JP3070913B2 - Immunostimulator using membrane-localized ZAP-70 - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a DNA encoding a membrane-localized chimeric protein having immunosuppressive activity, a recombinant vector containing the DNA, a transformed cell containing the vector, a method for activating immunocompetent cells, And an immunostimulant containing the transformed cell.

[0002]

2. Description of the Related Art It has been known that immune function is reduced in animals bearing cancer. Of particular note here is that T cells, which are known to play an important role in regulating immune responses, suppress the expression of receptors that recognize antigens of cancer cells. Thus, even if the immune system of a normal animal has the ability to combat cancer cells, it cannot exert that ability in a cancer-bearing state. Suppression of the immune system impairs the immune response to cancer cells, which can be a major obstacle in removing tumors, especially at sites where surgery is difficult, or small tumors that have metastasized.

On the other hand, chemotherapeutic agents used for treating cancer not only cause severe side effects, but also extremely suppress the immune system response, and eventually cause death to the patient due to opportunistic infection. Not a few. In view of the above, maintaining the immune system in an active state in a cancer-bearing state is a very important task.

[0004] A protein called ZAP-70 is a protein tyrosine kinase that exists in the cytoplasm and is specifically expressed in T cells. ZAP-70 is normally present in the cytoplasm, but when stimulation from a T cell antigen receptor (TCR) is applied to cells, ZAP-70 moves to the cell membrane by phosphorylation of the receptor. ZAP-70 with this movement
Activation, ZAP-70 is a motif structure commonly found in tyrosine-phosphorylated antigen receptors, that is, an immunoreceptor tyrosine-dependent activation motif (Immuno
Receptor Tyrosine-based Activation Motif (ITAM). Then, the phosphorylation function transmits information to another molecule, thereby activating the cell.

[0005] In TAPs derived from patients deficient in ZAP-70, TC
Since the response to the R stimulus is completely lost, ZA
P-70 has been shown to be essential for TCR signaling (Elder, ME et al., Science, 264, 1).
596-1599 (1994); Chan, AC et al., Science, 264, 1599-1.
601 (1994)).

[0006]

DISCLOSURE OF THE INVENTION The present invention provides a DNA encoding a membrane-localized chimeric protein, a recombinant vector and a transformed cell containing the DNA, a method for immunostimulating immunocompetent cells, and an immunostimulator. The purpose is to provide.

[0007]

Means for Solving the Problems As a result of intensive studies based on the above-mentioned problems, the present inventors have found that ZAP-70 localizes to the cell membrane without stimulating the TCR, thereby activating cells. And succeeded in completing the present invention.

That is, the present invention relates to a protein comprising an amino acid sequence represented by SEQ ID NO: 3 or 4 or a sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence, and which has immunostimulatory activity. Is a DNA encoding Proteins include membrane-localized protein tyrosine kinases (eg, ZAP-70). And as the DNA, for example, SEQ ID NO: 1
Or those represented by 2.

Further, the present invention is a recombinant vector containing the DNA. Furthermore, the present invention is a transformed cell transformed by the above-mentioned recombinant vector. Such cells include, for example, T cells, B cells, NK cells, mast cells or neutrophils.

Further, the present invention is a method for activating immunocompetent cells, which comprises introducing the DNA into immunocompetent cells (for example, T cells, B cells, NK cells, mast cells or neutrophils). . Furthermore, the present invention is an immunostimulant containing the transformed cell. Hereinafter, the present invention will be described in detail.

[0011]

BEST MODE FOR CARRYING OUT THE INVENTION The DNA of the present invention is a DNA encoding a membrane-localized chimeric protein in which a membrane-bound protein is linked to ZAP-70, a protein tyrosine kinase.
It is. The DNA of the present invention is a DNA encoding ZAP-70.
(Also called ZAP-70 DNA) and DNA encoding a membrane-bound protein,
Can be obtained by ligating a DNA encoding SH2-deleted ZAP-70 in which the SH2 domain has been deleted with a DNA encoding a membrane-bound protein. In addition, ZAP-
A DNA encoding a chimeric protein of a 70- or SH2-deleted ZAP-70 mutant having one or several amino acids deleted, substituted or added and a membrane-bound protein is also included in the DNA of the present invention. included. The DNA of the present invention can be obtained by the following steps.

(1) Cloning of DNA encoding ZAP-70 and DNA encoding a membrane-bound protein The nucleotide sequence of cDNA encoding ZAP-70 is already known (Chan, et al., 1992. Cell, 71,649-662), a commercially available T cell-derived cDNA library (Stratagene, Cl.
known from onetech, Inc. (“Molecular Cloning
”, J. Sambrooket al., Cold Spring Harbor Laboratory
Press, 1989). For example, a part (oligonucleotide) of the base sequence of ZAP-70 is chemically synthesized, and a clone that binds to the base
Identify from the A library.

On the other hand, the membrane-bound protein in the present invention comprises a transmembrane protein (TM) and an extracellular domain (C
D2). CDNAs encoding the CD2 and TM are also known (Mo
ingeon, P. et al., 1989. Immunol. Rev. 111, 111-144), C
When a cDNA encoding D2 and TM is newly cloned, a method similar to the method of cloning cDNA encoding ZAP-70 can be used.

(2) ZAP-70 DNA or deleted ZAP-70 DNA
(I) ZAP-70 DNA and DN encoding a membrane-bound protein
Ligation to A Ligation of ZAP-70 DNA to DNA encoding a membrane-bound protein can be carried out by digesting these DNAs with an appropriate restriction enzyme and ligating them using ligase, or
This is performed by binding NA and DNA encoding a membrane-bound protein with an appropriate oligonucleotide.

Alternatively, each DN obtained by the above (1)
Each DNA may be amplified by performing PCR (Polymerase Chain Reaction) using A as a template, and both DNAs may be ligated. In this case, the primer is synthesized as follows.

(Ia) DN encoding a membrane-bound protein
In the case of amplifying A, for the 5′-side primer, a suitable region inside the membrane-bound protein (eg, CD2) and at the 5′-end (eg, a region of about 30 bases in the 3′-direction from the 5′-end) An oligonucleotide of 15 to 30 bases is appropriately selected from the above and synthesized (FIG. 1 (a);
). The 3′-side primer includes both a region on the cell inner side of the transmembrane portion (TM) of CD2 (the region on the SH2 side of TM in FIG. 1) and a region on the N-terminal side of ZAP-70. (FIG. 1 (a); Primer 2)
).

(Ib) When amplifying ZAP-70 DNA,
As the 5′-side primer, a primer complementary to the above primer 2 was used (FIG. 1 (b); referred to as primer 3).
As for the 3′-side primer, an appropriate region inside the ZAP-70 DNA and on the 3′-terminal side (for example, 5 ′ from the 3′-terminal)
Oligonucleotides of 15 to 30 bases are appropriately selected from those within a region of about 30 bases in the lateral direction (FIG. 1 (b);
Primer 4).

The reaction conditions for PCR can be appropriately determined, and each DNA fragment is amplified (primary PCR) using the above primers. The PCR reaction is performed by a known method (J. Sambroo
k, et al., “Molecular Cloning”, ColdSpring Harbor
Laboratory Press, 1989), or using a commercially available kit (eg, manufactured by Perkin-Elmer).

Next, a secondary P for linking each amplified fragment was prepared.
The CR is performed (FIGS. 1 (c) and (d)). As a template for secondary PCR,
A mixture of the reaction products of the primary PCR is used (FIG. 1 (c)). As the primers used for the secondary PCR, primer 1 is used as the 5′-side primer, and primer 4 is used as the 3′-side primer. The reaction of the secondary PCR is the same as in the case of the primary PCR.

