JP2002275198A - Method for producing interleukin 12 in high purity - Google Patents

Abstract

PROBLEM TO BE SOLVED: To separate and fractionate interleukin 12 in high purity. SOLUTION: The interleukin 12 produced in various production systems and composed of a plurality of components is purified and separated in high purity by using a phenyl-Sepharose carrier.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for producing interleukin 12 with high purity, which is intended to be mass-produced by an interleukin 12 gene manipulation technique and thereby to be a drug.

[0002]

2. Description of the Related Art With the advance of gene manipulation technology, useful proteins such as cytokines present in living organisms, which are promising for the treatment of various diseases, are being discovered one after another, and research on development of uses as pharmaceuticals is being actively conducted. Among them, interleukin 12 is a cytokine composed of two proteins, P40 and P35.
In addition to the heterodimer of 40 and P35, impurities such as P40 homodimer were included, and purification was difficult. Pharmaceuticals need to contain an active ingredient with high purity, and when using interleukin 12 as a pharmaceutical, purification capable of separating interleukin 12 with high purity from crude proteins containing interleukin 12 produced in various production systems. If a law can be found, interleukin 12 (hereinafter I)
The development of the drug as L12) is opened.

[0003]

Among useful proteins, there is a protein which comprises a plurality of different proteins and forms an active component. When such a protein is produced, it is produced as a multi-component containing, in addition to the target component having the activity, another component having no activity. For example, since IL12 is composed of two proteins, P40 and P35 (Reference 1), when produced by various production systems, P40 and P35 are almost always used.
In addition to the 35 heterodimers, P40 homodimer, P40
40 monomers and a combination of P35 monomers, etc.
Therefore, it is produced in multiple components.

[0004] When a useful protein composed of multiple components is used as a pharmaceutical as described above, each component is separately purified and separated.
It is necessary to conduct detailed analyzes such as toxicity tests and pharmacological tests for each component, and it is obligatory to always add a fixed amount of each component at the time of formulation. Also,
When a protein constituting an active component by combining a plurality of different proteins, for example, IL12 as a drug, if a P40 homodimer is present in a drug product, the activity of IL12 is inhibited, and the pharmacological effect of the protein is reduced. descend. From the above, when a useful protein composed of multiple components is used as a drug, it is necessary to completely separate each component. However, since useful proteins composed of multiple components are similar in properties of each component and thus have similar adsorption behavior to a column chromatography carrier, it is difficult to separate each component with the column chromatography carrier. Often difficult. Therefore, when a useful protein, particularly a useful protein composed of multiple components, is used as a drug, it is an important issue to separate and fractionate the target component by purification.

[0005] Therefore, if a method for easily separating and fractionating IL12 composed of multiple components with high purity can be established, it is expected that the development of pharmaceuticals will be opened.

[0006]

SUMMARY OF THE INVENTION In view of the above circumstances, the present inventor aims to purify and separate high-purity useful proteins produced in various production systems with high purity. By using a phenyl sepharose carrier, a method for easily separating and fractionating a recombinant IL12 composed of multiple components having similar properties of the components was established,
Thus, the present invention has been completed.

That is, the present invention relates to “interleukin 1
2. A method for producing interleukin 12 with high purity, comprising bringing a solution containing 2 into contact with a phenyl sepharose carrier and eluting an adsorbed substance on the carrier with an eluent. ".

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION Separation to high purity by the production method of the present invention
Interleukin 12 to be fractionated includes human IL1
2. Mammalian IL12 and the like.
The present invention can be preferably applied to high-purity production of No. 12.

[0009] Plasmids incorporating DNAs encoding the two subunits of canine IL12 can be produced, for example, as follows. That is, after extracting poly (A) RNA from dog cells, cDNA is synthesized, and a polymerase chain reaction (hereinafter abbreviated as PCR) using primers based on gene sequences encoding the respective subunits. By performing the above, canine IL1
Genes respectively encoding the two subunits can be obtained. As a method for obtaining RNA from dog cells, for example, dog lymphocytes stimulated with mitogen or the like, usual methods, for example, separation of polysomes,
Examples include a method using sucrose density gradient centrifugation and electrophoresis. As a method for extracting RNA from the above-mentioned dog cells, a guanidine-thiocyanate-cesium chloride method (Reference 2) in which CsCl density gradient centrifugation is performed after guanidine-thiocyanate treatment (reference 2) using a vanadium complex in the presence of ribonuclease-inhibitor Phenol extraction after treatment with a surfactant (Reference 3), guanidine thiocyanate hot phenol method, guanidine thiocyanate guanidine hydrochloride method, guanidine thiocyanate phenol -Chloroform method, guanidine
An appropriate method can be selected from a method of treating RNA with thiocyanate and then precipitating RNA by treating with lithium chloride.

