includes a jar fermenter, an Erlenmeyer flask and the like, but a spinner flask is preferably used. A medium for culturing insect cells is added to a spinner flask at a maximum volume of 1/2, a surfactant is added, and insect cells are suspended at 1 to 10 × 10 ⁵ cells / mL, and the temperature is 25 ° C to 30 ° C. Culturing at 100 to 300 rpm for 4 to 7 days until confluent. The stirring method includes a method using a shake incubator and a method using a magnetic stirrer, but stirring is preferably performed using a stirring blade. In the culture method of the present invention, it is important to add a surfactant when stirring and culturing insect cells. By adding a surfactant to the culture solution, cell aggregation and the like are suppressed, and insect cells can be stirred and cultured. Examples of the surfactant include anionic, cationic, zwitterionic and nonionic surfactants, preferably nonionic surfactants such as PLURONIC.
F68 (manufactured by GIBCO) and the like are preferably used.
The amount of the surfactant added is 10 to 2 per 1 L of the culture solution.
It is preferable to add 0 mL.

Insect cells that had been cultivated with stirring to be confluent were infected with recombinant baculovirus, and
By culturing for 7 days, a culture solution containing the produced interleukin 12 can be obtained.

The amount of medium, the amount of surfactant added, the amount of virus solution added, etc. in culturing insect cells and infecting recombinant baculovirus are not particularly limited, and the optimum conditions are those of the culture vessel. It is appropriately determined according to the volume, cell concentration and the like.

[0018]

EXAMPLES The present invention will be described in more detail below with reference to examples. However, the present invention is not limited to the following examples.

[Reference Example 1] Canine interleukin 12
Acquisition of P40 and P35 genes (1) Preparation of canine cDNA Treated with dog liver, canine peripheral blood mononuclear cells stimulated with LPS (50 μg / mL) for 48 hours and chicken Newcastle disease virus for 7 hours (10 ⁷ pfu / mL) ) ISOGEN (Nippon Gene) from dog spleen-derived lymphocytes
Was used to prepare total RNA. Obtained RNA is 1 mM
10 mM Tris-HCl buffer containing EDTA (pH
7.5) (hereinafter abbreviated as TE) and treated at 70 ° C. for 5 minutes, and then the RNA solution is applied to an oligo dT cellulose column equilibrated with TE containing 1 M LiCl and washed with the same buffer solution. did. Further 0.3M LiCl
After washing with TE containing 0.01 mM SDS containing 1 mM
The poly (A) RNA adsorbed with EDTA (pH 7.0) was eluted. Single-stranded cDNA was synthesized using the poly (A) RNA thus obtained. Ie 0.5m sterilized
L microcentrifuge tube with 5 μg of poly (A) RNA and 0.5 μg of oligo dT primer (12-18me).
r) was added, diethylpyrocarbonate-treated sterilized water was added to make 12 μL, and the mixture was incubated at 70 ° C. for 10 minutes and then placed on ice for 1 minute. 200 mM MgC
12 2 μL, 10 mM dNTP 1 μL and 0.
After adding 2 μL each of 1M DTT and incubating at 42 ° C. for 5 minutes, 200 units of GibcoBR were added.
1 μL of Super Script II RT manufactured by L Co. was added, and the mixture was incubated at 42 ° C. for 50 minutes to obtain cDN.
A synthesis reaction was performed. The reaction was stopped by further incubating at 70 ° C for 15 minutes, and the plate was placed on ice for 5 minutes. 1 μL of E. coli RNaseH (2uni
(ts / mL) was added and incubated at 37 ° C. for 20 minutes.

(2) Acquisition of canine interleukin 12P40 gene Based on the N-terminal and C-terminal nucleotide sequences of canine interleukin 12P40 (Reference 7), 5'ATGCATCCCTCAGCAGTTGGTCAT was prepared.
CTCCTGGG 3 '(SEQ ID NO: 1) and 5'CTAACTGCAGGACACAGATGCCC
Two kinds of primers of AGTCCGCT3 '(SEQ ID NO: 2) were synthesized with a DNA synthesizer. 2 μL of the cDNA obtained from the dog liver of the above (1) was added to a 0.5 mL microcentrifuge tube, and each primer was 20 pmol, 20 mM Tris-HCl buffer (pH 8.0), 1.5 mM MgCl 2, 25 mM.
KCL, 100 μg / mL gelatin, 50 μM each dNT
P, 4 units Each reagent was added so as to become Taq DNA polymerase, and the total amount was 100 μL. The denaturing condition of DNA is 94 ° C for 1 minute, and the annealing condition of primer is 55
DNA from Perkin-Elmer Cetus under the conditions of 2 ° C., 2 min.
Using a thermal cycler, 35 cycles of reaction were performed.
This was electrophoresed on a 1% agarose gel to give about 990b
A DNA fragment of p was prepared according to a conventional method (Reference 8).