(Ii) Ligation of deletion ZAP-70 DNA and DNA encoding a membrane-bound protein In the present invention, the deletion chimera ZAP-70 is a natural ZAP-70.
A chimeric protein obtained by linking a fragment (deleted ZAP-70) obtained by cutting the SH2 site of No. 70 with a membrane-bound protein. Therefore, the DNA encoding the deleted chimeric ZAP-70 can be obtained by converting the native ZAP-70 DNA into an appropriate restriction enzyme (for example, SacII, EcoR).
I) to delete the SH2-encoding region, and to obtain a DNA fragment containing a membrane-bound protein.
Src1-14 (amino acids 1-14 of chicken Src; Take
1983, Cell32, 881-890), and ligated using ligase.

(3) Preparation of Mutant Form of Chimeric DNA of the Present Invention In the present invention, a mutation can be introduced into ZAP-70 DNA and deleted ZAP-70 DNA. The mutation can be introduced by a known method, for example, a method using PCR. First, a fragment containing a site into which a mutation is to be introduced is cut out of the entire ZAP-70 DNA using an appropriate restriction enzyme. Next, a primer containing the mutated base and about 10 bases before and after the mutation site is added to a sense strand (sense primer) and an antisense strand (antisense primer).
And each is synthesized. Then, a primer 5 'on the 5' side several hundred bases from the mutation site (referred to as primer 5)
And a primer (referred to as primer 6) 3 ′ to several hundred bases 3 ′ from the mutation site (FIG. 2 (a)).
Further, two PCR reactions are performed using a combination of the primer 5 and the antisense primer and the combination of the primer 6 and the sense primer (FIG. 2 (b)). Finally, based on the purified product, a secondary PC was prepared using primers 5 and 6.
Perform R (FIG. 2 (c)). After purifying this product, treat it with an appropriate restriction enzyme,
Mutated ZAP-70DN bound to ZAP-70 DNA
The whole of A is completed.

FIG. 3 shows a schematic diagram of the chimeric DNA of the present invention. In FIG. 3, “ZAP-70” is a DNA encoding natural ZAP-70, “CD2 / ZAP-70” is a DNA encoding a chimeric protein obtained by linking CD2 and TM to ZAP-70, and “CD2 / ZAP-70”.
(A369) '', `` CD2 / ZAP-70 (F492) '' and `` CD2 / ZAP-70 (F49
3) is the amino acid at position 369 of ZAP-70 as alanine,
DNA encoding the chimeric protein obtained by mutating the 492nd amino acid to phenylalanine and the 492nd amino acid to phenylalanine, respectively, and “Sr
"c / ZAP-70" is a DNA encoding a chimeric protein (deleted chimeric ZAP-70) in which Src1-14 is linked to deleted ZAP-70.
It is.

A known plasmid vector (for example, pBluescript by Stratagene) can be used as the plasmid DNA for holding the above-mentioned ligated DNA fragment. The plasmid DNA is digested with the same restriction enzymes as those used to digest the DNA.

Each of the above DNA and plasmid DNA
And ligation using a known ligation kit (Boehringer Mannheim) to obtain a recombinant vector.
Next, the obtained recombinant vector was transformed into E. coli JM109, HB101.
, XL1-Blue, etc., ampicillin-resistant colonies are selected, and plasmid DNA is prepared according to a known method (J. Sambrook, et al., “Molecular Cloning”, Co.
ld Spring Harbor Laboratory Press, 1989).

The nucleotide sequence of the target DNA is determined by a known method (for example, the dideoxy method) after digesting the above plasmid DNA with a restriction enzyme (J. Sambrook, et al.).
l., “Molecular Cloning”, Cold Spring Harbor Labor
atory Press, 1989). In the present invention, for example, a commercially available automatic base sequencer may be used.

As the base sequence of the DNA encoding the chimeric protein of ZAP-70 and the membrane-bound protein determined in this way, the DNA encoding CD2 / ZAP-70 is, for example, one represented by SEQ ID NO: 1. Src /
For DNA encoding ZAP-70, for example, SEQ ID NO: 2
Are represented.

However, as long as the CD2 / ZAP-70 or Src / ZAP-70 chimeric protein having the amino acid sequence represented by SEQ ID NO: 3 or 4 has a kinase activity, particularly a protein tyrosine kinase activity, the amino acid sequence is deleted. , Replace,
Mutations such as insertion may occur. Accordingly, for example, chimeric proteins including those in which the first methionine (Met) contained in the amino acid sequence of ZAP-70 is deleted, and those in which the 492th tyrosine is substituted with phenylalanine are also included in this protein. Included in proteins due to amino acid sequence changes. In addition to the nucleotide sequence encoding the amino acid contained in the CD2 / ZAP-70 or Src / ZAP-70 chimeric protein of the present invention, degenerate isomers encoding the same polypeptide that differs only in degenerate codons are also included in the present invention. DNA.

(4) Preparation of Recombinant Vector and Transformant The transformant of the present invention is prepared by transforming the expression vector of the present invention with a cell to be transformed, ie, an immunocompetent cell (eg, T cell, B cell, NK cells, mast cells or neutrophils, or precursor cells thereof). As the expression vector, for example, a vector derived from an adenovirus or a retrovirus is used. Therefore, as the gene transfer method, an infection method using a growth-defective strain of each virus is used.

(5) Activation of Immunocompetent Cells In the present invention, the immunocompetent cells can be activated (activated) by introducing the DNA of the present invention into the immunocompetent cells. The immunocompetent cell is not particularly limited as long as it is a cell that mainly controls an immune reaction in a living body. For example, T cells,
B cells, NK cells, mast cells, neutrophils, or precursor cells thereof, and the like are mentioned as immunocompetent cells. These immunocompetent cells can be prepared from blood, spleen, thymus, bone marrow, lymph nodes, and the like. Furthermore, in addition to these cells, established cell lines can also be used.

T cells are prepared by generally known methods (cell sorter method, magnet sorter method, nylon wool column method, etc.). For example, cells are stained with a fluorescent antibody against a CD3 molecule, which is a surface antigen specifically expressed on T cells, and then stained with Fecton-Dickinson FACS.
-Separate with VANTAGE etc. B cells, NK cells, mast cells and neutrophils can also be prepared in the same manner as described above by staining surface antigens specifically expressed on these cells and using a cell sorter.

Next, the DNA of the present invention is introduced into the immunocompetent cells thus prepared. The DNA of the present invention can be introduced by using an infection method using an adenovirus or a retrovirus strain whose growth has been lost.

The immunocompetent cells prepared as described above express ZAP-70 by expressing the DNA of the present invention (CD2 / ZAP-70, Src / ZAP-70 or a DNA encoding these mutants). Are localized on the membrane and have immunostimulatory activity. The activity of the immunostimulatory cells is determined by the nuclear factor of activated T cells (NF-AT).
l) Activation or IL-2 receptor expression is measured as an index.

(6) Immunostimulator When the immunostimulator cell of the present invention is used as an immunostimulator, the subject to be used is not particularly limited. For example, it can be used for the specific purpose of preventing or treating a disease in which individual immune functions have been reduced, and is not particularly limited to the type of the disease, but is mainly used for the treatment of immunosuppressive states after cancer chemotherapy, infectious diseases, and the like Or it is effective for prevention.

The method of administering the immunostimulant of the present invention includes parenteral administration, and parenteral administration includes injections, for example, intravenous injection, intravenous drip infusion, and intra-tissue injection. The dose varies depending on the age of the subject, the route of administration, and the number of administrations, and can be varied over a wide range. In this case, the effective amount (the number of effective cells) administered as a combination of the effective amount of the immunopotentiator of the present invention and a suitable diluent and a pharmacologically usable carrier is 1 × 10 ⁵ to 1 × 10 ^{5. It is 7} cells / kg body weight / day, and is administered once a day or several times a day.

When the immunostimulant of the present invention is to be administered parenterally, it is prepared as necessary, containing additives such as stabilizers, buffers, preservatives and isotonic agents. When administering the immunostimulant of the present invention, various cytokines (for example, interferon) may be added alone or in an appropriate combination.