[0010] The mR is determined by a conventional method such as canine lymphocyte, for example, lithium chloride / urea method, guanidine isothiocyanate method, oligo dT cellulose column method and the like.
NA is isolated, and a normal method is used from the obtained mRNA, for example, the method of Gubler et al. Okaya
cDNA is synthesized by the method of Ma et al.
In order to synthesize cDNA from the obtained mRNA, a method using a reverse transcriptase such as avian osteoblast virus (AMV) or the like and a method using a DNA polymerase or the like using a partial primer are basically used. However, it is convenient to use a commercially available synthesis or cloning kit. By using this cDNA as a template and performing PCR using primers based on the nucleotide sequences of the genes respectively encoding the two subunits of canine IL12, DNAs encoding the two subunits of canine IL12 can be obtained. it can.

Prokaryote or eukaryote can be used as a host. As prokaryotes, bacteria, particularly Escherichia coli, Bacillus bacteria, such as Bacillus subtilis, can be used. As eukaryotes, yeasts, for example, yeasts of the genus Saccharomyces, such as Saccharomyces cerevisiae, are used.
ces cerevisiae), eukaryotic microorganisms such as insect cells, eg, Spodoptera cells.
frugiperda), cabbage looper cells (T
ricchoplusiani, silkworm cells (Bomb)
yx mori), animal cells such as human cells, monkey cells, mouse cells and the like can be used. In the present invention, an organism itself, for example, an insect, for example, a silkworm, a cabbage looper, or the like can also be used.

As expression vectors, plasmids, phages, phagemids, viruses (baculo (insects), vaccinia (animal cells)) and the like can be used. The promoter in the expression vector is selected depending on the host bacterium. For example, a lac promoter, t
The rp promoter and the like are used, and as the yeast promoter, for example, the adh1 promoter, the pqk promoter and the like are used. Insect promoters include baculovirus polyhedrin promoter, p10
Simian Vi for animal cells such as promoters
rus40 early or late promoter, but is not limited thereto. Transformation of a host with an expression vector can be performed by conventional methods well known in the art, and these methods are described, for example, in Current Protocols in Molecular Biology (Current Protocolsin).
Molecular Biology, John Wiley & Sons
Sons). Culture of the transformant can also be performed according to a conventional method.

The produced canine IL12 has an apparent molecular weight of about 70 to 80 kD as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under non-reducing conditions.

In SDS-PAGE, a band of 70 to 80 kD shows a molecular weight of about 40 kD and about 35 kD under reducing conditions.
This gives rise to two subunits of D.

As shown in Reference Example 4 below, canine IL12 is mainly characterized in vitro by its ability to induce interferon gamma (hereinafter abbreviated as IFNγ) from canine leukocytes.

In the present invention, it is important to use a phenyl sepharose carrier. By using the phenyl sepharose carrier, a useful protein with higher purity can be obtained.

The phenyl sepharose carrier used for the separation / fractionation of IL12 in the present invention includes agarose, cellulose, sepharose, synthetic polymer gel, etc. via a hydrophilic spacer via a chemically stable ether bond. A phenyl group is introduced. Preferably, Phenyl Sepharose 6 Fast Flow (manufactured by Amersham-Pharmacia) or the like is used.

In the method of the present invention, a method is employed in which a solution containing IL12 is brought into contact with a phenyl sepharose carrier and the adsorbed substance on the carrier is eluted with an eluent.

The elution from the phenyl sepharose carrier is as follows:
By gradually lowering the salt concentration, the hydrophobic interaction with the phenyl group as a ligand is canceled, and separation and fractionation can be performed by the difference in hydrophobicity of the adsorbed protein. IL
When 12 is produced by various production systems, in addition to the heterodimer of P40 and P35, a plurality of protein components such as P40 homodimer, P40 monomer and P35 monomer, which are components of IL12, are mixed. These components have very similar properties as proteins, such as isoelectric point values. Therefore, the adsorption behavior on the column chromatography carrier is similar, and it is considered that it is not easy to separate each component. The phenyl sepharose carrier used in the present invention can separate and fractionate a plurality of proteins having very similar properties as proteins due to the difference in the concentration of the eluent.