This DNA fragment was added to T-Vector of Invitrogen and DNA Liga of Takara Shuzo Co., Ltd.
section Kit Ver. 1 was used for ligation. Escherichia coli was transformed with this using a conventional method, and a plasmid DNA was prepared from the obtained transformant by a conventional method. Next, after confirming that the PCR fragment was inserted in this plasmid by PCR under the same conditions as described above, it was obtained using a fluorescent DNA sequencer and a dye terminator cycle sequencing kit of Perkin Elmer Co. according to the attached protocol. It was confirmed that the DNA fragment was a sequence encoding canine interleukin 12P40. (SEQ ID NO: 3)

(3) Cloning of canine interleukin 12P35 gene N-terminal and C of canine interleukin 12P35 gene
Based on the terminal base sequence (Reference 6), 5'ATGTGCCCGCCGCGCGCGCCTCCT
CCTTGT 3 ′ (SEQ ID NO: 4) and 5 ′ TTAGGAAGAATTCAGATAACTCA
Two types of TCATTTCT3 '(SEQ ID NO: 5) primers were synthesized with a DNA synthesizer. CDNA obtained from dog spleen-derived lymphocytes treated with the chicken Newcastle disease virus of (1) above
As a template in the same manner as in (2) above, with a D of about 670 bp.
An NA fragment was obtained, inserted into T-Vector, and confirmed to be a sequence encoding canine interleukin 12P35. (SEQ ID NO: 6)

[Reference Example 2] Canine interleukin 12
Production of Recombinant Baculovirus Production P40 and P35 subunit cDNAs were ligated to the restriction enzyme XBaI and SmaI cleavage sites downstream of the promoter of the baculovirus transfer vector pAcAB3 (Pharmingen) in accordance with a conventional method to obtain a recombinant transfer vector. . Further, a recombinant baculovirus was prepared using a baculovirus transfection kit manufactured by Pharmingen Co. according to the attached manual.

[Example 1] Canine interleukin 12
Production by stirring culture of TNM-FHInsect manufactured by Pharmingen in a spinner flask having a capacity of 1000 mL.
o Medium 500mL was added, and 5mL of PLURONIC F68 manufactured by GIBCO was added to Sf.
21 cells (Spondoptera Flugiperd
a), obtained from PharMingen) 5 x 10 ⁵ c
The cells were suspended at a concentration of ells / mL and cultured at 28 ° C. for 5 to 6 days with stirring at 180 rpm to make them confluent. Remove the culture solution from the spinner flask and set it to 0.9K.
Centrifuge for 5 minutes, discard the supernatant, and remove Protein-Free Insecto M from Pharmingen.
EDIUM 500mL and PLURONIC F685
Sf21 cells were resuspended in a spinner flask containing mL, infected with the recombinant baculovirus obtained in Reference Example 2, and stirred at 180 rpm for 4-5 at 28 ° C.
After culturing for a day, 500 mL of a culture supernatant in which canine interleukin 12 was produced was obtained.

[Comparative Example 1] Canine interleukin 12
Production in flat culture of TNM-FHI in a 150 cm ² monolayer flask
Add 20 mL of nsecto Medium, add Sf21
Suspend the cells at a concentration of 5 × 10 ⁵ cells / mL and
The plate was cultured at 4 ° C. for 4 to 5 days to be confluent. Remove the medium from the monolayer flask and discard.
otain-Free Insecto Medium2
After adding 0 mL and infecting the recombinant baculovirus obtained in Reference Example 2 and culturing at 28 ° C. for 4 to 5 days, 20 mL of a culture supernatant in which canine interleukin 12 was produced was obtained.