[0036]

The present invention will be described more specifically with reference to the following examples. However, the technical scope of the present invention is not limited to these examples. [Example 1] Cloning of DNA encoding chimeric protein (1) CD2 / ZAP-70 chimeric DNA cDNA encoding ZAP-70 (ZAP-70 cDNA) and CD
CDNA encoding CD2 (CD2 cDNA) is already known, and these cDNAs were used to produce CD2 / ZAP-70 chimeric DNA (ZAP-70: CMIwashima et a).
l., 1992.Cell, 71, 649-662; CD2: Moingeon, P. et al., 1
989. Immunol. Rev. 111, 111-144).

First, a portion of the restriction enzyme NdeI immediately before the transmembrane portion of the CD2 cDNA and a portion of the SacII at the 5 ′ end of ZAP-70 were linked with a synthetic oligonucleotide. The oligonucleotides used at this time are shown below.

Sense side: 5'-TATGTGGAGGAGGCAGCCTCTTGAT
GGTCTTTGTGGCACTGCTCGTTTTCTATATCACCAAAAGGAAACCAGACC
CCGC-3 '(SEQ ID NO: 5) Antisense side: 5'-GGGGTCTGGTTTCCTTTTGGTGATATAGAAA
ACGAGCAGTGCCACAAAGACCATCAAGAGGCTGCCTCCTCCACA-3 '
(SEQ ID NO: 6) As a result, for the CD2 / ZAP-70 chimeric DNA, the nucleotide sequence represented by SEQ ID NO: 1 was obtained, and its amino acid sequence was represented by SEQ ID NO: 3. Here, SEQ ID NO: 1
In the base sequence represented by, the sequence of the DNA encoding the membrane-bound protein was 1st to 654th. Also, ZA
The sequence of the P-70 cDNA was from position 655 to the 3 'end.

On the other hand, for the Src / ZAP-70 chimeric DNA, the 5 'untranslated region (positions -1 to -30) of the ZAP-70 DNA, the 1st to 14th amino acid residues of chicken Src, and DNA (sequence; 5 ′) containing each sequence of an oligonucleotide encoding a spacer amino acid (glycine)
-ACGTCCCCAGGTTTCGGGAGGCCCAGGGGCGATGGGGAGTAGCAAGAGC
AGCCTAAGGACCCCAGCCAGCGCGGG-3 ′ (SEQ ID NO: 7)), which encodes D-encoding from position 263 to the C-terminus of human ZAP-70
It was ligated to the tip of the NA fragment. As a result, the base sequence represented by SEQ ID NO: 2 was obtained. The amino acid sequence was represented by SEQ ID NO: 4.

Further, among the CD2 / ZAP-70 chimeric DNAs,
Several types of ZAP-70 DNA in which a mutation was introduced were prepared. This means that the ZAP-70 portion of the CD2 / ZAP-70 chimeric DNA is mutated using restriction enzymes and ligase to form a mutant ZAP-70DN.
A was performed by replacing with A. Among the mutants used, A369 (mutated 369th lysine (AGG) of the amino acid sequence of ZAP-70 to alanine (GCG)) is known (Iwashima, M. et al., 1994). .Science, 263,11
36).

F4 was prepared in the same manner as when A369 was prepared.
92 (in the amino acid sequence of ZAP-70, the 492nd tyrosine (TAC) is mutated to phenylalanine (TTC))
, F493 (in which the 493rd tyrosine (TAC) in the amino acid sequence of ZAP-70 is mutated to phenylalanine (TTC)), K37K190 (37th and 190th arginine in the amino acid sequence of ZAP-70) Mutated to lysine)
Was introduced by two-step PCR. Primers used for primary PCR are as follows for F492.

(A) DNA corresponding to base sequence 1591-1615 of ZAP-70 DNA (5'-ACCTGGCGGCCCGCAACGTCCTGCT-3 '(SEQ ID NO: 8) (b) Antisense strand containing F492 mutation (5'-TGAGCGGGGGCAGTGT
AGAAGCTGTCG-3 '(SEQ ID NO: 9) (c) Sense strand containing F492 mutation (5'-CGACAGCTTCTACACTGCCC
GCTCA-3 '(SEQ ID NO: 10) (d) DNA corresponding to 1820-1796 of ZAP-70 DNA (5'-CT
GGCCGTAGGACAAGGCCTCCCAC-3 '(SEQ ID NO: 11)

PCR was performed using primers of the combination of (a) and (b) and (c) and (d), and ZAP-70 cDNA as a template. And Ampli taq polymerase (Roche)
In a reaction solution containing buffer and attached buffer, 94 ° C for 1 minute, 55 ° C
This is a cycle of 2 minutes and 2 minutes at 72 ° C.
35 cycles were performed.

After purifying a fragment of the expected size by agarose electrophoresis and Qiaex (Qiagen), in the secondary PCR, a mixture of the two fragments was used as a template, and (a) and (d) were used as primers. Was performed in the same manner as the primary PCR to obtain a final product. This was cloned into a cloning vector pBluescriptKS (+) (Stratagene), and it was confirmed that the expected mutation was introduced. After digesting this fragment with the restriction enzyme BstEII, it was introduced into ZAP-70 DNA that had been treated in the same manner.

F493 was prepared in the same manner as described above. However, the primer used was (b ') instead of (b)
(5'-TGAGCGGGCAGTGAAGTAGCTGTCG-3 '(SEQ ID NO: 12)),
(c ') instead of (c') (5'-CGACAGCTACTTCACTGCCCGCTCA-
3 '(SEQ ID NO: 13)) was used. For K37K190, the existing K37 mutation and K190 mutation (both from Iwashima,
M. et al., 1994.Science, 263, 1136) was treated with a restriction enzyme, and the K37 mutation site was replaced with a DNA having a K190 mutation site.
It was made by assembling it.

Example 2 Activation of Immunocompetent Cells (1) Cell Culture Jurkat and J.RT3.T3.5 cells and SV40 large T antigen (T
Ag) transfected Jurkat cells (Jurkat TAg
Cells) were RPMI-1640 containing 10% fetal calf serum, 100 μg / ml penicillin and 100 μg / ml streptomycin.
Each was cultured in a medium. Jurkat and J.RT3.T3.5 cells
Professor Arthur Weiss (University of California, San Fra
ncisco). J.TAg cells are from Professor G. Crabtree
(Stanford University).

(2) Construction of Expression Plasmid and Reporter Plasmid The CD2 / ZAP-70 chimeric DNA obtained in Example 1, a mutant thereof, and a DNA in which the kinase domain of ZAP-70 was linked to the N-terminal part of Src were used. Were introduced into the expression vector pME18S by restriction enzyme treatment and ligase treatment, respectively. Cell activation was measured using the transcriptional activity of the IL-2 promoter / enhancer region, which is a typical lymphokine of T cells, as an index. Therefore, as a marker for gene expression, a known reporter plasmid (Northrop, JPet al. 1993. J. Biotech.) In which a portion having an NF-AT binding region that controls the IL-2 promoter is linked to a luciferase gene.
Chem., 268, 2917-2923).

Here, the 369th lysine (AAG) in the amino acid sequence of ZAP-70, which is mutated to alanine (GCG), is referred to as mutant CD2 / ZAP-70 (A369) (variant A369). 70 of 49
A variant in which the second tyrosine (TAC) was mutated to phenylalanine (TTC) was designated as mutant F492, and a variant in which the 493rd tyrosine (TAC) of ZAP-70 was mutated to phenylalanine (TTC) was designated as variant F493, Mutated both arginine at positions 37 and 190 of ZAP-70 to lysine
190. For Src / ZAP-70 chimeric DNA, ZAP-
70 '5' untranslated region (positions -1 to -30),
Oligonucleotides containing DNAs encoding amino acid residues 1 to 14 of chicken Src and a spacer amino acid (glycine) (sequence: 5'-ACGTCCCCAGGTTTC
GGGAGGCCCAGGGGCGATGGGGAGTAGCAAGAGCAGCCTAAGGACCCCAG
CCAGCGCGGG-3 '(SEQ ID NO: 7)) and 263 of human ZAP-70
It was ligated to the leading end (5'-most side) of the DNA fragment encoding from the third position to the C-terminal. All CD2 / ZAP-70 chimeric DNA and Src / ZAP-70 chimeric DNA were transferred to plasmid pME18S
And transfected into pMIKHyg.

