JPH04506460A - C4 binding protein fusion protein - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] 18. The host according to claim 17, wherein the host is a CO3-7 cell or a CHO cell. Unicellular host.

19, the host is pJOD, 5CD4. Transformed using Y187.5CR4 18. The unicellular host according to claim 17, wherein

20, a C4bp fusion polypeptide comprising a functional moiety and a C4bp monomer.

21. The C4bp monomer has 8 SCRs and is located at positions +1 to +549 in Figure 1. C4bp monomer containing 5 SCRs from position +188 in Figure 1 to + C4bp monomer containing amino acid at position 549, has 4 SCRs and +248 in Figure 1 C4bp monomer containing amino acids from position +549, has 3 SCRs, and is shown in Figure 1. C4bp monomer containing amino acids from positions +314 to +549, and one SC From a C4bp monomer containing R and amino acids from position +433 to +549 in Figure 1 21. The C4bp fusion polypeptide of claim 20, selected from the group consisting of:

22. The functional moiety may be a target molecule, an enzyme, an enzyme inhibitor, an enzyme substrate, or a cytokine. Viral receptors that bind to viruses, growth factors, colony stimulating factors, hormones and toxins. receptors, cellular receptors, cellular ligands, bacterial immunogens, parasite immunity an immunogen, a viral immunogen, an immunoglobulin or a fragment thereof. 21. The C4bp fusion polypeptide of claim 20.

23. C according to claim 22, wherein the functional moiety is a soluble CD4 protein. 4bp fusion polypeptide.

24, Soluble CD4 proteins include CD4 (111), CD4 (181), C D4 (183), CD4 (187)-C4bp (SCR5), CD4 ( 187)-C4bp (SCR3) and CD4 (375) 24. The C4bp fusion polypeptide of claim 23, wherein the C4bp fusion polypeptide is selected.

25, the former Kimihi polypeptide is CD4 (187)-C4bp (S CR8), CD4 (187)-C4bp (SCR5), CD4 (187)-C4bp (SCR4), CD4 (187)-C4bp (SCR3) and CD4 ( 187)-C4bp (SCRI). C4bp fusion polypeptide.

26. The functional portion is a polypeptide of a virus expressing hepatitis B virus e antigenicity. 23. The C4gbp fusion polypeptide of claim 22, wherein the C4gbp fusion polypeptide is a polypeptide.

27, the polypeptide is HBeAg (2-89)-CAM (SCR8) , HBeAg (2-100) -C4bp (SCR8), HBeAg (2-1 38) -C4bp (SCR8) and HBeAg (2-148) -C4b C4bp fusion according to claim 26, selected from the group consisting of p (SCR8) polypeptide.

28, the functional part is I CAMI, ELAMI, VCAMI or VCA A cellular receptor or cell selected from the group consisting of Mlb, and LFA3 23. The C4bp fusion polypeptide of claim 22, which is a ligand for.

29, the functional moiety is hirudin, the C-terminal polypeptide of hirudin, and hirudin 23. The C4bp fusion polypeptide of claim 22, selected from the group consisting of .

30, the C-terminus of the polypeptide moiety is fused to the N-terminus of the C4bp monomer. 21. The C4bp fusion polypeptide of claim 20.

31. The functional moiety is a toxin, an antiretroviral agent, an enzyme substrate, and an enzyme inhibitor. 21. The c4bp fusion polypeptide of claim 20, wherein the c4bp fusion polypeptide is selected from the group consisting of:

32. The C4bp fusion polype of claim 31, wherein the functional moiety is AZT. Petite.

33. The functional moiety is an enzyme, a radionuclide, a fluorescent marker, and a chemiluminescent 21. A reporter group according to claim 20, comprising a reporter group selected from the group consisting of: C4bp fusion polypeptide.

34, multimeric C4bp fusion protein.

35. Claim that the protein is a multimeric CD4-C4bp fusion protein. The fusion protein according to item 34.

36, the protein is a CD4 (187)-C4bp (SCR4) fusion protein 36. The fusion protein of claim 35, which is a protein.

37, the protein is a multimeric HBeAg-C4bp fusion protein; A fusion protein according to claim 34.

38, the protein is ELAMI-C4bp fusion protein, VCAMI- C4bp fusion protein, VCAMIb-C4bp fusion protein and ICA 35. The protein according to claim 34, selected from the group consisting of MI-C4bp fusion proteins. fusion protein.

39, the protein is hirudin C4bp fusion protein, hirudin C-terminal poly from the peptide C4bp fusion protein, and the Hirulog C4b fusion protein. 35. The fusion protein of claim 34, selected from the group consisting of:

40, encoding a C4bp fusion polypeptide operably linked to an expression control sequence. Transforming a unicellular host with a recombinant DNA molecule containing a DNA sequence that A method for producing a C4bp fusion poly, comprising the steps of:

41, heteromultimeric C4bp fusion protein.

42, the fusion protein has a viral receptor, a cellular receptor and a first functional moiety selected from the group consisting of a cell glue and a toxin; a second functional moiety selected from the group consisting of anti-trovirus agents. The heteromultimeric C4bp fusion protein described in 41.

43. Claim 4, wherein the fusion protein comprises a recognition molecule and a reporter molecule. 1. The heteromultimeric C4bp fusion protein according to 1.

44, the first functional moiety is soluble CD4, and the second functional moiety is A 42. The heteromultimeric C4bp fusion protein of claim 41, which is ZT.

45. Claim 41, wherein said fusion protein comprises at least two different immunogens. The heteromultimeric C4bp fusion protein described in .

46, comprising the step of transforming a unicellular host with the recombinant DNA molecule of claim 12. A method for producing a multimeric C4bp fusion protein.

47, the multimeric CD4-C4bp fusion protein of claim 35 or the multimeric CD4-C4bp fusion protein of claim 42. administering to a patient a therapeutically effective amount of a heteromultimeric CD4-(4bp fusion protein); AIDS, ARC, HIV infection or) (antibodies against IV How to treat patients with

48, the fusion protein contains CD4 (187)-c4bp (SCR4), 48. The method of claim 47.

49, the heteromultimeric CD4-C4bp fusion protein is a fusion protein according to claim 44. 48. The method of claim 47, which is a synthetic protein.

50, contacting the sample with the heteromultimeric C4bp fusion protein of claim 43. A method for confirming the presence of a target molecule in a sample.

51. An effective amount of the heteromultimeric C4bp fusion protein according to claim 41 is administered to a patient. A method for determining the presence of a target molecule in vivo, the method comprising the step of administering to a target molecule.

52, a retrovirus containing a DNA sequence encoding a c4bp fusion polypeptide. A method for treating human diseases, which includes the step of infecting human somatic cells using a virus. .

53. Claim wherein said DNA sequence is characterized by a CD4-C4bp fusion polypeptide. 52.

54, recombinant human C4 binding protein.

55, including the DNA sequence from nucleotide position 4 to nucleotide position 1743 in Figure 1 using a recombinant DNA molecule containing an expression control sequence operably linked to a DNA sequence. production of recombinant C4-binding protein, comprising the step of transforming a unicellular host. Construction method.

56, a recombinant DNA sequence encoding a non-human C4bp fusion polypeptide DNA molecule.

57. The recombinant according to claim 56, wherein the non-human is a mouse or a guinea pig. DNA molecule.

58. According to claim 56, said DNA sequence is a non-human C4bp fusion polypeptide. A unicellular host transformed with the described recombinant DNA molecule.

59. The single cell according to claim 58, wherein the non-human is a mouse or a guinea pig. host.

60, a functional portion and a non-human C4bp fusion polypeptide comprising a non-human C4bp monomer. peptide.

61. C4b according to claim 60, wherein the non-human is a mouse or a guinea pig. p fusion polypeptide.

62, multimeric non-human) C4bp fusion protein.

63. The multimer according to claim 62, wherein the non-human is a mouse or a guinea pig. non-human C4bp fusion protein.

64, heteromultimeric non-human C4bp fusion protein.

65. The heterozygote according to claim 64, wherein the non-human is a mouse or a guinea pig. Multimeric non-human C4bp fusion protein.

66. Transforming a unicellular organism using the recombinant DNA molecule of claim 56. A method for producing a non-human C4 binding protein, comprising the steps of:

67. The method of claim 66, wherein the non-human is a guinea pig or mouse.

Specification Fusion protein of C4A protein Oitomo 11u Hungry Field The present invention provides multimeric and heteromultimeric fusions with 04-binding protein (C4bp). It relates to proteins, their compositions and methods of using them. For more details, The present invention relates to a large amount of C4bp that is an aggregation or assembly of C4bp monomers linked to a functional moiety. The present invention relates to body C4bp fusion proteins. The invention also provides C4bp fusion polypeptides, In particular, it relates to CD4-C4bp fusion polypeptides. Here CD4-C4bp fusion The polypeptide is preferably a C4bp polypeptide with four short consensus repeat regions. Contains the amino acid sequence of soluble human CD4 protein fused to a monomer.

Good luck! look In rapidly advancing biotechnology, researchers are developing drugs, vaccines, and diagnostics. Creates an excellent transport and carrier system for drug withdrawal and other bioactive molecules ing. Optimally, these systems enhance the molecular properties of the system and eliminate defects. Complement existing properties and combine useful properties of different molecules. especially Of interest to researchers is the serum half-life of bioactive molecules and their target particles. affinity for cells and cells, ability to target biologically active molecules, biological activity, immunogenicity and possibility of co-administration or delivery of these molecules.

Human C4-binding protein (hC4bp) is a multifunctional transport carrier for biologically active molecules. It has some interesting characteristics. Human C4bp is involved in the human complement system. Supplementary The system is a group of proteins that belong to the immune system, and its functions include the lysis of invading cells and the activation of phagocytes. including promoting sexualization and removal of foreign substances from the system. hC4bp is a protein in the complement system , in particular controls the action of the C4 protein. Structurally, hC4bp is flexible and disulfide. molecule with a long serum half-life and biologically active molecules. It is estimated that it has the ability to target nodes. hC4bp in serum has a molecular weight of approximately 590k. It is D. In SDS gel under reducing conditions, hC4bp forms a strong band at approximately 70 kD. , suggesting that it is a disulfide-linked multimeric protein.

Under electron microscopy, human C4bp is a structure with seven monomeric tentacles [B, Dahlback et al. -Visualization of Human C 4b-Binding Protein and Its Complex s with Vitaa+in K-Dependent Protein S and Complea+ent Protein C4b-, Proc, Natl, Acad, Sci, USA, 80. pp, 3461 -65 (1983>).Researchers call this structure of human C4bp spider-like. However, the flexibility of hC4bp's tentacle structure makes this protein octopus-like. Ru. In solution X-ray dispersion experiments, the tentacles of hC4bp do not spread in certain environments, and the molecules It has been proposed that [S, J, Pe rkins et al., “Unusual Ultrastructure of C o+oplement-Coa+ponent-C4b-Binding Pr otein of Human Co+aplement by 5ynchr oton X-Ray Scattering and Hydrodynam ic Analysis-.

Btochemj,, 233. pp. 799-807 (1986)].

The cDNA encoding monomeric C4bp has been cloned and characterized [ L, P, Chung et al. -Molecular Cloning and Characterization of the cDNA Coding for C4b-Binding Proteinof the C1ass ical Pathway of the Human Complement System-, Biochem, 230. pp, 133-41 (19 85) 1゜Chung et al. I'm doing it. The molecular weight of the polypeptide estimated from the DNA sequence was determined by reducing SDS. It is approximately 61.5 kD rather than the 70 kD observed in the gel. The difference in molecular weight is obvious This is due to the fact that sugar chains are attached to the serotype polypeptide.

The first 491 amino acids from the N-terminus of the sequence by Chung et al. Can be divided. They each consist of about 60 amino acids and are short consensus anti-amino acids. called recovery regions (SCRs).