[Reference Example 3] Canine interleukin 12
Detection of canine interleukin 12 in the culture supernatant of the insect cells obtained in Example 1 and Comparative Example 1 was detected by Western blotting. The culture solution was subjected to SDS-PAGE in a pagel manufactured by Atto Co., Ltd. After blotting according to a conventional method on a clear blot membrane manufactured by Atto Co., Ltd., the membrane was immersed in a block ace (manufactured by Dainippon Pharmaceutical Co., Ltd.) solution containing rabbit serum containing anti-dog P40 polyclonal antibody and P35 polyclonal antibody for 6 hours. After reacting and washing with PBS containing 0.02% Tween 20 three times, and further reacting with a block ace solution containing peroxidase-labeled goat anti-rabbit IgG (manufactured by Bio-Rad Co., Ltd.) for 6 hours, and similarly washing,
Color was developed with Konica Immunostain HPR1000 manufactured by Konica. As a result, about 40 kD, about 75 kD and about 8 kD were obtained from the culture supernatants obtained in Example 1 and Comparative Example 1.
Three bands of 0 kD were detected. About 75k of this
The D band is canine interleukin 12, which is a heterodimer of canine P40 and P35, the approximately 40 kD band is the canine P40 monomer, and the approximately 85 kD band is the canine P40 homodimer.

[Reference Example 4] Canine interleukin 12
Activity measurement of the dog interleukin 12 produced in Example 1 and Comparative Example 1 was measured as follows. Antiviral activity was measured for the determination of canine interferon-γ inducing activity from canine lymphocytes. Lymphocytes were isolated from dog spleen and 10 ⁶ cells were added to 10% FBS-ERDF.
Suspended at a cell density of / mL, of which 2.5 mL and human interleukin 12 (Genzyme) 250U
Was added to a 6 cm dish. To this, 2.5 mL of the culture supernatant obtained in Example 1 and Comparative Example 1 and 250 U of human interleukin 2 (Genzyme) were added, and 5% was added.
After culturing for 2 days under the condition of carbon dioxide gas and 37 ° C, the virus was used as Vesicular Stomatitis Vir
us, MDCK (ATCCCCL-3 as sensitive cells
4) was used to measure the antiviral activity of these cultures according to the CPE method of Reference 9. As a result, the culture supernatants obtained in Example 1 and Comparative Example 1 were 10 ⁷ dilution units /
The antiviral activity of not less than mL was measured.

That is, equivalent dog interleukin 1
20 mL of the culture supernatant having an activity amount of 2 was obtained in the flat culture of Comparative Example 1, while 500 mL was obtained in the stirring culture of Example 1.

[0029]

According to the method of the present invention, the interleukin 12 can be efficiently produced in a large amount.

References: 1. Wolf et al .: J. Immunol. 146,307
4-3081 (1991) 2. Isao Ishida et al .: Gene Expression Experiment Manual, (199
4). P236-237 3. Chirgwin et al .: Biochemistry,
18, 5294 (1979) 4. Berger et al .: Biochemistry, 1
8, 5143 (1979) 5. Gubler et al .: Gene. 25,236-269
(1983) 6. Okaya et al .: Mol. Cell. Bio
l. , 2, 161, (1982) 7. Okano et al .: J. Interferon & Cyt
kine Res. , 17, 713-718 (199
7) 8. Molecular Cloning. Cold
Spring Harbor Laboratory.
New York. 1982. 9. The Chemical Society of Japan, Vol. 5 (19)
86). P250-256, Tokyo Kagaku Dojin

[0031]