(3) Transfection into cells, stimulation and luciferase assay For luciferase assay, Jurkat, J.RT3.T3.5
And J. TAg cells (5 × 10 ⁶ ), various expression constructs (CD2 / ZAP-70 chimeric DNA and its mutants and Src /
Electroporation was performed using ZAP-70 chimeric DNA) (800 μF and 350-400 V).

After 24-36 hours, the cells are sorted and a final dose of 5
ml of RPMI medium (1.0 μM / ml ionomycin and 10 ng / m
1 with or without PMA (phorbol myristate acetate). After 8 to 12 hours of culture, cells are collected and
aGene kit (Wako Chemical) and Luminometer (Lumat-L)
Luciferase activity was measured using B9501; Berthold). The activity when treated with PMA and ionomycin was the maximum stimulation, and the relative activity (%) was calculated for each sample. Using this value (%), it was determined how many times the cells were induced on average compared to cells not transfected with the vector. As a result, only the DNA of the present invention (CD2 / ZAP-70 chimeric DNA) caused cell activation (FIG. 4, “CD2 / ZAP-70” in the left panel).

The degree of activation at this time was determined by treatment with anti-T cell antigen receptor antibody (anti-TCR) (mouse ascites:
(Use at 1000 dilution) (Fig. 4, right panel). In addition, F492
Enhanced activation, whereas F493 and A369 suppressed activation (FIG. 5). This is because the F493 and A369 mutants are ZAP-
It is thought to be due to the loss of kinase activity of 70 (Wange, RL et al., 1995. J. Biol. Chem., 270, 18730-187).
33).

(4) Immunoprecipitation and Western Blot The Western blot was performed using an ECL kit (Amersham) according to the instructions. CD2 / ZAP-70 chimeric DNA
To detect the expression of, the cell lysate was immunoprecipitated using a biotinylated anti-CD2 monoclonal antibody (Pharmingen) and streptavidin agarose (Sigma). As a result, as shown in FIG. 6, it was found that a chimeric protein was produced by the transformant of the present invention by Western blotting.

(5) Preparation of immunostimulatory cells in which the chimeric protein is localized on the cell membrane of immunocompetent cells and measurement of activity J.RT3.T3.5, a Jurkat cell lacking the expression of the β chain of TCR
Was transfected with CD2 / ZAP-70 chimeric DNA and NF-AT-luc. As a control, a sample not containing the DNA of the present invention (Mock) was used. The activity was measured by using Picka Gene Kit (Wako Pure Chemical Industries, Ltd.).

As a result, cells transfected with the CD2 / ZAP-70 chimeric DNA were activated (FIG. 7A). Similarly, Jurkat cells were transformed with NF-AT-luc and each expression vector (ZAP-70 DNA, CD2 / ZAP-70 chimeric DNA or K37K190
(Mutant chimeric DNA). As a result, CD2 / ZAP-70 chimeric DNA and K37K190 mutant DNA
Cells transfected were activated (FIG. 7).
B).

Further, the activation was measured for the cells transfected with the Src / ZAP-70 chimeric DNA in the same manner as described above. As a result, Src / ZAP-
70 chimeric DNA also activated the cells (FIG. 7C). From the above results, regardless of the presence of the T cell antigen receptor,
It was revealed that ZAP-70 localized on the membrane activates T cells.

[0056]

Industrial Applicability According to the present invention, a DNA encoding a membrane-localized chimeric protein having kinase activity, said DNA
And a transformed cell and an immunostimulant containing the same. The DNA of the present invention is useful for prevention and treatment of diseases having immunosuppression such as cancer and infectious diseases.