In the purification operation using the phenyl sepharose carrier, the composition and amount of the eluent are not particularly limited, and the optimal separation conditions are determined by the amount of the contaminating protein, the amount of each useful protein component, and It is appropriately determined according to the column dimensions and the like.

[0021]

The present invention will now be described more specifically with reference to examples. However, the present invention is not limited to the following examples.

Reference Example 1 Acquisition of canine IL12P40 and P35 genes (1) Preparation of canine cDNA Canine liver, canine peripheral blood mononuclear cells stimulated with LPS (50 μg / ml) for 48 hours, and treated with chicken Newcastle disease virus for 7 hours (10 ⁷ pfu / ml) ISOGEN (Nippon Gene) from dog spleen-derived lymphocytes
Was used to prepare total RNA. 1 mM of the obtained RNA
10 mM Tris-HCl buffer containing EDTA (pH
7.5) (hereinafter abbreviated as TE).
After treatment for 1 minute, TE containing 1 M LiCl was added in the same amount. The RNA solution was applied to an oligo dT cellulose column equilibrated with TE containing 0.5 M LiCl, and washed with the same buffer. T containing 0.3M LiCl
After washing with E, 2 mM EDT containing 0.01% SDS
A (pH 7.0) adsorbed poly (A) RNA was eluted. Using the poly (A) RNA thus obtained, a single-stranded cDNA was synthesized. That is, 5 μg of poly (A) RNA and 0.5 μg were placed in a sterilized 0.5 ml microcentrifuge tube.
5 μg of oligo dT primer (12-18mer) was added, and diethylpyrocarbonate-treated sterilized water was added to add 1 μg.
It was made up to 2 μl, incubated at 70 ° C. for 10 minutes, and then placed on ice for 1 minute. 2 μl of 200 mM Tris-HCl (pH 8.4), 500 mM KCl solution
₂ μl of 5 mM MgCl ₂ and 1 μm of 10 mM dNTP
Add 2 μl each of μl and 0.1 M DTT, and add 4 μl
After incubation at 2 ° C for 5 minutes, 200 units of SuperScript II from GibcoBRL
1 μl of RT was added, and the mixture was further incubated at 42 ° C. for 50 minutes to perform a cDNA synthesis reaction. The reaction was stopped by further incubation at 70 ° C. for 15 minutes and placed on ice for 5 minutes. 1 μl of E. coli was added to the reaction solution. coli RNa
seH (2 units / ml) was added and incubated at 37 ° C. for 20 minutes.

(2) Acquisition of canine IL12P40 gene Based on the N-terminal and C-terminal nucleotide sequences of canine IL12P40 (Reference 6), 5 'ATGCATCCTCCAGC
AGTTGGTCATCTCCTGGG3 '(SEQ ID NO: 1) and 5' CTACACTGCAGGACACAGATG
Two kinds of primers of CCCAGTCGCT3 ′ (SEQ ID NO: 2) were synthesized by a DNA synthesizer. 2 μl of the cDNA obtained from the dog liver of the above (1) was added to a 0.5 ml microcentrifuge tube, and each primer was
0 pmol, 20 mM Tris-HCl buffer (pH 8.
0), 1.5 mM MgCl ₂ , 25 mM KCl, 1
Each reagent is added to give 00 μg / ml gelatin, 50 μM each dNTP, and 4 units Taq DNA polymerase to make a total volume of 100 μl. DNA denaturation conditions were 94
C., 1 minute, primer annealing conditions: 55.degree.
And primer extension conditions at 72 ° C. for 3 minutes.
Using a DNA thermal cycler from erkin-Elmer Cetus, the reaction was performed for 35 cycles. This was electrophoresed on a 1% agarose gel, and a 990 bp D
The NA fragment was prepared according to a conventional method (Reference 7).