[Sequence list] <110> Toray Industries, Inc. <120> Method for producing useful protein <130> 51E16570 <160> 6 <210> 1 <211> 33 <212> DNA <213> Artificial Sequence <400> atgtgtcacc agcagttggt catctcttgg ttt 33 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <400> ctaactgcag ggcacagatg ccca 24 <210> 3 <211> 990 <212> DNA PRT <213> dog <220>   <221> CDS   <222> (1) ... (987) <220>   <221> mat # peptide   <222> (67) ... (987) <400> atg tgt cac cag cag ttg gtc atc tct tgg ttt tcc ctc gtt ttg ctg 48 Met Cys His Gln Gln Leu Val Ile Ser Trp Phe Ser Leu Val Leu Leu gcg tct ccc ctc atg gcc ata tgg gaa ctg gag aaa gat gtt tat gtt 96 Ala Ser Pro Leu Met Ala Ile Trp Glu Leu Glu Lys Asp Val Tyr Val gta gag ttg gac tgg cac cct gat gcc ccc gga gaa atg gtg gtc ctc 144 Val Glu Leu Asp Trp His Pro Asp Ala Pro Gly Glu Met Val Val Leu acc tgc cat acc cct gaa gaa gat gac atc act tgg acc tca gcg cag 192 Thr Cys His Thr Pro Glu Glu Asp Asp Ile Thr Trp Thr Ser Ala Gln agc agt gaa gtc cta ggt tct ggt aaa act ctg acc atc caa gtc aaa 240 Ser Ser Glu Val Leu Gly Ser Gly Lys Thr Leu Thr Ile Gln Val Lys gaa ttt gga gat gct ggc cag tat acc tgc cat aaa gga ggc aag gtt 288 Glu Phe Gly Asp Ala Gly Gln Tyr Thr Cys His Lys Gly Gly Lys Val ctg agc cgc tca ctc ctg ttg att cac aaa aaa gaa gat gga att tgg 336 Leu Ser Arg Ser Leu Leu Leu Ile His Lys Lys Glu Asp Gly Ile Trp tcc act gat atc tta aag gaa cag aaa gaa tcc aaa aat aag atc ttt 384 Ser Thr Asp Ile Leu Lys Glu Gln Lys Glu Ser Lys Asn Lys Ile Phe ctg aaa tgt gag gca aag aat tat tct gga cgt ttc aca tgc tgg tgg 432 Leu Lys Cys Glu Ala Lys Asn Tyr Ser Gly Arg Phe Thr Cys Trp Trp ctg acg gca atc agt act gat ttg aaa ttc agt gtc aaa agt agc aga 480 Leu Thr Ala Ile Ser Thr Asp Leu Lys Phe Ser Val Lys Ser Ser Arg ggc ttc tct gac ccc caa ggg gtg aca tgt gga gca gtg aca ctt tca 528 Gly Phe Ser Asp Pro Gln Gly Val Thr Cys Gly Ala Val Thr Leu Ser gca gag agg gtc aga gtg gac aac agg gat tat aag aag tac aca gtg 576 Ala Glu Arg Val Arg Val Asp Asn Arg Asp Tyr Lys Lys Tyr Thr Val gag tgt cag gag ggc agt gcc tgc ccc tct gcc gag gag agc cta ccc 624 Glu Cys Gln Glu Gly Ser Ala Cys Pro Ser Ala Glu Glu Ser Leu Pro atc gag gtc gtg gtg gat gct att cac aag ctc aag tat gaa aac tac 672 Ile Glu Val Val Val Asp Ala Ile His Lys Leu Lys Tyr Glu Asn Tyr acc agc agc ttc ttc atc aga gac atc atc aaa cca gac cca ccc aca 720 Thr Ser Ser Phe Phe Ile Arg Asp Ile Ile Lys Pro Asp Pro Pro Thr aac ctg cag ctg aag cca ttg gaa aat tct cgg cac gtg gag gtc agc 768 Asn Leu Gln Leu Lys Pro Leu Glu Asn Ser Arg His Val Glu Val Ser tgg gaa tac ccc gac acc tgg agc acc cca cat tcc tac ttc tcc ctg 816 Trp Glu Tyr Pro Asp Thr Trp Ser Thr Pro His Ser Tyr Phe Ser Leu aca ttt tgc ata cag gcc cag ggc aag aac aat aga gaa aag aaa gat 864 Thr Phe Cys Ile Gln Ala Gln Gly Lys Asn Asn Arg Glu Lys Lys Asp aga ctc tgc gtg gac aag acc tca gcc aag gtc gtg tgc cac aag gat 912 Arg Leu Cys Val Asp Lys Thr Ser Ala Lys Val Val Cys His Lys Asp gcc aag atc cgc gtg caa gcc cga gac cgc tac tat agt tca tcc tgg 960 