[0057]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 2956 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Sequence characteristics Characteristic symbol: CDS Location: 1..2568 Sequence: ATG AGC TTT CCA TGT AAA TTT GTA GCC AGC TTC CTT CTG ATT TTC AAT 48 Met Ser Phe Pro Cys Lys Phe Val Ala Ser Phe Leu Leu Ile Phe Asn 1 5 10 15 GTT TCT TCC AAA GGT GCA GTC TCC AAA GAG ATT ACG AAT GCC TTG GAA 96 Val Ser Ser Lys Gly Ala Val Ser Lys Glu Ile Thr Asn Ala Leu Glu 20 25 30 ACC TGG GGT GCC TTG GGT CAG GAC ATC AAC TTG GAC ATT CCT AGT TTT 144 Thr Trp Gly Ala Leu Gly Gln Asp Ile Asn Leu Asp Ile Pro Ser Phe 35 40 45 CAA ATG AGT GAT GAT ATT GAC GAT ATA AAA TGG GAA AAA ACT TCA GAC 192 Gln Met Ser Asp Asp Ile Asp Asp Ile Lys Trp Glu Lys Thr Ser Asp 50 55 60 AAG AAA AAG ATT GCA CAA TTC AGA AAA GAG AAA GAG ACT TTC AAG GAA 240 Lys Lys Lys Ile Ala Gln Phe Arg Lys Glu Lys Glu Thr Phe Lys Glu 65 70 75 80 AAA GAT ACA TAT AAG CTA TTT AAA AAT GGA ACT CTG AAA ATT AAG CAT 288 Lys Asp Thr Tyr Lys Leu Phe Lys Asn Gly Thr Leu Lys Ile Lys His 85 90 95 CTG AAG ACC GAT GAT CAG GAT ATC TAT AAG GTA TCA ATA TAT GAT ACA 336 Leu Lys Thr Asp Asp Gln Asp Ile Tyr Lys Val Ser Ile Tyr Asp Thr 100 105 110 AAA GGA AAA AAT GTG TTG GAA AAA ATA TTT GAT TTG AAG ATT CAA GAG 384 Lys Gly Lys Asn Val Leu Glu Lys Ile Phe Asp Leu Lys Ile Gln Glu 115 120 125 AGG GTC TCA AAA CCA AAG ATC TCC TGG ACT TGT ATC AAC ACA ACC CTG 432 Arg Val Ser Lys Pro Lys Ile Ser Trp Thr Cys Ile Asn Thr Thr Leu 130 135 140 ACC TGT GAG GTA ATG AAT GGA ACT GAC CCC GAA TTA AAC CTG TAT CAA 480 Thr Cys Glu Val Met Asn Gly Thr Asp Pro Glu Leu Asn Leu Tyr Gln 145 150 155 160 GAT GGG AAA CAT CTA AAA CTT TCT CAG AGG GTC ATC ACA CAC AAG TGG 528 Asp Gly Lys His Leu Lys Leu Ser Gln Arg Val Ile Thr His Lys Trp 165 170 175 ACC ACC AGC CTG AGT GCA AAA TTC AAG TGC ACA GCA GGG AAC AAA GTC 576 Thr Thr Ser Leu Ser Ala Lys Phe Lys Cys Thr Ala Gly Asn Lys Val 180 185 190 AGC AAG GAA TCC AGT GTC GAG CCT GTC AGC TGT CCA GAG AA A GGT CTG 624 Ser Lys Glu Ser Ser Val Glu Pro Val Ser Cys Pro Glu Lys Gly Leu 195 200 205 GAC ATC TAT CTC ATC ATT GGC ATA TGT GGA GGA GGC AGC CTC TTG ATG 672 Asp Ile Tyr Leu Ile Ile Gly Ile Cys Gly Gly Gly Ser Leu Leu Met 210 215 220 GTC TTT GTG GCA CTG CTC GTT TTC TAT ATC ACC AAA AGG AAA CCA GAC 720 Val Phe Val Ala Leu Leu Val Phe Tyr Ile Thr Lys Arg Lys Pro Asp 225 230 235 240 CCC GCG GCG CAC CTG CCC TTC TTC TAC GGC AGC ATC TCG CGT GCC GAG 768 Pro Ala Ala His Leu Pro Phe Phe Tyr Gly Ser Ile Ser Arg Ala Glu 245 250 255 GCC GAG GAG CAC CTG AAG CTG GCG GGC ATG GCG GAC GGG CTC TTC CTG 816 Ala Glu Glu His Leu Lys Leu Ala Gly Met Ala Asp Gly Leu Phe Leu 260 265 270 CTG CGC CAG TGC CTG CGC TCG CTG GGC GGC TAT GTG CTG TCG CTC GTG 864 Leu Arg Gln Cys Leu Arg Ser Leu Gly Gly Tyr Val Leu Ser Leu Val 275 280 285 CAC GAT GTG CGC TTC CAC CAC TTT CCC ATC GAG CGC CAG CTC AAC GGC 912 His Asp Val Arg Phe His His Phe Pro Ile Glu Arg Gln Leu Asn Gly 290 295 300 ACC TAC TAC GCC ATT GCC GGC GGC AAA GCG CAC TG T GGA CCG GCA GAG CTC 960 Thr Tyr Ala Ile Ala Gly Gly Lys Ala His Cys Gly Pro Ala Glu Leu 305 310 315 320 TGC GAG TTC TAC TCG CGC GAC CCC GAC GGG CTG CCC TGC AAC CTG CGC 1008 Cys Glu Phe Tyr Ser Arg Asp Pro Asp Gly Leu Pro Cys Asn Leu Arg 325 330 335 AAG CCG TGC AAC CGG CCG TCG GGC CTC GAG CCG CAG CCG GGG GTC TTC 1056 Lys Pro Cys Asn Arg Pro Ser Gly Leu Glu Pro Gln Pro Gly Val Phe 340 345 350 GAC TGC CTG CGA GAC GCC ATG GTG CGT GAC TAC GTG CGC CAG ACG TGG 1104 Asp Cys Leu Arg Asp Ala Met Val Arg Asp Tyr Val Arg Gln Thr Trp 355 360 365 AAG CTG GAG GGC GAG GCC CTG GAG CAG GCC ATC ATC AGC CAG GCC CCG 1152 Lys Leu Glu Gly Glu Ala Leu Glu Gln Ala Ile Ile Ser Gln Ala Pro 370 375 380 CAG GTG GAG AAG CTC ATT GCT ACG ACG GCC CAC GAG CGG ATG CCC TGG 1200 Gln Val Glu Lys Leu Ile Ala Thr Thr Ala His Glu Arg Met Pro Trp 385 390 395 400 400 TAC CAC AGC AGC CTG ACG CGT GAG GAG GCC GAG CGC AAA CTT TAC TCT 1248 Tyr His Ser Ser Leu Thr Arg Glu Glu Ala Glu Arg Lys Leu Tyr Ser 405 410 415 GGG GCG CAG ACC GAC GGC AAG TTC CTG CTG AGG CCG CGG AAG GAG CAG 1296 Gly Ala Gln Thr Asp Gly Lys Phe Leu Leu Arg Pro Arg Lys Glu Gln 420 425 430 GGC ACA TAC GCC CTG TCC CTC ATC TAT GGG AAG ACG GTG TAC CAC TAC 1344 Gly Thr Tyr Ala Leu Ser Leu Ile Tyr Gly Lys Thr Val Tyr His Tyr 435 440 445 CTC ATC AGC CAA GAC AAG GCG GGC AAG TAC TGC ATT CCC GAG GGC ACC 1392 Leu Ile Ser Gln Asp Lys Ala Gly Lys Tyr Cys Ile Pro Glu Gly Thr 450 455 460 AAG TTT GAC ACG CTC TGG CAG CTG GTG GAG TAT CTG AAG CTG AAG GCG 1440 Lys Phe Asp Thr Leu Trp Gln Leu Val Glu Tyr Leu Lys Leu Lys Ala 465 470 475 475 480 480 GAC GGG CTC ATC TAC TGC CTG AAG GAG GCC TGC CCC AAC AGC AGT GCC 1488 Asp Gly Leu Ile Tyr Cys Leu Lys Glu Ala Cys Pro Asn Ser Ser Ala 485 490 495 AGC AAC GCC TCA GGG GCT GCT GCT CCC ACA CTC CCA GCC CAC CCA TCC 1536 Ser Asn Ala Ser Gly Ala Ala Ala Pro Thr Leu Pro Ala His Pro Ser 500 505 510 ACG TTG ACT CAT CCT CAG AGA CGA ATC GAC ACC CTC AAC TCA GAT GGA 1584 Thr Leu Thr His Pro Gln Arg Arg Ile Asp Thr Leu Asn Ser Asp Gly 515 520 525 TAC ACC CCT GAG CCA GCA CGC ATA ACG TCC CCA GAC AAA CCG CGG CCG 1632 Tyr Thr Pro Glu Pro Ala Arg Ile Thr Ser Pro Asp Lys Pro Arg Pro 530 535 540 540 ATG CCC ATG GAC ACG AGC GTG TAT GAG AGC CCC TAC AGC GAC CCA GAG 1680 Met Pro Met Asp Thr Ser Val Tyr Glu Ser Pro Tyr Ser Asp Pro Glu 545 550 555 560 GAG CTC AAG GAC AAG AAG CTC TTC CTG AAG CGC GAT AAC CTC CTC ATA 1728 Glu Leu Lys Asp Lys Lys Leu Phe Leu Lys Arg Asp Asn Leu Leu Ile 565 570 575 GCT GAC ATT GAA CTT GGC TGC GGC AAC TTT GGC TCA GTG CGC CAG GGC 1776 Ala Asp Ile Glu Leu Gly Cys Gly Asn Phe Gly Ser Val Arg Gln Gly 580 585 590 590 GTG TAC CGC ATG CGC AAG AAG CAG ATC GAC GTG GCC ATC AAG GTG CTG 1824 Val Tyr Arg Met Arg Lys Lys Gln Ile Asp Val Ala Ile Lys Val Leu 595 600 605 AAG CAG GGC ACG GAG AAG GCA GAC ACG GAA GAG ATG ATG CGC GAG GCG 1872 Lys Gln Gly Thr Glu Lys Ala Asp Thr Glu Glu Met Met Arg Glu Ala 610 615 620 CAG ATC ATG CAC CAG CTG GAC AAC CCC TAC ATC GTG CGG CTC ATT GGC 1920 Gln Ile Met His Gln Leu Asp Asn Pro Tyr Ile Val Arg Leu I le Gly 625 630 635 640 GTC TGC CAG GCC GAG GCC CTC ATG CTG GTC ATG GAG ATG GCT GGG GGC 1968 Val Cys Gln Ala Glu Ala Leu Met Leu Val Met Glu Met Ala Gly Gly 645 650 655 GGG CCG CTG CAC AAG TTC CTG GTC GGC AAG AGG GAG GAG ATC CCT GTG 2016 Gly Pro Leu His Lys Phe Leu Val Gly Lys Arg Glu Glu Ile Pro Val 660 665 670 AGC AAT GTG GCC GAG CTG CTG CAC CAG GTG TCC ATG GGG ATG AAG TAC 2064 Ser Asn Val Ala Glu Leu Leu His Gln Val Ser Met Gly Met Lys Tyr 675 680 685 CTG GAG GAG AAG AAC TTT GTG CAC CGT GAC CTG GCG GCC CGC AAC GTC 2112 Leu Glu Glu Lys Asn Phe Val His Arg Asp Leu Ala Ala Arg Asn Val 690 695 700 CTG CTG GTT AAC CGG CAC TAC GCC AAG ATC AGC GAC TTT GGC CTC TCC 2160 Leu Leu Val Asn Arg His Tyr Ala Lys Ile Ser Asp Phe Gly Leu Ser 705 710 710 715 720 AAA GCA CTG GGT GCC GAC GAC AGC TAC TAC TAC ACT GCC CGC TCA GCA GGG 2208 Lys Ala Leu Gly Ala Asp Asp Ser Tyr Tyr Thr Ala Arg Ser Ala Gly 725 730 735 AAG TGG CCG CTC AAG TGG TAC GCA CCC GAA TGC ATC AAC TTC CGC AAG 2256 Lys Trp Pro Leu Lys Trp Tyr Ala Pr o Glu Cys Ile Asn Phe Arg Lys 740 745 750 TTC TCC AGC CGC AGC GAT GTC TGG AGC TAT GGG GTC ACC ATG TGG GAG 2304 Phe Ser Ser Arg Ser Asp Val Trp Ser Tyr Gly Val Thrl Met Trp Glu 755 760 765 GCC TTG TCC TAC GGC CAG AAG CCC TAC AAG AAG ATG AAA GGG CCG GAG 2352 Ala Leu Ser Tyr Gly Gln Lys Pro Tyr Lys Lys Met Lys Gly Pro Glu 770 775 780 GTC ATG GCC TTC ATC GAG CAG GGC AAG CGG ATG GAG TGC CCA CCA GAG 2400 Val Met Ala Phe Ile Glu Gln Gly Lys Arg Met Glu Cys Pro Pro Glu 785 790 795 800 TGT CCA CCC GAA CTG TAC GCA CTC ATG AGT GAC TGC TGG ATC TAC AAG 2448 Cys Pro Pro Glu Leu Tyr Ala Leu Met Ser Asp Cys Trp Ile Tyr Lys 805 810 815 TGG GAG GAT CGC CCC GAC TTC CTG ACC GTG GAG CAG CGC ATG CGA GCC 2496 Trp Glu Asp Arg Pro Asp Phe Leu Thr Val Glu Gln Arg Met Arg Ala 820 825 830 TGT TAC TAC AGC CTG GCC AAG AAG GTG GAA GGG CCC CCA GGC AGC ACA 2544 Cys Tyr Tyr Ser Leu Ala Ser Lys Val Glu Gly Pro Pro Gly Ser Thr 835 840 845 CAG AAG GCT GAG GCT GCC TGT GCC TGAGCTCCCG CTGCCCAGGG GAGCCCTCCA 2598 Gln Lys Ala G lu Ala Ala Cys Ala 850 855 CGCCGGCTCT TCCCCACCCT CAGCCCCACC CCAGGTCCTG CAGTCTGGCT GAGCCCTGCT 2658 TGGTTGTCTC CACACACAGC TGGGCTGTGG TAGGGGGTGT CTCAGGCCAC ACCGGCCTTG 2718 CATTGCCTGC CTGGCCCCCT GTCCTCTCTG GCTGGGGAGC AGGGAGGTCC GGGAGGGTGC 2778 GGCTGTGCAG CCTGTCCTGG GCTGGTGGCT CCCGGAGGGC CCTGAGCTGA GGGCATTGCT 2838 TACACGGATG CCTTCCCCTG GGCCCTGACA TTGGAGCCTG GGCATCCTCA GGTGGTCAGG 2898 CGTAGATCAC CAGAATAAAC CCAGCTTCCC TCTTGAAAAA AAAAAAAAAA AAAAAACC 2956