These regions, from N-terminus to C-terminus, are called 5CR8 to 5CRI. SCR The domain is defined in the amino acid sequence of Figure 1 of this application as follows: 5CR8-+ 1 to +61: SCR? -+62 to +123: 5CR6-4124 to + 187: 5CR5-+188 to +247; 5CR4-+248 to +31 3.5CR3-+314 to +374; 5CR2-+375 to:+432: 5CRI-+433 to +491° These domains have significant sequence homology each has a cysteine residue in a similar position. These systems The phosphorus residues form disulfide bonds regularly within the region. [J, Janat ova et al., “Disulfide Bonds Are Localized WHhin the 5hort Con5ensus Repeat Un its of Co+gple+aent Regulation Protect ins:C4b-Binding Protein”, B[oche+o,, 28. pp.

4754-61 (1989)], within each SCR domain, the first cysteine The residue is bonded to the third, and the second cysteine residue is bonded to the fourth, forming a double loop. form the amino acid sequence of the sample. Therefore, SCRs are connected like beads on a string. It is. The pattern of disulfide bonds within this region is due to the structural flexibility of the C4bp monomer. It is the cause of softness.

In addition to the 8 SCR domains, hC4bp also contains 58 amino acids at the C-terminus. It has a C4bp core consisting of sequences that show homology to other parts of the protein. does not have. This site is what causes molecules to aggregate and form multimers. to a certain model According to this, cysteine at position +498 in one C4bp monomer is at position +5 in another monomer. Forms a disulfide bond with cysteine at position 10.

In addition to the seven C4bp monomers, human C4bp contains 4Sk as another subunit. D polypeptide, which is bound to the core of the C4bp heptamer by a disulfide bond. [A, old 11arp and B, Dahlback, -Novel] 5ubunit in C4b-Binding Protein Requi red for Protein S Binding-, J, Biol, Che m,, 263. pp, 12759-64 (1988)]. This subunit binds to protein S, a protein involved in the control of blood coagulation. Ta When protease C binds to protein S, protease C separates the active form of coagulation factor ■ and V. Catalyzes conversion to inactive form.

C4bp is also present in non-human mammals. Both mice and guinea pigs [S, J. Lintin et al., “Derivation of the 5equence or the Signal Pepti de in Human C4b-protein and Interspe cies Cross-hybridization of the C4bp c DNA 5equence', FEBS Letters, 232. pp , 32g-332 (1988)]. Analysis of mouse C4bp compared with human C4bp. Similarly, it is shown to have consecutive SCI+. However, The murine C4bp has only 6 SCRLs within each C4bp monomer, and the multimers are non- connected to each other by chemical bonds.

At present, the structural characteristics of C4bp have not been determined to be useful for the delivery of therapeutic or prophylactic drugs in vivo. Not used for shipping. Despite advances in biotechnology, drugs, properties and transport of molecules, diagnostics and bioactive molecules, including multivalent, single target particles. including affinity for offspring, serum half-life, biological activity and, in some cases, immunogenicity. There remains a need for methods and products that optimize the process.

Ryogoji! 1 The present invention provides multimeric and petromultimeric C4bp fusion proteins. and solve these problems. Multimeric C4bp fusion proteins can be used in drugs, vaccines, etc. C4 linked to a functional moiety, which may be a drug, diagnostic agent, or other biologically active molecule. It is an aggregate or complex of bp monomers. petero multimeric C4bp fusion protein The quality depends on the combination of different C4bp monomers, the combination of interesting functional parts, and Or have a combination of both. The present invention also relates to non-human multimers and heterogeneous Multimeric C4bp fusion proteins are provided. The C4bp fusion polypeptide It includes monomeric C4bp fused or chemically linked to a functional moiety.

In particular, the present invention provides a fusion polypeptide CD4(187)-C4bp (SCR4). provide The present invention also provides multimeric C4 fusion polypeptides containing monomeric C4bp fusion polypeptides. bp fusion protein. And the present invention further provides C4bp fusion polypeptides. DNA sequences encoding codes, recombinant DNA molecules containing those sequences, and and unicellular host cells transformed with these molecules. The present invention also provides Provides a famous method for transparentizing these fusion polypeptides by culturing hosts. . The present invention can also be used as a therapeutic, prophylactic or diagnostic agent, particularly for AIDS, ARC, etc. and C4bp fusion polypeptides useful for the diagnosis, prevention and treatment of old V infections. The present invention provides a composition comprising a compound or a protein.

The fusion proteins of the present invention are characterized by their multimeric nature, large size, tentacle flexibility, and Advantageously, various properties of hC4bp can be exploited, including its ability to migrate through lymph nodes. Ru. Therefore, in such fusion proteins, monomeric C4bp is used as the functional part. The biologically active molecule attached to is characterized by one or more of the following: properties: multivalent, long serum half-life, high affinity for target particles or cells, strong bioactivity. activity or immunogenicity and targeting ability.

Multimeric and heteromultimeric C4bp fusions according to the invention can be achieved by selection of functional moieties. Synthetic proteins have many uses. Antigen binding part of antibody, receptor of virus Alternatively, a recognition molecule containing a cellular receptor may be able to recognize a C4bp fusion protein from a specific antigen. It is useful as a functional moiety for targeting proteins. In this way, target multimeric C4bp fusion protein blocks virus binding to cells It is useful to prevent virus infections. C4bp fusion protein It is also used to suppress intercellular junctions, which are a hallmark of pathological inflammation. of the present invention The multivalent nature and structural flexibility of fusion proteins allows them to be monovalent or rigid. It is believed that this compound has a stronger affinity for the target than multivalent molecules. In one embodiment of the invention The functional part is CD4, a receptor on human lymphocytes. This is AID It is a target of the old V virus that is the causative agent of S and ARC.

In the heteromultimeric C4bp fusion protein according to the present invention, the recognition molecule is a toxin, an antireactive When used in conjunction with toroviral drugs or radionuclides, these proteins Quality becomes a therapeutic agent that seeks out and destroys its target. C4bp fusion with recognition molecule Proteins are also useful for enhancing the sensitivity of diagnostic assays. They are large Since it is a mercury molecule, many of the bonding parts are labeled with horseradish peroxidase. Present on a reporter molecule such as an antibody. On the one hand, they are target recognition molecules and and multiple reporter groups.

The functional portion of the C4bp fusion protein is an immunogen of one or more pathogens. When , the proteins of the invention are useful in vaccines. In addition, the functional part When it comes to enzymes, substrates, or inhibitors, multimeric C4bp fusion proteins are more bioactive. It functions as a highly active drug.

The present invention also provides recombinant C4bp and methods for producing the protein. .

Plates ffi lice limbs Figure IA-IC shows pJOD, C4bp, 3. human C4bp polypeptide derived from I) represents the NA sequence and deduced amino acid sequence. Amino acids with negative numbers corresponds to a signal sequence, which is not present in the mature polypeptide. Through this application Therefore, the reference to C4bp regarding the amino acid sequence is equivalent to that shown in this figure. corresponds to that of

Figure 2 represents the structure of the SCR domain. The figure shows a short electrical outlet connected to an adjacent SCR. The amino acid sequence of the SUS repeat site (SCI?) is drawn. Each amino acid is a circle It is shown. As described below, each SCR consists of cysteine 1 and cysteine 3 and two disulfide bonds between cysteine 2 and cysteine 4 are connected as shown in this figure.

The loop is an amino acid sequence between cysteine 1 and cysteine 4 contained within it. expressed. A junction is an amino acid sequence between two connected loops. shown.

Figures 3A-3B show the nucleotide sequence and predicted amino acids of human CD4 protein. represents a noic acid sequence. Nucleotide positions 1 to 636 are pJOD, 5CD4. Y 187.5naBl. Nucleotide positions 637 to 1377 are p17 Derived from 0.2. In this diagram, amino acids are numbered from position 125 to position 375. ing. Throughout this application, when referring to CD4 by its amino acid sequence, , corresponds to the equivalent of this figure, unless otherwise indicated.

Figure 4 depicts the domain structure of human CD4 protein. Amino acids indicated by numbers are , cysteine residues involved in disulfide bonds, according to Figure 3A-38.

Figure 5A-58+t:t! J　cov　-C4bp, 1 to C4bp, 20. SCR, 1, SCR, 4° SCR, 8, 312, 20, 312, 21, 312 , 35 and 312.36. 5° from left to right for all alignments It is defined as 3° from

Figure 6A-6 Hit block 5 x mi)’pJOD, c4bp and pJOD, 5C D4. Y,! It represents the construction of 87°5 nail.

Figure 7 contains a sequence encoding a CD4-C4bp fusion polypeptide according to the invention. represents the construction of a plasmid. r　CD4-C4bp fusion polypeptide'' is human Contains the amino acid sequence of CD4 protein and C4bp. The top strand is , adenovirus major late promoter (AdMLP); 5' untranslated sequence 5°UTS); site encoding the ATG start codon and signal sequence; The human CD4 protein encodes up to the tyrosine codon (TAC (1g?>) Site: 5na81 site (TACGTA); II 1 site (AGATCT ); and represents the SV40 boriatenylation control sequence. The bottom strand is 5CR 8-SCRI core and the site that harbors the stop codon and the port of the MIS gene. pJOD, which contains the rearenylation control sequence, represents C4bp.

Figure 8 shows recombinant human C4bp (rhC4bp) and serotype human C4bp ( The results of purification of serum (serum) by HPLC are shown.

FIG. 9 shows embodiments of C4bp fusion polypeptides and proteins according to the invention. Illustrated.

Figure 10 shows the antibodies used in ELISA assays 1-9 as described in this document. This is a table that summarizes the body.

Ryomakoi 1 Nezukou Eyu In order that the invention described herein may be more fully understood, a detailed description is provided below. .

The following terminology is used in this description: rC4-binding protein J (rC4b pJ) has the amino acid sequence from position 132 to position +549 shown in Figure 1. Refers to polypeptide. Expression of a polypeptide often involves truncating a signal sequence. Including post-translational modifications such as removal, intramolecular disulfide bonds, glycosylation, etc. should be understood. Therefore, the term c4 protein also includes such It also refers to the modified amino acid sequence of C4bp. It is also a naturally occurring It also includes genetic polymorphisms. The term also refers to natural, recombinant, or synthetic Contains C4-binding protein.

“Multimeric C4bp fusion protein” and “Heteromultimeric C4bp fusion protein” Each term "substance" includes an aggregate or collection of C4bp polypeptides. rC "4bp fusion polypeptide" includes a C4bp monomer attached to a functional moiety. Ru. "Functional moiety" means a polypeptide ("polypeptide moiety") or a compound ( ``chemical moieties''). Multimeric C4bp fusion proteins are genetic fusions, chemical It can be manufactured by synthesis or chemical bonding techniques.

Genetic fusions are preferred when the functional moiety is a polypeptide. this is For example, if the 3' end of a DNA sequence encoding a polypeptide contains a C4bp monomer, A C4bp fusion polypeptide encoding a C4bp fusion polypeptide linked to the 5' end of the encoding DNA. The process involves creating a hybrid DNA sequence to be coded. Expression in a suitable host This hybrid DNA sequence then aggregates into a C4bp fusion that becomes a multimer. Produces polypeptides.