The DNA fragment was transferred to T-Vector of Invitrogen and DNA Liga of Takara Shuzo Co., Ltd.
Tion Kit Ver. 1 and ligated. Using this, Escherichia coli was transformed according to a conventional method, and a plasmid DNA was prepared from the obtained transformant by a conventional method. Next, after confirming that the PCR fragment was inserted into this plasmid by PCR under the same conditions as described above, using a fluorescent DNA sequencer (DNA Sequencer 373S, manufactured by Perkin Elmer), and using a Perkin Elmer Dye Terminator according to the attached protocol. Using a cycle sequencing kit, the resulting DNA fragment
It was confirmed that the sequence encodes L12P40.

(3) Cloning of Canine IL12P35 Gene Based on the N-terminal and C-terminal nucleotide sequences of canine IL12P35 (Reference 6), 5'ATGTGCCCCGCCGC
GCGGCCTCCCTCCTTGT3 '(SEQ ID NO: 3)
And 5'TTAGGAAGAATTCAGATAACTC
Two primers, ATCATCTCT '(SEQ ID NO: 4), were synthesized using a DNA synthesizer. The above (1)
(2) using cDNA obtained from canine spleen-derived lymphocytes treated with chicken Newcastle disease virus
A DNA fragment of about 670 bp was obtained in the same manner as described above, and T-Ve
ctor and confirmed that it was a sequence encoding canine IL12P35.

Reference Example 2 Production of Canine IL12 (1) Preparation of Recombinant Baculovirus Producing Canine IL12 Baculovirus Transfer Vector pAcAB3
The P40 and P35 subunit cDNAs were ligated to restriction enzyme XbaI and SmaI cleavage sites downstream of the promoter (manufactured by Pharmingen) in accordance with a conventional method to obtain a recombinant transfer vector. Further, a recombinant baculovirus was prepared using a baculovirus transfection kit manufactured by Pharmingen in accordance with the attached manual.

(2) Production of Canine IL12 in Insect Cells The recombinant baculovirus obtained in the above (1) was purified from Pharmingen's BaculoGold Protein-
After infecting Sf21 cells (derived from Spondoptera Flugiperda, obtained from Pharmingen) that had been flat-cultured in a 75 cm ² flask with Free Insect Medium to confluence, and cultured for 4 days, a culture supernatant from which canine IL12 was produced was obtained. .

Reference Example 3 Detection of Canine IL12 Canine IL12 in the culture supernatant of the insect cells obtained in Reference Example 2 (2) was detected by Western blotting. The culture supernatant was subjected to SDS-
It was subjected to PAGE. Thereafter, blotting was performed on a clear blot membrane manufactured by Atto Co., Ltd. according to a conventional method, and the membrane was subjected to a Block Ace (Dainippon Pharmaceutical Co., Ltd.) solution containing rabbit serum containing an anti-dog P40 polyclonal antibody and an anti-dog P35 polyclonal antibody. For 6 hours, and then in PBS containing 0.02% Tween 20 for 3 hours.
Washed twice and further peroxidase-labeled goat anti-rabbit I
After reacting with a block ace solution containing gG (manufactured by Bio Rat Co., Ltd.) for 6 hours and washing in the same manner, Konica Corporation
Color development was carried out using Konica Immunostain HRP1000 manufactured by Toshiba Corporation. As a result, about 40 kD, about 75 kD and about 85 kD
Three bands of kD were detected. Of which, about 75k
The D band is dog IL12 consisting of the heterodimer of dogs P40 and P35, the band at about 40 kD is dog P40 monomer, and the band at about 85 kD is dog P40.
It is a homodimer.

Reference Example 4 Activity Measurement of Canine IL12 The activity of dog IL12 produced in Reference Example 2 (2) was measured as follows. Canine IF from canine lymphocytes
For Nγ-inducing activity assay, antiviral activity was measured. Lymphocytes were isolated from dog spleen and 10% FBS-E
Suspended in RDF at a cell density of 10 ⁶ cells / ml,
2.5 ml of this and 250 U of human IL2 (Genzyme) were added to a 6 cm dish. 2.5 ml of the culture supernatant obtained in (2) above and human IL2
(Genzyme) 250 U, 5% CO ₂ , 3
Cultured at 7 ° C for 2 days, Vesic as virus
The antiviral activity of this culture solution was measured using MDCK (ATCC CCL-34) as a susceptible cell, according to the CPE method of Reference 8. As a result, an antiviral activity of 10 ⁷ dilution units / ml or more was detected.