SEQ ID NO: 2 Sequence length: 1119 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Sequence characteristics Characteristic symbol: CDS Location: 1 ..1116 Sequence: ATG GGG AGT AGC AAG AGC AAG CCT AAG GAC CCC AGC CAG CGC GGG TCA 48 Met Gly Ser Ser Lys Ser Lys Pro Lys Asp Pro Ser Gln Arg Gly Ser 1 5 10 15 GGG GCT GCT GCT CCC ACA CTC CCA GCC CAC CCA TCC ACG TTG ACT CAT 96 Gly Ala Ala Ala Pro Thr Leu Pro Ala His Pro Ser Thr Leu Thr His 20 25 30 CCT CAG AGA CGA ATC GAC ACC CTC AAC TCA GAT GGA TAC ACC CCT GAG 144 Pro Gln Arg Arg Ile Asp Thr Leu Asn Ser Asp Gly Tyr Thr Pro Glu 35 40 45 CCA GCA CGC ATA ACG TCC CCA GAC AAA CCG CGG CCG ATG CCC ATG GAC 192 Pro Ala Arg Ile Thr Ser Pro Asp Lys Pro Arg Pro Met Pro Met Asp 50 55 60 ACG AGC GTG TAT GAG AGC CCC TAC AGC GAC CCA GAG GAG CTC AAG GAC 240 Thr Ser Val Tyr Glu Ser Pro Tyr Ser Asp Pro Glu Glu Leu Lys Asp 65 70 75 80 AAG AAG CTC TTC CTG AAG CGC GAT AAC CTC CTC A TA GCT GAC ATT GAA 288 Lys Lys Leu Phe Leu Lys Arg Asp Asn Leu Leu Ile Ala Asp Ile Glu 85 90 95 CTT GGC TGC GGC AAC TTT GGC TCA GTG CGC CAG GGC GTG TAC CGC ATG 336 Leu Gly Cys Gly Asn Phe Gly Ser Val Arg Gln Gly Val Tyr Arg Met 100 105 110 CGC AAG AAG CAG ATC GAC GTG GCC ATC AAG GTG CTG AAG CAG GGC ACG 384 Arg Lys Lys Lys Gln Ile Asp Val Ala Ile Lys Val Leu Lys Gln Gly Thr 115 120 125 GAG AAG GCA GAC ACG GAA GAG ATG ATG CGC GAG GCG CAG ATC ATG CAC 432 Glu Lys Ala Asp Thr Glu Glu Met Met Arg Glu Ala Gln Ile Met His 130 135 140 CAG CTG GAC AAC CCC TAC ATC GTG CGG CTC ATT GGC GTC TGC CAG GCC 480 Gln Leu Asp Asn Pro Tyr Ile Val Arg Leu Ile Gly Val Cys Gln Ala 145 150 155 160 GAG GCC CTC ATG CTG GTC ATG GAG ATG GCT GGG GGC GGG CCG CTG CAC 528 Glu Ala Leu Met Leu Val Met Glu Met Ala Gly Gly Gly Pro Leu His 165 170 175 AAG TTC CTG GTC GGC AAG AGG GAG GAG ATC CCT GTG AGC AAT GTG GCC 576 Lys Phe Leu Val Gly Lys Arg Glu Glu Ile Pro Val Ser Asn Val Ala 180 185 190 GAG CTG CTG CAC CAG GTG TCC ATG GGG ATG AAG TAC CTG GAG GAG AAG 624 Glu Leu Leu His Gln Val Ser Met Gly Met Lys Tyr Leu Glu Glu Lys 195 200 205 AAC TTT GTG CAC CGT GAC CTG GCG GCC CGC AAC GTC CTG CTG GTT AAC 672 Asn Phe Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Leu Val Asn 210 215 220 CGG CAC TAC GCC AAG ATC AGC GAC TTT GGC CTC TCC AAA GCA CTG GGT 720 Arg His Tyr Ala Lys Ile Ser Asp Phe Gly Leu Ser Lys Ala Leu Gly 225 230 235 240 GCC GAC GAC AGC TAC TAC ACT GCC CGC TCA GCA GGG AAG TGG CCG CTC 768 Ala Asp Asp Ser Tyr Tyr Thr Ala Arg Ser Ala Gly Lys Trp Pro Leu 245 250 255 AAG TGG TAC GCA CCC GAA TGC ATC AAC TTC CGC AAG TTC TCC AGC CGC 816 Lys Trp Tyr Ala Pro Glu Cys Ile Asn Phe Arg Lys Phe Ser Ser Arg 260 265 270 AGC GAT GTC TGG AGC TAT GGG GTC ACC ATG TGG GAG GCC TTG TCC TAC 864 Ser Asp Val Trp Ser Tyr Gly Val Thr Met Trp Glu Ala Leu Ser Tyr 275 280 285 GGC CAG AAG CCC TAC AAG AAG ATG AAA GGG CCG GAG GTC ATG GCC TTC 912 Gly Gln Lys Pro Tyr Lys Lys Met Lys Gly Pro Glu Val Met Ala Phe 290 295 300 ATC GAG CAG GGC AAG CGG ATG GAG TGC CCA CCA GAG TGT CCA CCC GAA 960 Ile Glu Gln Gly Lys Arg Met Glu Cys Pro Pro Glu Cys Pro Pro Glu 305 310 315 320 CTG TAC GCA CTC ATG AGT GAC TGC TGG ATC TAC AAG TGG GAG GAT CGC 1008 Leu Tyr Ala Leu Met Ser Asp Cys Trp Ile Tyr Lys Trp Glu Asp Arg 325 330 335 CCC GAC TTC CTG ACC GTG GAG CAG CGC ATG CGA GCC TGT TAC TAC AGC 1056 Pro Asp Phe Leu Thr Val Glu Gln Arg Met Arg Ala Cys Tyr Tyr Ser 340 345 350 CTG GCC AGC AAG GTG GAA GGG CCC CCA GGC AGC ACA CAG AAG GCT GAG 1104 Leu Ala Ser Lys Val Glu Gly Pro Pro Gly Ser Thr Gln Lys Ala Glu 355 360 365 GCT GCC TGT GCC TGA 1119 Ala Ala Cys Ala 370