"r　C4bp monomer" used in the text refers to polypeptide containing a C4bp core. or, more preferably, at least one SCR of the C4bp core. A polypeptide comprising the sequence fused to the N-terminus. rC4bp core” is , at least the amino acids from position +498 to +549 in Figure 1, preferably +49 Contains amino acids from position 2 to +549. rscRJ used in the text is C4 bp polypeptide fragment. SCR includes loops at a minimum, and loops at a maximum. Includes a loop and two connections. A "loop" has eight S Contains the amino acid sequence surrounded by the first and fourth cysteines of the CR domain . That is, the loop includes amino acids from position +2 to +60 of 5CR8, and amino acids from position +60 of 5CR8. Amino acids from positions +65 to +122, amino acids from positions +127 to +186 of 5CR6 amino acid, amino acid from position +191 to +246 of 5CR5, +251 of 5CR4 Amino acids from position +312 to position +375 from position +316 of 5CR3 , amino acids from position +378 to +432 of 5CR2, and +446 of 5CRI The amino acids from position +490 are included. Between the loops, the "connection part" and (in the case of SCR8 and 5CRI) the amino acid sequences outside the loop.

Therefore, each loop is connected to other loops via a link. the connecting part An SCR having a connecting portion is preferable to one having no connecting portion. Because there is no connecting part Two loops that are joined are as flexible as those joined by a link. This is an example of an amino acid sequence that includes the amino acid sequence of the SCR\A region defined above. The SCR that includes this is optimal. For example, to the short loop of 5CRI and 5CRa Small changes are made to the amino acid sequence of the SCR, such as the addition of a few amino acids. It should be understood that what will be gained.

The C4bp monomer of the present invention can be arranged in any arrangement including randomly arranged SCRs. including. However, the purpose of the present invention is to reduce the immune response to this C4bp monomer. The aim is to produce proteins that are least likely to cause Therefore, it is more preferable In other words, the amino acid sequence of C4bp monomer is less than that of mature C4bp. Both correspond to fragments, which are usually non-immunogenic. Therefore, C4bp monomer, C4bp (SCR8) corresponds to the mature C4bp polypeptide.

C4bp (SCR4) corresponds to the amino acid sequence from position +248 to +549 in Figure 1. do. C4bp (SCRI) is compatible with the amino acids from position +433 to +549 in Figure 1. I guess. C4bp (SCR4) is the most preferred C4bp monomer.

Other embodiments of the invention include a number of SCRs of c4bp4bp monomers. minimum In this case, SCR is not included. At maximum, the C4bp monomer carries approximately 32 SCRs. include. It has 30 regions and is the longest known repeat unit molecule, CRI. is roughly equivalent to [L, 8゜1[1ickstein, -1solatio n of NO3-terminal CRI (CD3S) C1onesan d Expression of Recombinant Human CR I-FASEB J, 2゜p, A1832 #8921 (198g)].

A C4bp monomer containing 8 or more SCRs is more preferably a C4bp monomer containing at least 8 or more SCRs. also corresponds to the amino acid sequence of mature C4bp fused into one fragment. For example, 16 A monomer consisting of SCR of 5CR8-SCR fused to 5CR8-SCRI Includes I.

The DNA sequence encoding C4bp monomer is derived from the DNA sequence encoding C4bp. come There are several ways to obtain these DNA sequences.

First of all, the C4bp gene or its degenerate form can be synthesized by commercially available chemical synthesis. It can be chemically synthesized using a machine. We have shown in Figure 1 that nucleotides +1 to +96 The DNA sequence of C4bp is shown because it contains the signal sequence at position. It is three With the exception of silent nucleotide substitutions, Chung et al. (supra) and Lin Confirming the sequence presented by Tin et al. (supra). The difference is nucleotide 62 Located in the codons starting from positions 5, 1402, and 1459, GGC and T, respectively. Read as GG and GAG. Chung et al. changed those codons to GGT, T It has been identified as GC and GAA.

Second, the cDNA sequence encoding the C4bp polypeptide was can be separated by screening for Many screening methods are known to business owners. For example, activating nucleic acids using oligonucleotide probes. Colonies can be screened by hybridization. probe is known can be prepared by chemically synthesizing a portion of the C4bp DNA sequence. a Alternatively, construct a cDNA library in an expression vector such as λgtll and It is also possible to screen colonies with hC4bp antibodies.

Third, by amplifying the mRNA using polymerase chain reaction (PCR). cDNA encoding C4bp can be isolated. We demonstrate this method in Example I I will explain later.

The DNA sequence encoding the C4bp monomer is then combined with a functional component such as a polypeptide moiety. fused with a DNA sequence encoding a functional portion. Polypeptides useful in the present invention Encoding DNA sequences are available from many sources. This is described in the literature specific DNA sequences obtained by any conventional molecular cloning technique. Contains a DNA sequence that encodes a polypeptide.

The invention also provides non-human C4bp fusion polypeptides, including non-human C4bp fusion polypeptides. bp fusion proteins. In such fusion polypeptides, the C4bp single The amino acid sequence of C4bp and SCR is derived from the amino acid sequence of non-human C4bp. Contains. Any non-human C4bp that has monomeric units that assemble into multimers useful for this purpose. Such C4bp multimers are found in guinea pigs and mice. [Lint in et al., supra. Mouse C4bp is preferred.

This is because its amino acid sequence is known to contain consecutive SCRs. It is.

(Margin below) A wide range of polypeptides can be incorporated into the C4bp fusion proteins or fusion polypeptides of the invention. It is useful in the production of Among the most useful are those that are advantageously administered in multimeric form. Contains lipeptides.

For example, viral receptors or cellular receptors or ligands It is for use. This is because they typically bind to particles and cells that exhibit a large number of receptors. This is because they match.

Fusion proteins containing these polypeptides can be used for virus-cell or It is useful for treatments involving inhibition of cell-cell junctions. Useful Virus-Cell Lease The receptors include ICAMl, line virus receptor; poliovirus receptor. [J, White and D, Littman, “Viral Rec eptors of the [mmun.

-globulin Superfamily-, Ce1l, 56. pp, 725-28 (1989)] and most preferably the old V receptor. Includes CD4. Cell-cell receptors or ligands include ICAMI , ELAMl, and VCAM! and adhesion molecule families such as VCAMlb. lymphocytes and their opposing parts (ligands); lymphocyte-related antibodies Hara, LFAI, LFA2 (CD2) and LFA3, CDI 1/CD18 fa Milly members, and VLA4. These molecules contribute to pathological inflammation. Involved [M, P, Bevilacqua et al., “Identific a-tion of an Inducible Endothelial-1e ukocyte Adhesion Mo1ecule”, Proc, Na tl, Acad, Set, USA, 84. pp, 9238-42 ( 1987); L, 05bOrn et al. -Direct Expression CIoning of Vascular Cell Adhesion Mo1 ecule 1: A Cytokine-induced Endothel iat Protein that Binds to Ly+aphocyt es, -Ce1l, 59. pp, 1203-11 (1989) and He 5sron et al., Wo 90/13300].

Bacterial, parasitic, and viral immunogens are useful as vaccines Polypeptides for creating multimeric or heteromultimeric C4bp fusion proteins Useful as part of a putide. The bacterial origin of these immunogens may include bacterial lung These include those that cause inflammation and ecothromocystis pneumonia. Plasma is a source of parasites. Contains malaria parasites such as Smodium. Origins from viruses include e.g. Smallpox viruses such as cowpox virus and sheeppox virus; herpes symp Rexvirus types 1 and 2, B-virus, Varicella Sister Will herpesviruses, such as virus, cytomegalovirus, and Epstein-Barr virus. Adenoviruses such as milk 1] JJL virus; papillomaviruses; polyomaviruses, such as Rus, BK and JC viruses, papobau Viruses: parvoviruses like adenovirus sanitary virus; reovirus 1 ．． reoviruses such as 2, and 3; rubiviruses such as Colorado tick fever virus Viruses: rotaviruses such as human rotavirus; eastern encephalitis virus and Alphaviruses such as Venezuelan encephalitis virus; rubiviruses such as rubella virus Viruses: yellow fever virus, dengue virus, Japanese encephalitis virus, tick-borne Flaviviruses such as encephalitis virus and hepatitis C virus; human coronaviruses Rus's coronavirus; parainfluenza 1.2. 3 and 4, and Paramyelin virus such as mumps virus; measles virus morbillivirus; echomovirus like respiratory giant cell virus; vesicular ostium Vegkinirovirus like flame virus; Lysvirus like rabies virus ; orthomyxoviruses such as influenza A and B; lacrotusevirus; Bunya virus like S. Rus; chirovirus like Congoro blood fever virus; 8ri 1ff like flame Hepadonavirus; 1cm virus, rhinovirus, and Juninvirus rus-like arenaviruses; HTLV [, HTLVll, HIV I and and retroviruses such as old V11; poliovirus 1.2 Oyohi 3, Kotsufusa Key virus, echovirus, human enterovirus, hepatitis A virus, E Enteroviruses such as hepatitis virus and Norwalk virus; Rhinoviruses such as Novirus; Marburg virus and Includes filoviruses such as Ebola virus.

More specifically, the present invention comprises a viral polypeptide having hepatitis B e antigenicity. C4bp fusion polypeptides comprising a polypeptide portion comprising: Hepatitis B A DNA sequence encoding the virus e antigen (HBeAg) was prepared by Mimms et al. production, purification.

and 1mmunological Characterization f　a　Recombinar+t　DNA-derived　Hepatit is B e Antigen-, Viral Hepatitis and Liver Disease, pp, 248-251 Alan R, Li 5s, Inc. (1988). coded by this array Amino acids are hepatitis B virus core antigen (r HBcAgJ) (subtype a dw2) corresponds to the 144 amine-terminal amino acids. Or M, Pa5 - Hepatitis B Virus Genes and The ir Expression inE, coli-, Nature, 282° pp. 575-579 (1979). The coded DNA sequence corresponds to amino acids 1 to 144 of HBcAg. including. The DNA sequence encoding HBeAg is also known as ) Urra! rice union It can be obtained by the method described in National Patent No. 4758507. we are here Here, the DNA sequence encoding amino acid number 2 (Asp) to X of HBeAg is Alternatively, a polypeptide having this is referred to as "HBeAg(2-X)".

Immunoglobulins or fragments thereof that bind to target molecules can also be used as functional moieties. Useful. Although immunoglobulin molecules are divalent, immunoglobulin-C4bp The fusion protein becomes multivalent and exhibits enhanced affinity or binding to the target. can be shown. Single domain antibodies (dAbs) have proven useful [E, S, Ward et al. -Binding Activities of a R epertoire of Single Immunoglobulin Va riable Do+mains 5ecreted fro+a Esche richia colt, NatLlre, 341. pp, 544-46 (1989) Monoclonal Fab fragments that recognize lo-specific antigens are W, D, Each domain is a multimer according to the present invention. or can be used as a functional part of a heteromultimeric C4bp fusion protein [W , D, Huse et al. - Generation of a Large C Ombinatorial Library of the In++auno globulin Repertoirein PhageLambda-, 5 science, 246. pp, 1275-81 (1989)], (A, 5kerraand A, Pluckthun, -Assembly of a Functional ra+munoglobutin Fv Fragm ent+n Escherichia coli-, 5science, 240 ．． pp.

1038-43 (see also 198g)).

Additionally, when the functional moiety is an enzyme, enzyme substrate, or enzyme inhibitor, enhanced Multimeric C4bp fusion proteins can be produced as substances with biological activity. we We believe that such substances exhibit stronger biological activity. Because multimers are partially This is because it has a higher density and exhibits a higher turnover rate. For example, group The multimeric C4bp fusion protein with tissue plasminogen activator has its - It appears to have stronger clot lysis catalytic activity than its valent counterpart. Hirujin, Hiruji C-terminus of the peptide (described in PCT patent application W090103391, cited herein) ) and molecules based on the structure of hirudin (i.e., 1990 July Hillrobe, described in U.S. Patent Application No. 549,388, filed on May 6th, hereby A multimeric C4bp fusion protein with a fusion protein with It may exhibit stronger anticoagulant activity than the monomer of the repeptide.