Example 1 Separation and Fractionation by Purification of Canine IL12 Using the cell culture supernatant obtained in Reference Example 2 (2), fractionation of canine IL12 using a phenyl sepharose carrier was examined. Purification was performed at pH: 7. First, Phenyl Sepharose 6 Fast Flow Carrier (Amersham-Pharmacia)
The column was filled with 15 ml, and then a 50 mM phosphate buffer (pH: 1.5 M) containing a sufficient amount of 1.5 M ammonium sulfate was used.
In 7), the phenyl column was replaced.

After 200 ml of the culture supernatant was applied to a column packed with phenyl sepharose 6 fast flow carrier, 50 ml containing a sufficient amount of 1.5 M ammonium sulfate were added.
The column was washed with a mM phosphate buffer (pH: 7). Next, canine IL12 was eluted. Elution was performed by gradually decreasing the concentration of ammonium chloride to 0 M in steps of 10 mM. As a result, canine IL12 was detected in the eluted fraction at 0 to 100 mM, the P40 monomer was detected at 350 mM to 600 mM, and the P40 homodimer was detected at the ammonium chloride concentration of 650 mM to 700 mM. That is, per 1 ml of phenyl carrier,
Canine IL12 was separated and fractionated at a ratio of about 0.1 mg to 0.13 mg. (Western blotting and activity measurement). In addition, canine interleukin 12, P40
No monomer or P40 homodimer was detected.

Reference Example 5 Purified dog IL12 and dog P
Activity of 40 homodimers In vitro of purified canine IL12 obtained in Example 1
The activity measurement at o was performed as follows. Purified dog I
For the assay of L12 canine IFNγ-inducing activity from canine lymphocytes, antiviral activity was measured. Lymphocytes were isolated from dog peripheral blood and 10% in a 96-well microplate.
100 μl per well was added to FBS-ERDF at a cell density of 10 ⁶ cells / ml, and Zenzyme (G
Enzyme) 250 recombinant human IL2
μg, and 1 μg of purified canine IL12, 5%
The cells were cultured under conditions of CO ₂ and 37 ° C. for 72 hours. The antiviral activity in 100 μl of the culture supernatant after the culture was measured. Vesicular Stomatis as a virus
Virus, FCBR1 was used as a sensitive cell, and the antiviral activity of this culture was measured according to the CPE method of Reference 9. As a result, the culture supernatant was added purified canine IL12, the anti-viral activity of 10 ⁵ U / ml was observed.

[0033]

According to the method of the present invention, interleukin 12 can be separated and fractionated with high purity.

References: Wolf et al. Immunol. 146,307
4-3081 (1991). 2. Chirgwin et al .: Biochemistry,
18, 5294 (1979). 3. Berger et al .: Biochemistry, 1
8, 5143 (1979). 4. Gubler et al .: Gene. 25,236-269
(1983). 5. Okayama et al .: Mol. Cell. Bio
l. , 2,161, (1982) & 3,280,
(1983). 6. Okano et al. Interferon & Cy
Tokyo Res. , 17, 713-718 (19
97). 7. Molecular Cloning. Cold
Spring Harbor Laboratory.
New York. 1982. 8. The Biochemical Society of Japan, ed.
86). P250-256, Tokyo Kagaku Doujin. 9. F. L. Grabam et al .: Virology 5
4,536 (1973).

[0035]

[Sequence List] <110> Toray Industries, Inc. <120> High purity production method of useful proteins <130> 51E16010 <160> 4 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <400> atgcatcctc agcagttggt catctcctgg 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> ctaactgcag gacacagatg cccagtcgct 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <400> atgtgcccgc cgcgcggcct cctccttgt 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <400> ttaggaagaa ttcagataac tcatcattct 30

Claims (3)

[Claims] Manufacturing method. 1. A method for producing interleukin 12 with high purity, comprising bringing a solution containing interleukin 12 into contact with a phenyl sepharose carrier and eluting an adsorbed substance on the carrier with an eluent. 2. The method for producing interleukin 12 with high purity according to claim 1, wherein the interleukin 12 is dog interleukin 12. 3. The method for producing interleukin 12 according to claim 1, wherein the eluent is an ammonium chloride solution.