SEQ ID NO: 3 Sequence length: 856 Sequence type: amino acid Topology: linear Sequence type: protein Sequence: Met Ser Phe Pro Cys Lys Phe Val Ala Ser Phe Leu Leu Ile Phe Asn 1 5 10 15 Val Ser Ser Lys Gly Ala Val Ser Lys Glu Ile Thr Asn Ala Leu Glu 20 25 30 Thr Trp Gly Ala Leu Gly Gln Asp Ile Asn Leu Asp Ile Pro Ser Phe 35 40 45 Gln Met Ser Asp Asp Ile Asp Asp Ile Lys Trp Glu Lys Thr Ser Asp 50 55 60 Lys Lys Lys Ile Ala Gln Phe Arg Lys Glu Lys Glu Thr Phe Lys Glu 65 70 75 80 Lys Asp Thr Tyr Lys Leu Phe Lys Asn Gly Thr Leu Lys Ile Lys His 85 90 95 Leu Lys Thr Asp Asp Gln Asp Ile Tyr Lys Val Ser Ile Tyr Asp Thr 100 105 110 Lys Gly Lys Asn Val Leu Glu Lys Ile Phe Asp Leu Lys Ile Gln Glu 115 120 125 Arg Val Ser Lys Pro Lys Ile Ser Trp Thr Cys Ile Asn Thr Thr Leu 130 135 140 Thr Cys Glu Val Met Asn Gly Thr Asp Pro Glu Leu Asn Leu Tyr Gln 145 150 155 160 Asp Gly Lys His Leu Lys Leu Ser Gln Arg Val Ile Thr His Lys Trp 165 170 175 Thr Thr S er Leu Ser Ala Lys Phe Lys Cys Thr Ala Gly Asn Lys Val 180 185 190 Ser Lys Glu Ser Ser Val Glu Pro Val Ser Cys Pro Glu Lys Gly Leu 195 200 205 Asp Ile Tyr Leu Ile Ile Gly Ile Cys Gly Gly Gly Ser Leu Leu Met 210 215 220 Val Phe Val Ala Leu Leu Val Phe Tyr Ile Thr Lys Arg Lys Pro Asp 225 230 235 240 Pro Ala Ala His Leu Pro Phe Phe Tyr Gly Ser Ile Ser Arg Ala Glu 245 250 255 Ala Glu Glu His Leu Lys Leu Ala Gly Met Ala Asp Gly Leu Phe Leu 260 265 270 Leu Arg Gln Cys Leu Arg Ser Leu Gly Gly Tyr Val Leu Ser Leu Val 275 280 285 His Asp Val Arg Phe His His Phe Pro Ile Glu Arg Gln Leu Asn Gly 290 295 300 Thr Tyr Ala Ile Ala Gly Gly Lys Ala His Cys Gly Pro Ala Glu Leu 305 310 315 320 Cys Glu Phe Tyr Ser Arg Asp Pro Asp Gly Leu Pro Cys Asn Leu Arg 325 330 335 Lys Pro Cys Asn Arg Pro Ser Gly Leu Glu Pro Gln Pro Gly Val Phe 340 345 350 Asp Cys Leu Arg Asp Ala Met Val Arg Asp Tyr Val Arg Gln Thr Trp 355 360 365 Lys Leu Glu Gly Glu Ala Leu Glu Gln Ala Ile Ile Ser Gln Ala Pro 370 375 380 380 Gln Val GluLys Leu Ile Ala Thr Thr Ala His Glu Arg Met Pro Trp 385 390 395 400 Tyr His Ser Ser Leu Thr Arg Glu Glu Ala Glu Arg Lys Leu Tyr Ser 405 410 415 Gly Ala Gln Thr Asp Gly Lys Phe Leu Leu Arg Pro Arg Lys Glu Gln 420 425 430 Gly Thr Tyr Ala Leu Ser Leu Ile Tyr Gly Lys Thr Val Tyr His Tyr 435 440 445 Leu Ile Ser Gln Asp Lys Ala Gly Lys Tyr Cys Ile Pro Glu Gly Thr 450 455 460 Lys Phe Asp Thr Leu Trp Gln Leu Val Glu Tyr Leu Lys Leu Lys Ala 465 470 475 480 480 Asp Gly Leu Ile Tyr Cys Leu Lys Glu Ala Cys Pro Asn Ser Ser Ala 485 490 495 Ser Asn Ala Ser Gly Ala Ala Ala Pro Thr Leu Pro Ala His Pro Ser 500 505 510 Thr Leu Thr His Pro Gln Arg Arg Ile Asp Thr Leu Asn Ser Asp Gly 515 520 525 Tyr Thr Pro Glu Pro Ala Arg Ile Thr Ser Pro Asp Lys Pro Arg Pro 530 535 540 Met Pro Met Asp Thr Ser Val Tyr Glu Ser Pro Tyr Ser Asp Pro Glu 545 550 555 560 Glu Leu Lys Asp Lys Lys Leu Phe Leu Lys Arg Asp Asn Leu Leu Ile 565 570 575 Ala Asp Ile Glu Leu Gly Cys Gly Asn Phe Gly Ser Val Arg Gln Gly 580 585 585 590 Val Tyr ArgMet Arg Lys Lys Gln Ile Asp Val Ala Ile Lys Val Leu 595 600 605 Lys Gln Gly Thr Glu Lys Ala Asp Thr Glu Glu Met Met Arg Glu Ala 610 615 620 620 Gln Ile Met His Gln Leu Asp Asn Pro Tyr Ile Val Arg Leu Ile Gly 625 630 635 640 Val Cys Gln Ala Glu Ala Leu Met Leu Val Met Glu Met Ala Gly Gly 645 650 655 Gly Pro Leu His Lys Phe Leu Val Gly Lys Arg Glu Glu Ile Pro Val 660 665 670 Ser Asn Val Ala Glu Leu Leu Leu His Gln Val Ser Met Gly Met Lys Tyr 675 680 685 Leu Glu Glu Lys Asn Phe Val His Arg Asp Leu Ala Ala Arg Asn Val 690 695 700 Leu Leu Val Asn Arg His Tyr Ala Lys Ile Ser Asp Phe Gly Leu Ser 705 710 715 720 Lys Ala Leu Gly Ala Asp Asp Ser Tyr Tyr Thr Ala Arg Ser Ala Gly 725 730 735 Lys Trp Pro Leu Lys Trp Tyr Ala Pro Glu Cys Ile Asn Phe Arg Lys 740 745 750 Phe Ser Ser Arg Ser Asp Val Trp Ser Tyr Gly Val Thr Met Trp Glu 755 760 765 Ala Leu Ser Tyr Gly Gln Lys Pro Tyr Lys Lys Met Lys Gly Pro Glu 770 775 780 Val Met Ala Phe Ile Glu Gln Gly Lys Arg Met Glu Cys Pro Pro Glu 785 790 795 800 Cys Pro Pro Glu Leu Tyr Ala Leu Met Ser Asp Cys Trp Ile Tyr Lys 805 810 815 Trp Glu Asp Arg Pro Asp Phe Leu Thr Val Glu Gln Arg Met Arg Ala 820 825 830 Cys Tyr Tyr Ser Leu Ala Ser Lys Val Glu Gly Pro Pro Gly Ser Thr 835 840 845 Gln Lys Ala Glu Ala Ala Cys Ala 850 855