Other useful moieties include various IFN-α, especially C2, C5, C8, IFN-β and and cytokines including IFN-γ, IL-1, IL-2, IL-3゜IL-4, Various inleukins, including IL-5, IL-6, IL-7 and IL-8, and tumor necrosis factor TNF-α and β. moreover, Functional moieties include, for example, monocyte colony stimulating factor (M-CSF), granulocyte colony stimulating factor stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CS) F), erythropoietin, platelet-derived growth factor (PDGF), and growth protein Contains human and animal hormones including lumon and insulin.

In one embodiment of the invention, the multimeric C4bp fusion protein is CD4-C4b p fusion polypeptides. CD4 is a causative factor in AIDS and ARC A receptor on the 1978 leukocyte that recognizes a certain old V [P, J, M addon et al. -The T4 Gene Encodes the AIDS Virus Receptor and Is Expressed int he Immune System and the Brain-, Ce1l , 47. pp, 333-48 (1986). Recognizes gp120/160, a virus surface protein. fusion of these In the polypeptide, the functional moiety is CD4 or a fragment thereof, preferably soluble C This is a polypeptide portion that includes D4. D encoding the entire human CD4 protein The nucleotide sequence and deduced amino acid sequence of NA have been reported [P, J, Maddon et al., “The l5olation and Nucleoti de 5equence of a cDNA Encoding the T Ce1l 5surface ProteinT4: A NewMember of the Immunoblobulin Gene Fa+aily-, Ce1l, 42°pp, 93-104 (1985); D, R, Littm an et al., -Corrected CD45equence”, Ce1l, 5 5. p, 541 (1988)]. Based on its predicted-order structure, the CD4 protein is Divided into the following functional domains: (Left below) Hydrophobic/secretory signal -25 to 11 Hydrophobic/transmembrane sequence +371 to +3 91 Very hydrophilic/intracytoplasmic +392 to +431 primary immunoglobulin-related dosing The main also includes a variable-related (v) site and and joint-related (J) parts. [S, J, C1ark et al. -Pe ptide and Nucleo-tide Sequences of Ra t CD4 (W3/25) Antigen: Evidence for De rivation flora a 5structure with Four I+u+unoglobulin-related Domains-, Pr oc, Natl, Aead, Sci, USA, 84. pp, 1 649-53 (1987)] These domains also contain structural domains formed by intraregional disulfide bonds. corresponds roughly to Inn. Therefore, disulfide bonds are the first immunoglobulin-related The amino acids at positions +16 and +84 of the domain are replaced by a second immunoglobulin-related domain. amino acids at positions +130 and +159 of The amino acids at positions +303 and +345 are connected. Figure 4 shows the height of Figures 3A-3B. -Represents the region structure of CD4 protein.

Soluble CD4 protein removes transmembrane and intracytoplasmic domains was constructed by cleaving the full-length CD4 protein at amino acid position +375. . Such proteins are produced by recombinant DNA technology and are made from recombinant, soluble cD4 (rsCD4) [R, A. Fisher et al., “Former V Inf. Ection Is Blocked In vitro by Recomb inant 5olable CD4°, Nature, 331. pp, 1B-78 (1988)r Ficher et al., PCT Patent Application W089101 940 (Add as cited here) These soluble CD4 proteins are CD4”J lymphocytes/HIV interact through a competitive binding mechanism or a competitive binding mechanism. This inhibits old Vg staining of cells expressing CD4 protein. control The immunoglobulin-related domain binds to gp120/160. It is enough. Since it acts as a soluble virus receptor, soluble CD4 protein The white matter is affected by the binding of old V to CD4” lymphocytes and the formation of syncytia caused by the virus. It is useful as an antiviral treatment to suppress

CD4 polypeptides useful in the invention include those that bind gp120/16o or All CD4 polypeptides that inhibit or inhibit CD4 are included.

These include transmembrane amino acids from positions +371 to +391 in Figure 3A-38. Contains a CD4 fragment lacking the domain. Such fragments are truncated forms of CD4. or the fourth immunoglobulin-related domain is a hydrophilic intracytoplasmic domain. It can be a directly linked fusion protein. The secondary structure of a polypeptide depends on its function. Preferably, the soluble CD4 protein contains disulfide bonds within the domain. the following immunoglobulin domains: contains insufficient domains to contain the first cysteine. be within this range For example, certain amino acid sequences bind gp160/120 with stronger affinity. .

We now select the +X position from the phase of Figures 3A-3B, optionally including the N-terminal methionine. A CD4 polypeptide containing the amino acids rCD4(X)J is called rCD4(X)J.

For example, with reference to FIGS. 3A-3B, immunoglobulin-like domain number 10 The soluble CD4 protein preferably contains a small number of amino acids (from positions +1 to +84). , containing at most amino acids from position +1 to +129. Most preferably, soluble C D4 protein contains amino acids from position +1 to +111 [CD4(111)]. most The soluble CD4 protein containing the first two immunoglobulin-like domains preferably comprises: Amino acids from positions +1 to +159 at least, and at most +302 from the phase Contains amino acids. More preferably, the soluble CD4 protein is at least at position +1 or It contains amino acids at positions +175 and at most positions +1 to +190.

Most preferably, the soluble CD4 protein contains amino acids from positions +1 to +181 [CD4 (181)], amino acids from positions +1 to +183 [CD4 (183)], or contains the amino acid at position +187 from the village [CD4 (187)]. The first four exemptions The soluble CD4 protein containing the epiglobulin-like protein region preferably has at least Amino acids from positions +1 to +345, at most amino acids from positions +1 to +375 [CD4(375)]. Any of these molecules may optionally also be shown in Figures 3A-3B. It may contain a CD4 signal sequence, which is amino acids 25 to 11. This again These molecules optionally include a methionine residue before the amino acid at position +1 in Figure 3-A-38. may be included.

Soluble CD4 proteins useful in the fusion polypeptides and methods of the invention can be found in a variety of ways. can be manufactured by the method. We have pJOD in Figure 3A-38.

5CD4. Total CD4 cDNA obtained from Y187 and p170.2 The nucleotide sequence and amino acids deduced therefrom are shown. Figures 3A-3B According to an equivalent system, the amino-terminal amino acid of mature CD4 protein isolated from T cells The noic acid is lysine located at nucleotide position 136 in Figure 3 [D, R, L ittman et al., supra]. The soluble CD4 protein also has an amino acid at position +62. Arginine is encoded by GG, and position +229 is encoded by TTT. including those that are phenylalanine. Therefore, when we refer to CD4 means that amino acid sequences containing one or both of these substitutions are included. Figure. Soluble CD4 polypeptide can be obtained by oligonucleotide-directed mutagenesis and conventional techniques such as digestion with restriction enzymes and subsequent insertion of linkers; can be produced by enzymatic digestion of full-length CD4 protein.

Soluble CD4 protein is produced by recombinant technology by the process described below. containing the protein. 198, which is a pending similar application by two same applicants. U.S. Patent Application No. 094322, filed September 4, 1988. Application No. 141649 filed on January 7th, filed on May 24th, 1989. As application number 351945 and PCT patent application number WO39101940 PCT Patent Application No. PCT/US88 filed September 1, 1988, published No. 102940. The materials disclosed therein are incorporated herein by reference.

Microorganisms and recombinants characterized by DNA sequences encoding soluble CD4 protein The DNA molecule is described in PCT Patent Application No. WO 89101940. An example is a culture of. They were published in Vitro I on September 2, 1987. international, Inc., culture collection n, Linthicum, Maryland, USA, as follows: was certified.

EC100: E, coli JM83/pEc100-IVI 1014 6BG377: E, coli MC1061/pBG377-IVI 1 0147BG380: E, coli MC1061/pBG380 - IV I 10148BG381: E, coli MC1061/pBG381 - IVI 10149゜Such microorganisms and recombinant DNA molecules also include , January 6, 1988 In Vitro International, In c, deposited in the culture collection and certified as follows. Cultures are also exemplified.

BG-391: E, coli MC1061/pBG391-IVI 1 0151BG-392: E, coli MC1061/pBG392-I VI 101528G-393: E, colj MC1061/pBG393 - IN 101538G-394: E, coli MC1061/pBG 394-IVI 101548G-396: E, coli MC1061 /p8G396 - IVI 1 (1155203-5: E, coli 5G 936/p203-5 - IVI 10156 Furthermore, such microorganisms and In Vitro I on August 24, 1988, international, Inc., deposited with the culture collection. Examples of certified cultures are as follows.

211-11: E, coli A89/1) BG211-11 - IVI 10183214-10: E, coli A89/pBG214-10 - IVI 10184215-7: E, colj A89/pBG215-7 - IVI Multimeric C4 containing 10185CD4-C4bp fusion polypeptide bp fusion proteins are useful in a variety of pharmaceutical compositions and methods. CD4-C Due to its competitive binding feature, the 4bp fusion protein binds to the HIV T4+ receptor. Advantageously inhibits binding to lymphocytes. And they are gp120/160 proteins. It actively destroys old V-infected cells that express protein and produce HIV. Therefore , CD4-C4bp fusion protein can be used to infect AIDS, AffC, and HIV. or to pharmaceutical compositions and methods for treating humans with antibodies to old V. can be used. They are also used to reduce the immune dysfunction caused by [V infection, or old VG It is useful in preventing the occurrence and spread of infection. Additionally, these CD4-C4bp fusions The proteins and methods are applicable to retroviruses such as simian immunodeficiency virus. can be used to treat AIDS-like diseases in mammals, including humans, caused by Ru.

The DNA sequence encoding the C4bp fusion polypeptide is a multimeric C4bp fusion protein. Useful for quality production. A preferred step is to adapt the expressed polypeptide to multimers. This includes the expression of such NA sequences in a host that allows for proper assembly.

As is well known to those skilled in the art, for expression of the DNA sequences of the invention, the DNA sequences are operably linked to expression control sequences in a suitable expression vector to form a suitable unicellular host. It must be integrated into the expression vector to be transformed. In this way, the DNA sequence of the present invention Effectively linking a sequence to an expression control sequence requires, of course, that the upstream sequence of the DNA sequence including providing a translation initiation signal in a new reading frame. expressed If the specific DNA sequence to be processed does not begin with a methionine, a start signal is generated. It becomes methionine, an additional amino acid located at the N-terminus of a substance. Such methionyl Group-containing products can be used directly in the compositions and methods of the invention, whereas methionyl It is usually more desirable to remove the material before use. expressed with methionine Methods for removing such N-terminal methionine from polypeptides are known to those skilled in the art. ing. For example, certain hosts and fermentation conditions may cause virtually all The N-terminal methionine is removed. Other hosts have shown that the N-terminal methionine in vitro Requires removal.

However, such methods in vivo and in vitro are well known to those skilled in the art. It is about.

A variety of host/expression vector combinations may be used to express the DNA sequences of the invention. Ru. For example, useful expression vectors include chromosomal DNA, non-chromosomal DNA such as A, and two different known SV40 derivatives consisting of segments of synthetic NA sequences. and bacterial plasmids such as colEl, pcRl, pBR322, pM E, coJi insect plasmids, including B9 and their derivatives, such as RP4. Broad host range plasmids; phage DNA, e.g. λ phages such as NM989 other DNA such as 1-di; 2μ plasmid or its derivatives. yeast plasmids; and phage DNA or other expression control sequences. Combinations of plasmids and phage DNA, such as modified plasmids A vector derived from.

Additionally, a sequence which, when operatively linked to a DNA sequence, controls the expression of that DNA sequence. Any of a variety of expression control sequences may be used to express the DNA sequences of the invention. Can be used in vectors. Such useful expression control sequences include, for example, SV4 0 or adenovirus early and late promoters, lac system, trp system , TAC or TRC system, main operator and promoter of λ phage region, regulatory region of fd coat protein, 3-phosphoglycerate kinase promoters of other glycolytic enzymes, acid phosphatases such as Pbo2. motor, promoter of yeast α mating factor, polyhedral promoter of Bagyu mouth virus - and expression of genes in prokaryotic or eukaryotic cells or their viruses. including other sequences known to regulate and various combinations thereof.