Ala Lys Ile Arg Val Gln Ala Arg Asp Arg Tyr Tyr Ser Ser Ser Trp agc gac tgg gca tct gtg ccc tgc agt tag 990 Ser Asp Trp Ala Ser Val Pro Cys Ser *** <210> 4 <211> 42 <212> DNA <213> Artificial Sequence <400> agcatgtgtc cagcgcgcag cctcctcctt gtcgctaccc tg 42 <210> 5 <211> 39 <212> DNA <213> Artificial Sequence <400> ctaggaagaa ctcagatagc tcatcattct gtcgatggt 39 <210> 6 <211> 669 <212> DNA PRT <213> dog <220>   <221> CDS   <222> (1) ... (666) <220>   <221> peptide   <222> (1) ... (666) <220>   <221> mat # peptide   <222> (76) ... (666) <400> atg tgt cca gcg cgc agc ctc ctc ctt gtc gct acc ctg gtc ctg cta 48 Met Cys Pro Ala Arg Ser Leu Leu Leu Val Ala Thr Leu Val Leu Leu agc cac ctg gac cac ctt act tgg gcc agg agc ctc ccc aca gcc tca 96 Ser His Leu Asp His Leu Thr Trp Ala Arg Ser Leu Pro Thr Ala Ser cca agc cca gga ata ttc cag tgc ctc aac cac tcc caa aac ctg ctg 144 Pro Ser Pro Gly Ile Phe Gln Cys Leu Asn His Ser Gln Asn Leu Leu aga gcc gtc agc aac acg ctt cag aag gcc aga caa act cta gaa tta 192 Arg Ala Val Ser Asn Thr Leu Gln Lys Ala Arg Gln Thr Leu Glu Leu tat tcc tgc act tcc gaa gag att gat cat gaa gat atc aca aag gat 240 Tyr Ser Cys Thr Ser Glu Glu Ile Asp His Glu Asp Ile Thr Lys Asp aaa acc agc aca gtg gag gcc tgc tta cca ctg gaa tta acc atg aat 288 Lys Thr Ser Thr Val Glu Ala Cys Leu Pro Leu Glu Leu Thr Met Asn gag agt tgc ctg gct tcc aga gag atc tct ttg ata act aac ggg agt 336 Glu Ser Cys Leu Ala Ser Arg Glu Ile Ser Leu Ile Thr Asn Gly Ser tgc ctg gcc tct gga aag gcc tct ttt atg acg gtc ctg tgc ctt agc 384 Cys Leu Ala Ser Gly Lys Ala Ser Phe Met Thr Val Leu Cys Leu Ser agc atc tat gag gac ttg aag atg tac cag atg gaa ttc aag gcc atg 432 Ser Ile Tyr Glu Asp Leu Lys Met Tyr Gln Met Glu Phe Lys Ala Met aac gca aag ctt tta atg gat ccc aag agg cag atc ttt ctg gat caa 480 Asn Ala Lys Leu Leu Met Asp Pro Lys Arg Gln Ile Phe Leu Asp Gln aac atg ctg acg gct atc gat gag ctg tta cag gcc ctg aat ttc aac 528 Asn Met Leu Thr Ala Ile Asp Glu Leu Leu Gln Ala Leu Asn Phe Asn agt gtg act gtg cca cag aaa tcc tcc ctt gaa gag ccg gat ttt tat 576 Ser Val Thr Val Pro Gln Lys Ser Ser Leu Glu Glu Pro Asp Phe Tyr aaa act aaa atc aag ctc tgc ata ctt ctt cat gct ttc aga att cgt 624 Lys Thr Lys Ile Lys Leu Cys Ile Leu Leu His Ala Phe Arg Ile Arg gcg gtg acc atc gac aga atg atg agc tat ctg agt tct tcc tag 669 Ala Val Thr Ile Asp Arg Met Met Ser Tyr Leu Ser Ser Ser ***

   ─────────────────────────────────────────────────── ─── Continued front page    F-term (reference) 4B064 AG03 CA10 CA19 CC12 CC24                       DA04

Claims (3)

[Claims] 1. A method for producing interleukin 12, which comprises stirring and culturing insect cells when producing interleukin 12 by infecting insect cells with a recombinant virus encoding interleukin 12. 2. The method for producing interleukin 12 according to claim 1, wherein a surfactant is added when culturing the insect cells. 3. The method for producing interleukin 12 according to claim 1 or 2, wherein the interleukin 12 is dog interleukin 12.