SEQ ID NO: 4 Sequence length: 372 Sequence type: amino acid Topology: linear Sequence type: protein Sequence: Met Gly Ser Ser Lys Ser Lys Pro Lys Asp Pro Ser Gln Arg Gly Ser 1 5 10 15 Gly Ala Ala Ala Pro Thr Leu Pro Ala His Pro Ser Thr Leu Thr His 20 25 30 Pro Gln Arg Arg Ile Asp Thr Leu Asn Ser Asp Gly Tyr Thr Pro Glu 35 40 45 Pro Ala Arg Ile Thr Ser Pro Asp Lys Pro Arg Pro Met Pro Met Asp 50 55 60 Thr Ser Val Tyr Glu Ser Pro Tyr Ser Asp Pro Glu Glu Leu Lys Asp 65 70 75 80 Lys Lys Leu Phe Leu Lys Arg Asp Asn Leu Leu Ile Ala Asp Ile Glu 85 90 95 Leu Gly Cys Gly Asn Phe Gly Ser Val Arg Gln Gly Val Tyr Arg Met 100 105 110 Arg Lys Lys Gln Ile Asp Val Ala Ile Lys Val Leu Lys Gln Gly Thr 115 120 125 Glu Lys Ala Asp Thr Glu Glu Met Met Arg Glu Ala Gln Ile Met His 130 135 140 Gln Leu Asp Asn Pro Tyr Ile Val Arg Leu Ile Gly Val Cys Gln Ala 145 150 155 160 Glu Ala Leu Met Leu Val Met Glu Met Ala Gly Gly Gly Gly Pro Leu His 165 170 175 Lys Phe L eu Val Gly Lys Arg Glu Glu Ile Pro Val Ser Asn Val Ala 180 185 190 Glu Leu Leu His Gln Val Ser Met Gly Met Lys Tyr Leu Glu Glu Lys 195 200 205 Asn Phe Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Leu Val Asn 210 215 220 Arg His Tyr Ala Lys Ile Ser Asp Phe Gly Leu Ser Lys Ala Leu Gly 225 230 235 240 Ala Asp Asp Ser Tyr Tyr Thr Ala Arg Ser Ala Gly Lys Trp Pro Leu 245 250 255 Lys Trp Tyr Ala Pro Glu Cys Ile Asn Phe Arg Lys Phe Ser Ser Arg 260 265 270 Ser Asp Val Trp Ser Tyr Gly Val Thr Met Trp Glu Ala Leu Ser Tyr 275 280 285 Gly Gln Lys Pro Tyr Lys Lys Met Lys Gly Pro Glu Val Met Ala Phe 290 295 300 Ile Glu Gln Gly Lys Arg Met Glu Cys Pro Pro Glu Cys Pro Pro Glu 305 310 315 320 Leu Tyr Ala Leu Met Ser Asp Cys Trp Ile Tyr Lys Trp Glu Asp Arg 325 330 335 Pro Asp Phe Leu Thr Val Glu Gln Arg Met Arg Ala Cys Tyr Tyr Ser 340 345 350 Leu Ala Ser Lys Val Glu Gly Pro Pro Gly Ser Thr Gln Lys Ala Glu 355 360 365 Ala Ala Cys Ala 370

SEQ ID NO: 5 Sequence length: 79 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: TATGTGGAGG AGGCAGCCTC TTGATGGTCT TTGTGGCACT GCTCGTTTTC TATATCACCA 60 AAAGGAAACC AGACCCCGC 79

SEQ ID NO: 6 Sequence length: 75 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: GGGGTCTGGT TTCCTTTTGG TTCCTTTTGG TGATATAGAA AACGAGCAGT GCCACAAAGA CCATCAAGAG 60 GCTGCCTCCT CCACA 75

SEQ ID NO: 7 Sequence length: 75 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids (synthetic DNA) Sequence: ACGTCCCCAG GTTTCGGGAG GCCCAGGGGC GATGGGGAGT AGCAAGAGCA GCCTAAGGAC 60 CCCAGCCAGC GCGGG 75

SEQ ID NO: 8 Sequence length: 24 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: ACCTGGCGGC CCGCAACGTC CTGCT 24

SEQ ID NO: 9 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: TGAGCGGGCA GTGTAGAAGC TGTCG 25

SEQ ID NO: 10 Sequence length: 25 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence: CGACAGCTTC TACACTGCCC GCTCA 25

SEQ ID NO: 11 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: CTGGCCGTAG GACAAGGCCT CCCAC 25

SEQ ID NO: 12 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: TGAGCGGGCA GTGAAGTAGC TGTCG 25

SEQ ID NO: 13 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids (synthetic DNA) Sequence: CGACAGCTAC TTCACTGCCC GCTCA 25

[Brief description of the drawings]

FIG. 1 is a schematic diagram for constructing the DNA of the present invention.

FIG. 2 is a schematic diagram for constructing the DNA of the present invention.

FIG. 3 is a schematic diagram showing the DNA of the present invention.

FIG. 4 is a diagram showing luciferase activity of cells into which the DNA of the present invention has been introduced.

FIG. 5 is a diagram showing luciferase activity of cells into which the DNA of the present invention has been introduced.

FIG. 6 is an electrophoretic photograph showing the results of Western blot.

FIG. 7 is a diagram showing luciferase activity of cells into which the DNA of the present invention has been introduced.

Continuation of the front page (56) References Experimental Medicine, 11 [19] (1993) p. 2511-2516 Experimental Medicine, 11 [13] (1993) p. 1745-1747 Molecular And Cellular Biology, 11 [9] (1991) p. 4760-4770, The Journal of Biological Chemistry, 268 [26] (1993) p. 19797-19801 Cell, 71 [4] (1992) p. 649-662 Cell, 32 [3] (1983) p. 881 -890 (58) Fields investigated (Int. Cl. ⁷ , DB name) C12N 15/00-15/90 GenBank / EMBL / DDBJ SwissProt / PIR MEDLINE (STN) JICST file (JOIS) BIOSIS (DIALOG) WPI ( DIALOG)

Claims (10)

(57) [Claims] Claims 1. A DNA encoding a protein which comprises an amino acid sequence represented by SEQ ID NO: 3 or 4 or a sequence in which one or several amino acids have been deleted, substituted or added in said amino acid sequence, and which has immunostimulatory activity. . 2. The DNA according to claim 1, wherein the protein is a membrane-localized protein tyrosine kinase. 3. The method of claim 1, wherein the protein tyrosine kinase is ZAP-
The DNA according to claim 2, which is 70. 4. The DNA according to claim 1, wherein the DNA is represented by SEQ ID NO: 1 or 2. 5. The D according to claim 1, wherein
A recombinant vector containing NA. 6. A transformed cell transformed with the recombinant vector according to claim 5. 7. The transformed cell according to claim 6, wherein the cell is a T cell, B cell, NK cell, mast cell, or neutrophil. 8. D according to any one of claims 1 to 4,
A method for activating immunocompetent cells, comprising introducing NA into immunocompetent cells in vitro . 9. The immunocompetent cell is a T cell, B cell, NK
9. The activation method according to claim 8, which is a cell, a mast cell, or a neutrophil. 10. An immunostimulator comprising the transformed cell according to claim 6.