A variety of unicellular host cells are also useful for expressing the DNA sequences of the invention. this These hosts are two well-known prokaryotic and eukaryotic-containing E. coli strains; Fungi such as Domonas, Bacillus, Streptomyces, and yeast, as well as CH O and mouse cells, CO5-1, CO5-7, BSCL, B5C40 and B Animal cells such as African green monkey cells, insect cells and tissues such as MTIO Human and plant cells in tissue culture. For expression in animal cells, we use CHO Prefers cells and CO5-7 cells.

Not all vectors and expression control sequences are identical for expression of the DNA sequences of the invention. It should be understood that it does not work as such. Similarly, not all hosts do not function equally well in the same expression system. However, those skilled in the art can , expression control sequences, and hosts that fall outside the scope of the invention without undue experimentation. You can choose without having to worry about it. For example, the host must be considered in vector selection. No. Because the vector must replicate within itself. . The number of copies of a vector, the ability to control that number of copies, and the amount of code in that vector. The expression of other proteins, such as antibiotic markers, that have been should be considered.

Various factors should also be considered in selecting expression control sequences. this These include, for example, the relative strengths of the systems, their ability to control particular DNA sequences of the invention, and and compatibility, particularly with respect to potential secondary structure. The unicellular host is The DNA of the invention should be selected taking into account the compatibility with the two chosen vectors. Toxicity to the cell of the product of expression of the A sequence, secretory properties of the cell, protein the ability to form the correct three-dimensional structure, the need for fermentation, and the DNA sequences of the invention. Ease of purification of encoded products expressed by.

or CI (for large-scale culture of animal cells such as O cells or CO5-7 cells). Those skilled in the art will be able to find various vector/expression construct/host combinations for expression. You can choose.

According to one embodiment of the invention, the plasmid pJoI)-s (u　u　description) A CD4-C4bp fusion inserted into a The DNA sequence encoding the polypeptide naturally forms a heptameric CD4-C4bp fusion. A fusion polypeptide is produced that assembles into a protein.

The polypeptides and proteins produced by expression of the DNA sequences of the invention are , isolated from fermentation or animal cell culture and purified by any of a variety of conventional methods. It will be done. Those skilled in the art will be able to determine the most appropriate separation and refinement without departing from the scope of the invention. You can choose the manufacturing technology.

C4bp fusion polypeptides can also be synthesized by solid-phase synthesis [R,B, Merrifiel d, “5olid Phase Peptide 5ynthesis, 1 ．． "The 5 synthesis of A Tetrapeptide", J ,AtChe+s,Soc,,83. pp, 2149-54 (1963) J It can be chemically synthesized using conventional peptide synthesis techniques such as. Then a large amount The body C4bp fusion protein is an internal or polypeptide of the C4bp fusion polypeptide. It can be produced by forming disulfide bonds between peptides in vitro.

In addition to genetic fusion and chemical synthesis, the production of multimeric C4bp fusion proteins Another method that is useful is by chemically attaching functional moieties to monomeric C4bp. . This method is useful for both polypeptide or chemical moieties. Functional part for example hC4bp itself or multimeric recombinant hC4bp. It binds to another C4bp monomer or C4bp monomers that have already assembled into a multimer. obtain.

Several methods are used for chemical bonding. These include, for example: nigertaraldehyde [M, Reichlin, -Use o f Glutaraldehyde as a Coupling Agent for Proteins and Peptides+Methods In Enzymology, 70. pp, 159-65 (1980)], ]N- Ethyl-N'-3-dimethylaminopropyl)-carbodiimide [T, L, Goodf r 1end et al. -Anti-bodiesto Bradyki nin and Angiotensin: A Use of Carbo- "Diimides in Immunology", 5science, 144. pp, 1344-46 (1964)] or ]N-ethyl-N'-3-dimethy mixture of carbodiimide and succinic support [M, H, Kl upper and [, M, Klotz.

-Acylation with Dicarboxylic Ac1d an hydrides-, Methods In Enzymology, 25. pp , 531-36 (1972)], or Pierce Chemical Co. Heterobifunctional or homobifunctional crosslinking agent described in mpany Catalog . Because the chemical bond is not limited to one site on the C4bp monomer, more than one functional It is possible to attach moieties to each C4bp monomer. Additionally, periodic acid Sodium method [P, Nakane and A, Kawai, -Per Oxidase-1 labeled Antib.

dy: A New Method of Conjugation-, J, H istochem, Cytochera, 22. pp, 1084-91 ( (1984)] can be used to attach functional moieties to glycans on proteins.

Heteromultimeric C4bp fusion proteins are combinations of different C4bp monomers, or a combination of both. for example , a heteromultimeric C4bp fusion protein comprises one or more C4bp monomers (e.g. C4bp, 5CR4 and C4bp, 5CR8) and one type of functional part combination of one type of C4bp monomer and one or more types of functional moiety one or more C4bp molecules (e.g. recognition molecules and reporter groups), combinations of polymers and combinations of one or more functional moieties; Not all C4bp monomers are fused or chemically linked to functional moieties. Includes combinations that do not exist.

Heteromultimeric c4bp fusion protein containing two different polypeptide moieties is the production of DNA sequences encoding two different polypeptides in one host. It is advantageously manufactured by making it appear. When expressed in an appropriate system, polypeptides The molecules assemble into multimeric fusion proteins containing one or more types of functional moieties. Become.

According to another embodiment of the invention, a polypeptide moiety and a chemical moiety, or two Heteromultimers featuring different chemical moieties of can also be produced. as mentioned above , moieties can be chemically attached to the polypeptide before or after assembly.

The properties of different parts of the heteromultimeric C4bp fusion protein complement each other. This is particularly useful when For example, the present invention can target specific target particles or cells. A binding receptor and a toxin or antiretroviral agent are combined in a fusion protein. It is possible to create targeted toxins or targeted retroviral agents by combining It is Noh. Polypeptides useful as toxins include lithin, abrin, and angiogenin. , Shade Monas Exotoxin A5 Porkweed Antiviral Protein, Saporin ( 5aporin), gelonin and diphtheria toxin, or their toxic parts, but are not limited to these. Useful anti-retrow Viral agents include suramin, azidothymidine (AZT), dideoxycytidine, and Castanospermine, deoxynojirimycin (deoxynojiri) Bcin) and their derivatives.

The heteromultimeric C4bp fusion proteins of the invention can also be used in a sample or in vivo. It is useful as a diagnostic agent to confirm the presence of target molecules. such a protein is an immunoglobulin or its fragment (Fab, dAb) that binds to a target molecule one functional moiety, a recognition molecule such as CWard et al., supra]; radionuclides, enzymes (such as horseradish sociniperoxidase) or fluorescent Includes a second functional moiety that is a photo or chemiluminescent marker. Many Since the mer C4bp is large, it is possible to attach many reporter groups, which increases the Strengthen Gunar. These heteromultimers can be detected in e.g. ELISA type assays. It can be used to replace antibodies as recognition molecules in contact with samples, or as contrast agents in vivo. can be used.

The heteromultimeric C4bp fusion protein according to the invention can also be used as a combination vaccine. can also be used. For example, such fusion proteins can contain a number of proteins from the same infectious agent. can be constructed using different antigenic determinants of the species. In addition, polio, measles, mumps protection against several infectious agents, such as those used in subcutaneous and other childhood vaccines. Fusion proteins containing the primary determinants can be produced and thus conjugate vaccines can be created. It will be done.

Multimeric C4bp fusion proteins according to the invention also contain human C4bp fusion proteins that are normally associated with human C4bp. It also contains the protein S-linked subunit of bp.

Such a protein consists of a DNA sequence encoding an initial C4bp fusion polypeptide. sequence and the DNA sequence encoding the second protein S-linked subunit. It is produced in the transformation of a host. When expressed, these DNA sequences produce C The 4 bp polypeptide assembles into an associated multimer of protein S-binding subunits. becomes. C4bp polypeptide is usually a heptamer (tannoprotein S-linked subunit) If the monomeric polypeptide is smaller than normal, , or if large, they may assemble into octamers or hexamers, for example. subordinate Therefore, the multimeric C4bp fusion protein referred to in this application is a heptameric C4bp fusion protein. It also includes things other than proteins.

Pharmaceutical compositions of the invention typically contain an effective amount of a C4b9 fusion protein of the invention. and pharmaceutically acceptable carriers. The treatment method of the present invention includes pharmacological treating a patient with those compositions in a manner acceptable to the patient. °these The compositions can be used to treat all mammals, including humans. Pharmacology of the present invention Compositions can take a variety of forms. These include, for example, tablets, pills, powders, liquid solutions or suspensions, liposomes, suppositories, injectable and infusible solutions, and sustained-release Includes solid, semi-solid and liquid dosage forms, such as molds. The preferred form is depending on the method of administration and therapeutic application. The composition preferably also includes Contains conventional pharmaceutically acceptable carriers and adjuvants.

Generally, the pharmaceutical compositions of the present invention contain pharmaceutical agents such as alpha interferon. Formulated using methods and compositions similar to those used for polypeptides of interest to can be formulated and administered. The fusion protein of the invention is then stored in lyophilized form. be reconstituted with sterile water immediately before administration, and administered parenterally, subcutaneously, intravenously, intramuscularly, or It can be administered by conventional routes of administration, such as the intrafocal route. The effective dose is approximately 10-1 00 μg/kg body weight 7 days, lower and higher doses may also be useful. It is recognized that Typical dosages may vary depending on the specific molecular moiety involved. It is understood that

Additionally, DNA sequences encoding C4bp fusion polypeptides may be useful for somatic gene therapy. can be used. This is based on retroviruses suitable for infection of human somatic cells, for example. It involves inserting a DNA sequence into the underlying vector [A, Kasid et al. Human Gene Transfer: Characterization of Hua+an Tumor-infiltrating Lympho Cytes as Vehicles for Retroviral-med iated Gene Transfer-, Proc, Natl, Aca d, Set, USA, 87. pp. 473-77 (1990)].

For example, an AIDS or JRC patient might be treated as follows: A retro DNA sequence characterized by a DNA sequence encoding a CD4-C4bp fusion polypeptide. Prepare the virus. Next, isolate T cells from the patient and test them in vitro. Infect with a retrovirus. These cells are then reintroduced into the patient, where they The vector is expressed and the cells secrete the CD4-C4bp polypeptide.

In order that the invention may be better understood, the following examples are set forth below. Implementation of these Examples are for illustrative purposes only and should not be interpreted in any way to limit the scope of the invention. Not interpreted.

Cloning, restriction enzyme digestion, and DNA used in the examples described below. Fragment separation, Flenow enzyme and deoxyribonucleotide triphosphate (dXTP) ), ligation, transformation of E. coli, etc. The technique is by J. Sambr.

Ok et al Molecular Cloning, A Laboratory M annual, Co1d Spring Harbor Laboratory Press, Co1d Spring Harbor, New Y.

The usual protofurs as exemplified and described in further detail in R.K.R.K. (1989) It is.

We cloned the human C4PA protein using the following method. The cDNA sequence encoding the binding protein was isolated. Human hepatocytes (Hep G 2) American Type Culture Co11ection, Rockville, Maryland, USA, ATCCHB 80 Obtained from 65. We extracted polyadenylated mRNA from these cells using guanine. Dium thiocyanate/oligo dT cellulose method [Sambrook et al., supra. 7.19-7.22]. 5μg polyadenyls using conjugated mRNA, Mo-MLV reverse transcriptase, and primer C4bp, 3. Then, antisense C4bp single-stranded cDNA was synthesized.

(The DNA sequences of all oligonucleotide primers and splint probes are The columns are shown in Figures 5A-5B. ) Next, the second cDNA strand was subjected to Gubler-Hof fman method [U, Gubler and B, J, Hoffman, “A S impIe and Very Efficient Method for Generating cDNA Library, Gene, 25. pp, 263-69 (19g3)].

PCR method for cDNA sequence of C4bp [Sambrook et al., supra, Chapter 14] was amplified using We performed all amplifications using Taq DNA polymerase and using T4 polynucleotide kinase and primers pre-oxidized with ATP. I went. oligonucleotide C4b$), 1 as a sense primer (antisense primer) (hybridizes with the strand) and C4bp, 2 as It was used as a sense primer. The amplified fragment was treated with Flenow enzyme and dXTP. filled with This yields a 1746 bp fragment encoding C4bp, resulting in transcriptional cleavage. Framed with start and stop signals. The identity of this fragment is SnaBl and P This was demonstrated by digestion with stl. As expected from the DNA sequence of C4bp, 5 Digestion with naBI produced a 1436 bp fragment and 5naBI/Pstl Digestion produced a 1047 bp fragment.

Next, the fragment encoding C4bp is inserted into an animal expression vector created as follows. It was inserted into pJOD-S. (See Figures 6B-6C).

First, we obtained pJOD-LO. Described in European Patent Application No. 343783 As in, pJOD-10 can be prepared as follows. Blasumi do psV2 -DHFR, (ATCC37146, American Type Cu1tu re Calection) [S, Subramani et al. -Expr Ession of the Mouse Dihydrofolate Re ductase Complen + entry Deoxyribonucle eic Actd in 51m1an Virus 40 Vectors- , Molec, Ce11. Biol, 1. pp, 854-64 (1 981)] was digested with Apal and EcoRI, and a 4420 bp fragment was isolated. did. Next, from +190 of the Apal lumi overhang gastrin gene to + DNA sequence encoding 233 nucleotides [K, 5ato et al. -A 5 pecific DNA 5equence Controls Ter+m1 Nation of Transcription in the Ga5tr fn Gene+Mo1ec, Ce1l.

Biol, 6. pp, 1032-43 (1986) Figure 4], Xho1 Synthetic double-stranded DNA was prepared with the EcoRI overhang.

This oligonucleotide was added to psV2-DI (4420 bp taken from FR). The fragments were ligated and the resulting plasmid was called pDT4. Plasmid 1) DT4 was then digested with Aatll and Xhol, and the fragment of 4391b+) was isolated. . Mullerian inhibitor expression vector pD1 [R, L, cate etal, +l5olatfon of the Bovine and Human Genes for Mullerian Inhibiting 5ubst ance and Expression of the Hu+5anGen e in Animal Ce1ls-, Ce11. 45. pp, 685- 96 (1986)] was then digested with Aat I + and Sal I, and the obtained The resulting 5462 bp fragment was isolated. 1) DT4 4391bp fragment The fragment was ligated to create pJOD-10.

We digested pJOD-10 with old ndlll and BstEII and used Mueller A large fragment that did not encode the ductal inhibitor was isolated. The fragment was blunt-ended and S The ai+ linker was ligated to the ends and self-ligated to the vector. This is pJOD-S was generated.

Next, pJOD-S was prepared in order to insert a fragment encoding C4bp. plastic The sumid was linearized by digestion with SatI at a unique Sal1 site and filled with enzyme and dXTP. And in it, the fragment encoding C4bp. The pieces were ligated using D4DIJA ligase and ATP. Concatenation mixture E. coli was introduced into HBIOI by electroexpansion method. supplied with equipment Based on the protocol, electroporation was carried out at 25 μFD, 2. Ski, 200 ohm using the old oRad GENE PULSERR [Biorad Catalog, -Bacterial Electro-transfo rmation and Pulse Controller Instrument entManualo, 2165-2098.　version　2-89 ]o Then, the plasmid with the insert in the correct orientation is labeled with a 32p-labeled synthetic Ligonucleotide splint probes C4bp, 9 and C4bp-10 It was identified by hybridization. The splint probe is inserted between the insertion part and the vector. A 30 base long synthetic oligo that hybridizes beyond the fusion point between It is a nucleotide. The obtained plasmid was called pJOD, C4bp.

We have developed one strain of this plasmid, pJOD, C4bl), 3. was deposited.

X give yo ■ - one, two, one rainbow, two and one ri To test the expression of recombinant human I-C4bp (rhC4bp), we Supercoiled plasmid DNA from pJOD and C4bp was extracted by electroexposure method. was introduced into CO5-7 cells. 20μg supercoil plasmid by electro-exposure method 8 ooμl of 20mM HEPE along with 380μg of salmon sperm DNA S, pH 7,05, 137mM NaCl, 5mM KCl, 0.7mN 2 using 1xlo7 cells in a2HPOa and 6mM dextrose. It was performed at 80V and 960μI'D. As a control, reverse direction to vector A plasmid with a C4 bp fragment inserted into the plasmid was used.

Therefore, they do not produce all C4bp.

Transformed cells were treated with 10% FBS, 4n+M glutamine, 2QtaMHEP. ES(p)I 6. a> at 37 °C and 5% COa in DMEM medium containing , 100 liters of dates or 775 rut culture flasks. next , rhC4bp was assayed in the culture supernatant after 72 hours and cultured using three methods. Products were identified: immunoprecipitation, gel filtration and immunodetection by Western blot. . In these assays, the produced rhc4bl) was compared to natural hC4 in human serum. compared with bp. Our results show that transfected CQS-7 cells It is similar in molecular weight to native hc4bp and is recognized by anti-hC4bp antiserum. A heptameric protein with a properly folded SCR that has an epitope that It was shown that C4bp protein was produced. Recombinant human C4bp is a protein It differs from serotypes in that it lacks a protein S-binding subunit.

A, Rhythm “Jijishi Ura!” In the first assay, we used two different hC4bp-specific antisera and r Both hC4bp and hC4bp were immunoprecipitated and the size of the precipitated proteins standard sodium dodecyl sulfate polyacrylic acid before and after reduction of disulfide bonds. Comparison was made using midgel electrophoresis (5DS-PAGE).

Comparison of rhC4bp and hC4bp separated by immunoprecipitation revealed that CO3-7 rhC4bp produced in cells forms a heptameric rhC4bp via disulfide bonds. It was shown that the protein was properly assembled.

Human serum (Gibco, Grand Land, New York) Immunoprecipitation of the culture soil and CO5-7 was performed as follows. Immobilized protein G ( Gibco, Rockford, 111inois) suspension 0.05ml Precondition the sample by adding 1 m + 1 serum and stirring the mixture for 30 min at room temperature. I placed it. Next, protein G particles were sedimented using a centrifuge, and the supernatant was used for immunoprecipitation. Ta. The supernatant was treated with 0.05a+1 polyclonal rabbit anti-hC4bp antiserum (Ca lbioche II+ Corp,, San Diego/La Jolla .

Ca1ifornia) or polyclonal sheep anti-hC4bp antiserum (formerly o design International, Kennebunkport, (Maine) for 1 hour at room temperature. after that A protein G suspension of 0.05 ml was added and incubated for 1 hour at room temperature.

Centrifuge the pellet, add loOmM NaCl and 1% Twin (Pierce ), 50mM Trishydroxyaminomethane (pH 8°0) (Tris , Sigma Chemical Corp, , St, Louts, M issouri). The solution was centrifuged again and the supernatant was removed. this process was repeated twice with the same buffer and lomM), pH 7.4. Finally, resuspended in a standard Laemmli sample of O,15a+1, and the solution was poured into a boiling water bath. Heated for 5 minutes. Then, the molecular weight of the precipitated protein was reduced to 5% or 12%. Determined by DS-PAGE.

Human serum C4bp is a 45kD protein bound to the S-binding subunit. A band of approximately 530 kD was generated, representing the body C4bp. rhC4bp is a protein The predicted molecular weight of the heptameric rhC4bp, which does not contain the protein S-binding subunit. A band of approximately 490 kD was generated. having inserted DNA in a direction that is not expressed; Control samples produced no bands.

To prove that the precipitated rhC4bp was a heptamer, disulfide bonds were A reducing agent 2-mercap that separates a combined protein into its polypeptide subunits. The immunoprecipitated proteins were run on 5DS-PAGE using ethanol.

We compared the size of the C4bp polypeptide, 70kD, to hC4bp and rhC4bp were found to be produced.

5ton, Massachusetts) expressed in CO5-7 cells. Immunoprecipitation of rhC4bp was performed. The above-mentioned tanno-kuri quality labeled with 35 5DS-PAG precipitated with rabbit anti-hC4bp antiserum of 4 to 20% concentration gradient. Analyzed by E. High molecular weight equivalent to the 490 kD protein described above under non-reducing conditions band was detected by autoradiograph.

After reduction, this band disappeared and a band of approximately 70 kD appeared.

Neither band was present in the negative control. This means that C4bp It was confirmed that the polypeptides aggregate to form a heptamer.

(Margin below) B, rC4b islets by Western blot, then we (TCA) to non-selectively immunoprecipitate rhc4bp and hC4bp and Proteins were determined by Western blot using three different hC4bp-specific antisera. The quality was identified. rhC4b in Western blot under non-reducing and reducing conditions Immunological detection of rhC4bp and hC4bp shows that CO5-7 cells carry rhC4bp It was shown that the ruphide bond is produced in a properly folded form.

We concentrated 10 times (CENTRIPREP 30®).

rhC4bp was precipitated from the cell culture medium (concentrated by ultrafiltration with Am1con). Precipitate hC4bp from serum by adding 12% w/v TCA to I set it. After standing in water for 1 hour, the protein was Centrifuge for 10 min at 10,000 g at 4°C in a centrifuge tube (Eppendorf). and pelletized. Resuspend the pellet in 1 ml water-cooled acetone (-20°C). , and immediately re-pelletized under the above conditions. We repeated this washing step once.

Finally, we dissolve the protein pellet in standard Laemmli sample buffer and boil the solution. It was heated in boiling water for 5 minutes.

Next we under non-reducing and reducing conditions (using 2-mercaptoethanol) Proteins were separated on a 5% acrylamide gel (SDS-PAGE). we analyzed these tan1 I moved it to the top of the page. We then examined the plots by immunological detection.

We use 5% skim milk powder (Carnation, Los Angeles, Ca. 1ifornia) by incubation in Dulbecco's PBS containing to block nonspecific binding in these plots. Next, we plot , incubated in 5% milk powder solution containing primary antibody diluted 1:500. . - As the next antibody, we used a polyclonal rabbit anti-hC4bp antiserum (Cal bioch em), polyclonal sheep anti-hC4bp antiserum (Biodes ign) or monoclonal murine anti-hC4bp antibody (Quidel, Sa n Diego, California) was used. After leaving it at room temperature for 1 hour, We washed the plots three times with 0.05% Twin-20 in PBS. then pro incubate with secondary antibody at 1:1000 dilution in 5% milk powder solution. did. As secondary antibodies, we used rabbit IgG, sheep IgG or human IgG, respectively. Commercially available horseradish peroxidase conjugated to antibody against mouse IgG Product (A++ersham Corp, ArliArlln Heights , 111inois or Calbiochem) were used. 1 hour at room temperature After 1 day of incubation, the above washing steps were repeated. we are an antigen-antibody complex and the horseradish peroxidase substrate 4-coo-1-naphthol ( 0,02%, v/v, Sigma) and hydrogen peroxide (0,03 %, Sigma).

In the case of rhC4bp, a single band with a molecular weight of approximately 490 kD was detected. human serum , the band shifts to a slightly higher molecular weight (approximately 530 kD), which further indicates that This may reflect the presence of a subunit that binds to the 45 kD protein S.

We detected no protein in the negative control.

These results again demonstrate that the recombinant form of rhC4bp was The molecular weight is calculated by subtracting the subunit that binds to protein S from the natural form. It was shown that they assembled into similar heptamers. 12% acrylamide gel (SDS- After reduction and separation of proteins by PAGE), we analyzed the results using the above antiserum. Even in these cases, no protein could be detected. In this way, the anti- Serum only recognizes hC4bp with correctly folded disulfide bonds did. This confirms that hC4bp recombination detected by antiserum under non-reducing conditions form of the protein that exists in nature without the subunit that binds to protein S provide new evidence that the form is identical or similar to that of the

C, hC4bp- and rhC4bp-containing fractions by hC4bp-specific ELISA Gel permeation chromatography and δ We further used high performance liquid chromatography (HPLC) gel permeation method to rhC4bp and hC4bp are separated under conditions that preserve the natural structure of the protein. Ta. Subsequently, we identified the peak position and for the fraction hC4bpC4b The approximate molecular weight was determined by performing p-specific enzyme membrane attachment assay (ELISA). Established.

HPLC of rC4bp and hC4bp supported our previous results and showed that CO3-7 It was shown that the cells produce rC4bp in the form of a heptamer. Furthermore, hC4bp binds to natural glue such as protein IS or C4b (a fragment of C4). It was also suggested that there was We use the TSK-4000SWXL (registered trademark) HPLC Kel permeation column (30 0x7.8mm, Toyo 5oda, 7080M Corp, Japan) Equilibrate in 50mM phosphate buffer, pH 7°, 0.100mM sodium chloride. did. We used a column containing the molecular weight marker thyroglobulin (approximately 670 kD). , ferritin (approximately 440 kD) and catalase (approximately 230 kD) (all Ph armacia-LKB), and the eluted peaks were exposed to UV light. Detection was performed using a detector at 280 nm.

We used human serum (0,05 ml diluted in PBS to o, smt) or expressed A 10-fold concentrated cell culture supernatant (0.5 ml) containing rhcabp was added to this container. Loaded the ram. Proteins are removed from the column by an equilibration slow at a constant flow rate of 1 ml/min. Elution was carried out with buffer solution and 0.5 ml fractions were collected.

We used the collected fractions for hC4bp specific sandwich ELI SA (EL I 5A9). (for the ELISA assay described herein) See Figure 10 for a summary. ) In detail, we use a 96-well standard EL IS A plate (Imi x Ron [[, Dynatech Laboratories 0.005 μg/ml tungsten in 0.05 M bicarbonate buffer, pH 9.0. The cells were coated with a protein concentration of polyclonal sheep anti-hC4bp. we plate was incubated overnight at 4°C. We removed the non-specific portion of the well in PBS. by adding 2% milk and incubating for at least 30 minutes at room temperature. Blocked. We prepared the ELISA plate with 0.05% Twin20 in PBS. After washing three times, the fractions from the HPLC column were diluted with PBS containing 2% nonfat dry milk at 1:2. or diluted 1:10 and added 0.05 ml of each. Next we chamber the plate After incubating at room temperature for 3 hours, they were washed as above.

We optimally diluted (1:300) in PBS containing 2% milk powder in each well. 0) 0.05ml of polyclonal/L/Ufgi anti-hC4bp serum (Cal biochem) was added. We incubated the plates for 1 hour at room temperature. After that, it was washed as above.

Finally, we prepared 0.05 ml of the filtrate appropriately diluted with PBS containing 2% milk powder. -Goat anti-rabbit Ig conjugated to Radishniver oxidase (HRP) G (Organon Teknika Corp, West Chest er, Penn5ylvania) and incubate the plate for 1 hour at room temperature. I bet. After washing, OPD★ (0-phenylenediamine) (Ca lbiochem) was added as a substrate for HRP, and the amount of HRP antibody bound was detected colorimetrically. Ta. We quantified the results by reading the absorbance of each well at 490 nm.

(★This is a strong carcinogen, and before disposing of it, 50g K2Cr○7.25 m1 ION H2S0a, 145 m1 Should be detoxified using a solution of H2O It is. ) Next we plotted the results against fraction number as shown in Figure 8 . As shown in the figure, the elution profile of rhC4bp peaked at 490kD. This means that rhC4bp expressed in CO5-7 cells has a positive Distinct proteins shown to exist as heptamers representing well-folded immune epitopes The results matched. However, the peak in the elution profile of hC4bp was It was somewhat higher than 700 kD, as opposed to 530 kD. This is for this minute. as a result of non-covalent binding of the offspring to natural glues such as C4 and protein S. could be. We also wanted to observe the presence of protein S in these fractions. (data not shown).

Plan JJL! L--r　s　CD　4　187　Firstly, we have r A plasmid characterized by a DNA sequence encoding sCD4 (187), pJOD, 3CD4. Y187.5naB1 was created. We publish PCT applications Described in WO39101949 (7) Started from pJODSCD4. this is Prepared as follows (see Figure 6G). Plasmid pBG391 (IVI) 10149) was digested with Ba mHI and BgllI, and Flenow enzyme and dX Filled with TP.

A double-stranded Xho I linker with the sequence 5' CCTCGAGG and T4 at the end. Ligated with DNA ligase. The mixture was digested with xho I and rs CD A 1407 bp fragment encoding 4 was isolated. Next is an example! pJOD- described in S was digested with 5all and phosphorylated with alkaline phosphatase. Obtained 14 07t) The p fragment was ligated into 5aII-digested pJOD-S with T4 DNA ligase. Gated. In this way, pJODsCD4 was created.

Next we modified pJODsCD4 to include the 5naBI cloning site (Figure 6H %,) was created. We determined the tyrosine residue at position 187 of CD4 as follows: A 5naBI cleavage site was introduced immediately after the coding sequence. we phosphorylate By hybridizing C4bp,7 to phosphorylated C4bp,8, a single We created NheI/Bgln containing the 5naB1 site. Next we pJODs CD4 was completely digested with NheI and partially digested with Bglff. did. We added linkers into this digestion mixture and extracted the fragments with T4 DNA ligase. Reigate was done. We then prepared the ligate mixture using the method of Example I. E. coli was electroinjected into HBIOI. We used 32p-labeled probes. Hybridization with C4bp, 11 allows accurate large digestion A plasmid containing a synthetic fragment flanked by the Bgl■ site of the fragment was identified. we are this Such a plasmid was named pJOD, 5CD4°Y187.5naB1.

! --Cloning of CD4-C4bp fusion polypeptide Next we constructed three clones expressing the CD4-C4bp fusion polypeptide. (See Figure 7). This includes DNA sequences encoding C4bp or fragments thereof. Column p J OD.

5CD4. This includes insertion into the 5naBI site of Y187.5naB1.

We have 5CR8-SCRI and C4bp core, 5CR4-SCRI and C4bp core, respectively. 4b-core, or 5CRI and C4bp core. used. The DNA sequence was obtained by PCR as follows.

We performed PCR using pJOD, C4bp, 3 linearized with Notl. 164 of C4bp encoding 5CR8-SCRI and C4bp core. An 8 bp fragment was produced. We used prephosphorylated sense primers SCR,8 and The prephosphorylated antisense primer C4bp, 2 was used (Figures 5A-5B).

We then paired the ends of the PCR products with Flenow enzyme and dXTP. we The obtained fragment was pre-linearized with 5naBI, pJOD, 5cD4Y187° 5naB1. We prepared the ligate mixture.

E.coli HBIOI was electroporated. Next, we used 32P-labeled oligo By hybridizing to the nucleotide attached probe C4bp, 12, A plasmid was identified in which tyrosine-encoding sequences flank 5CR8. of 57. pJOD, 5CD4. It was named Y187.5CR8. I The fusion polypeptides expressed by such plasmids can be expressed by CD4 ( 187) -C4bp (SCR8). We have pJOD, 5CD4. Y187°5CR8,2 and pJOD, 5CD4. Y187.5CR8,3 An isolate of plasmid was obtained.

except that we used sense primer 312.21 instead of SCR,8. , 1 of C4bp encoding 5CR5-5CRI and C4bp core as described above. 089bI) fragment was produced. Next we pre-linearized pJO with 5naBI D, 5CD4. The fragment was ligated into Y187.5naB1. we are ligame The mixture was electroporated into E. coli HBOI. Next we have 32p Hybridization against probe 312.36 with labeled oligonucleotide tion, a plasmid with tyrosine-encoding sequences adjacent to 5CR5 was created. Identified. We have designated such plasmids as pJOD, 5CD4. Y187.5C It was named R5. We created a fusion polypeptide expressed by such a plasmid. The peptide was called CD4 (187)-C4bp (SCR5).

We have pJOD, 5CD4. Y187.5CR5,l and pJOD,5CD 4. Two isolates of the Y187.5CR5,2 (D plasmid were obtained.

We used sense primer SCR instead of SCR,8.

4 was used, the 5CR4-SCRI and C4bp core were coded as described above. A 908 bp fragment of C4bp was produced. Next, we preliminarily set 5naB I pJ OD made into a line.

5CD4. The fragment was ligated into Y187.5naB1.

We electroporated the ligate mixture into E. coli HBIOI. next We used a probe C4bp, 13 with a 32p-labeled oligonucleotide. By hybridization, the sequence encoding thyronone is located next to 5CR4. The contacting plasmid was identified. We named such plasmids pJOD, 5CD 4. It was named Y187.5CR4. We believe that such a plasmid produces The expressed fusion polypeptide is combined with CD4 (187)-C4bp (SCR4). called. We have pJOD, 5CD4. Y187.5CR4,2 and pJOD , 5CD4. Two isolates of Y187.5CR4,3 plasmids were obtained.

except that we used sense primer 312.20 instead of SCR,8. , 7 of C4bp encoding 5CR3-3CRI and C4bp core as described above. An 11 bp fragment was produced. Next we linearized pJO with 5naBI beforehand. D.

5CD4. The fragment was ligated into Y187.5naB1.

We electroporated the ligate mixture into E, colt HBIOI. next We used 32p-labeled oligonucleotide attached probe 312.35. Upon hybridization, the tyrosine-encoding sequence is adjacent to 5CR3. The plasmid was identified. We have designated such plasmids as pJOD, 5CD4. It was named Y187.5CR3. We expressed by such a plasmid The resulting fusion polypeptide is called CD4 (187)-C4bp (SCR3). is. We have pJOD, 5CD4. Y187.5CR3,2 and pJOD,5 CD4. Two isolates of Y187.5CR3,3(1) plasmid were obtained.

Except that we used the sense primer SCR,1 instead of SCR,8. A 353 bp fragment of C4bp that harbors 5CRI and C4bp fur as described above. was manufactured. Next we pre-linearized with 5naBI pJOD, 5CD4°Y The fragment was ligated into 187.5naB1. We prepare the ligate mixture E,c The olt HBIOI was injected by electroporation. Next, we used 32p-labeled oligonucleotides. By hybridization to cleotide probe c4bp, t7 identified a plasmid in which tyrosine-encoding sequences flanked 5CRI. we has designated such a plasmid as pJOD, 5cD4. Named Y187.5CRI . We expressed the fusion polypeptides expressed by such plasmids as CD It was called 4(187)-C4bp (SCRI). We are pJOD, 5CD 4. Y187.5CR1,1, pJOD, 5CD4. Y187.5CR1,2 and pJOD, 5CD4°Y187.5CR1,3 plasmid isolates. I got it.

Blood production--CD4-C4bp multimeric fusion protein and We used all the isolates described in Example Transform cells and culture for expression of CD4-C4bp multimeric fusion protein. I tested it. In detail, we supercoiled plus Mid DNA was electroporated into CO3-7 cells. After 72 hours, culture solution was assayed with several different ELISAs. Our results show that cells with CD4-C It was shown that a 4bp multimeric fusion protein was expressed.

A, CD4187-C4b5CR4 expression. CD4(187)-C was detected by both immunological detection and ELSA assay. Conditioned media of transformed cells were tested for expression of SCR4b (SCR4).

The results showed that these cells expressed CD4 (187)-C4bp (SCR4). It was shown that the expressed poly assembled into a heptamer.

1. ELISA assay We performed two EL I SA assays, and when combined, the multimer Production of CD4(187)-C4bp (SCR4) polypeptide was demonstrated. child In all ELISA assays described here, we Washed with 0.05% Twin 20 in PBS.

Two EL I SA assays were performed as follows. We play Imron■ rabbit anti-hC4bp (ELISAI) or anti-CD4 monoclonal 6 C6 (Biogen, Inc., Ca+mbridg, yassachu Sodium carbonate buffer p Add 50 μl/well of 5 μg/ml solution of each antibody in H9,0 and plate. The plates were coated by incubating overnight at 4°C. Excluding coating solution After that, we added 200 μl/well of 2% non-fat dry milk in PBS for at least 1 hour at room temperature. Non-specific binding was also blocked by incubating for 30 minutes. next , we removed the blocking solution and placed the sample in PBS (conditioned medium or 2% non-fat dry powder). Add 50 μl/well of conditioned medium diluted in milk and incubate for 3 hours at room temperature. I did it. We removed this liquid and appropriately diluted (1:1000) HRP- 50 μl/well of antibody for detection of bound 6C6 was added. 6C6 is an anti-human CD4 antibody. Zumi monoclonal antibody that blocks CD4-gp120 binding. (CD Other antibodies that block the binding of 6C6 to gp120 and can be used in place of 6C6 Becton Dickinson, M.

Untain View, anti-Leu-3 available from California There is a. ) We incubated the plates for 1 hour at room temperature.

We removed the solution and added OPD. Again we keep the plates at room temperature for 20-3 After incubating for 0 minutes, the starlight reaction was stopped with 1N sulfuric acid. Next we have 49 0.0 nm at 0 nm. D. was measured.

Both abseils showed positive results. Coat the plate with anti-hC4bp antibody. In this assay, polynucleotides containing both hC4bp and CD4 epitopes were used. The presence of the peptide was detected. A plate coated with 6C6 monoclonal Only the presence of multimers was confirmed by assay. Multimers contain more than one of 6C6 This is because it has only multiple binding sites that can bind to copies simultaneously.

2. Wesnplot's ・ Immunological detection of conditioned media by Western blot indicates that transformed cells are It was established that D4 (187)-cabp (SCR4) was produced, and furthermore, the It was shown that the lipeptides were assembled into heptamers. We describe in Example ■ Immunoprecipitation was performed on two samples of conditioned medium as described above. About the first sample , we used a polyclonal rabbit anti-hC4bp antiserum (Calbioche+++ ) was used. For the second sample we used the 6C6 antibody. we each sample The immunoprecipitated proteins inside were separated by 5% 5DS-PAGE, and then the proteins was transferred onto nitrocellulose under standard electroplotting conditions. we get Western blots were probed with each of the two antisera. first is a polyclonal sheep anti-hC4bp antiserum (Biodesign).

The second was a polyclonal anti-hCD4 antiserum (a gift from Biogen, Inc.) ). We performed immunological detection as described in Example ① above. anti-hC4b Both the p antiserum and the anti-hCD4 monoclonal antibody are anti-CD4 (187)- The estimated molecular weight of the heptamer of c4bp (SCR4), that is, 400 kD to 500 kD, is Proteins on both plots were detected.

We performed the same immunoassay using chondrorhoea-rhC4bp and human serum. I left. Again, anti-hc4bp detects higher molecular weight forms of the protein. I put it out. However, no protein could be detected.

The same protein was detected in both the anti-hCD4 and anti-hC4bp antisera in conditioned media. The fact that CD4(187)-C4bp (SCR4) was precipitated indicates that It was shown that the polypeptide was expressed as a fusion polypeptide and assembled into a heptameric form.

We also used 3SS-labeled cysteine (New England Nuclea CD4(187)-C4bp expressed in CO5-7 cells in the presence of r) Immunological precipitation of (SCR4) was performed. We used the rabbit anti-hC4bp serum described above. The resulting 353-labeled protein was precipitated using a 4% to 20% concentration gradient. It was analyzed by 5DS-PAGE. Under non-reducing conditions, we obtained 400 kD to 500 kD A high molecular weight band of kD was detected on the autoradiograph. After redemption, this The band disappeared and a 53.5 kD band appeared. Both bands are negative con. It was not present in the Troll sample. This means that CD4 (187)-c4b established our previous results that p (SCR4) was expressed and assembled into heptamers. .

B, Multimeric CD4 (187)-C4bp (S CR4) We used conventional column chromatography methods to detect CD4(187)-C4bp (SCR4) was purified. We have CD4 (187)-c4bp (SCR 4) Collect conditioned medium 201 obtained from the transformed CHO cell line stably expressing did.

Transformed CHO cell lines are described in Barsoum, U.S. Pat. No. 4,956,288. pJOD, 5CD4, Y187.5CR4,2 by the described electroporation method. was used to transform and prepare CHO cells. Preferably we use CD4-C4b p fusion protein in three columns: first FAST S® (Phar Macia) ion exchange column; second Cu chelate 5EPHARO8E (registered trademark) (manufactured by Pharmacia) column; and thirdly, Zn chelate S Using E PHAROSE (Pharmacia) columns sequentially, CD4 -C4bp fusion protein was purified. However, the fusion protein is partially FA It can be purified by STS (registered trademark).

To perform FAST S® chromatography, we use sodium hydroxide. Adjust the conditioned medium to pH 8.0 using a 5 μm prefilter and It was filtered through a 0.45 μm filter. We prepared the medium at 3 ml/cm for 2 hours for 30 Loaded onto a 0m1 (ID50mm) FAST Q (registered trademark) ion exchange column did. The column was placed in a 5-force ram volume of 50 mM H containing 200 mM NaCl. Washed with EPES buffer, pH 8.0. Next, a solution containing 250mM NaCl CD4-C4bp fusion protein with 50mM HEPES% pH 8.0 was eluted.

We also added a Cu and Zn chelate column (40 ml.

The eluate was purified using 25 mm ID. we in these columns All steps were performed at 4° C. and a flow rate of 0.4 ml/cm for 2 hours. like above Each wash was performed with aomt buffer.

We prepared a Cu chelate column using 50mM aqueous CuCl2 with Cu iodine. was prepared by loading onto chelated sepharose using We run the column twice, first 500mM) Lis, 500mM NaCl5 pH 8.0, then 10mM ) Squirrel, washed with 500mM NaCl, pH 8.0.

Next we transferred the eluate from the FAST Q® column to a Cu chelate column. load on the system. We loaded the column three times, first with 500mM Tris, 500mMNa C1, pH 8,0; second 10 mM Tris, pH 8,0; and third 10 100 mM imidazole, pH 8.0. Next we have C D4-C4bp fusion proteins (10mM), 50mM EDTA, pH It eluted at 8.0. The eluate was 10mM) Lis 500mM NaCl, pH 8.0. 1 I underwent dialysis. Next, we used C Same as u chelate column, Zn chelate) SEPHARO8E (registered trademark) color A sample was prepared.

Next we transferred the dialyzed eluate from the Cu chelate column to a Zn chelate column. load on the system. After loading the sample, we run the column three times as before, first 500mM) Squirrel, 500mM NaCl, pH 8,0? Second 10mM! − Lis pH 8,0: and thirdly 10mM 1'Lis, 100mM imidazole, Washed at pH 8.0. Next, we 6, add 1 CD4-C4b p fusion protein. 0mM 1-Lis, 25mM Imidazole, 500mM NaCl, pH 8.0 It eluted.

We prepared the protein in 20mM HEPESS containing 500mM NaCl. Stored at pH 8, O. In this step, as measured by 5DS-PAGE, C Significant concentrations and purification of D4(187)-CAM (SCR4) were obtained.

Next, we analyzed the purified CD4 (187)-CAM (SCR4) using an electron microscope. I examined it in the mirror. To do this, we (1) prepared a CD4-C4bp fusion protein using a conventional method. Mix glycerol with the nozzle paste and spray it onto the carbon-coated grill nod. Rotational shadowing with China. At high magnification, the molecule can be seen as a number of rods extending from the center. It appeared to have a "spider-like" morphology with shaped arms.

Affinity of C, CD4 (187)-C4bp (4SCR) 1 Instead of the purification by column chromatography described above, we purified CD4 (187) -C4t+p(SCR4) was purified as follows. We are CD4 (187) - Conditioned medium of CHO cells producing C4bp (SCR4) multimeric protein. , 5IOY30 (registered trademark) spiral cartridge (A+aicon, Da Concentrate 50 to 60 times at 4°C using Shrunk. We used concentrated medium as PB without calcium and magnesium. ID7-CNBr5EPHARO8E® affinity equilibrated with S - column at 4° C. at approximately 1 column volume/hour. ID7 is the second immunity of CD4 It is a monoclonal antibody that binds to the globulin-related domain (ID 7 G*Patricia Chisholm of Biogen, lie, ka Transfected CHO expressing full-length CD4 protein was produced by immunizing mice with We produced ID7, Monoclonal antibody ID7. A hybridoma line named G11 was developed in vitro. Deposited in the Toro International Incorporated Culture Collection Ta.

CNBr5EPHAROSE (registered trademark) is Sig+*a Chemical Corp., St., Louts, Missouri. ID7 is It was bound to the resin at a concentration of 0.5 mg/ml essentially according to the manufacturer's instructions.

In general, the antibody concentration on the resin should be adjusted to achieve maximum binding and elution of the fusion protein. It should be kept as close as possible to 0.5 mg/ml in order to

We washed the loaded column with 3-5 ram volumes of PBS and then washed it with 0.5 M N Washed again with aC1 and PBS.

We combined the binding protein with 20 mM) ethylamine pH 11,5 (Pierc e, Rockford, llinois), eluted with 0.5M NaCl . The fractions were immediately neutralized with 1150 volumes of LM HEPES, pH 6,8, and Stored at °C. 5DS-PAGE analysis revealed substantially pure CD4 (187 )-C4b1) (SCR4) protein was revealed. Exchange buffer with PBS. In order to remove the remaining impurities, we used YM30® membrane (A++1c by ultrafiltration on Danvers, Massachusetts) , the preparation was concentrated to approximately 2 mg/ml. Equilibrate the concentrate with PBS 1, 6x50cm SUPERO3E-6® size exclusion column ( Preparative grade, Pharmacia/IJB, Piscatavay, Ne W Jersey). 5DS-PA protein containing fusion protein Identified by GE, stained with Coomassie blue, and pooled into 0.22μ Mille x-GV® filter (MHlipore, Bedford, M The mixture was sterile filtered through an assachusetts. From amino acid analysis, CD4 The extinction coefficient of (187)-C4bp (SCR4) at 280 nm is 1.44A It was determined to be 26 a units/mg-1 cm light path kinibet ml. we are the final product The samples were stored at 4°C until use. For maximum activity, the fusion protein is purified for 3 min. Should be used within ~5 days.

Two types of assays, ELISA assay and syndithia blocking assay Therefore, CD4 (1B?)-C4bp (SCR4) (7) HIV Will It showed the ability to bind to gp120 at 7°.

1, gl yu” 1-mu soil Δ- E showing the binding ability of CD4 (1B?)-C4bp (SCR4) to gp120 LISA assay (ELISA 3) was performed at 5 μg/IIl in PBS. gp120 (A+sericanBio-Technologies, Inc. Commercially available from Cambridge, Massachusetts. gi) by adding 50 μl/well of a The plate was coated and the plate was incubated overnight at 4°C. coati After removing the mixing solution, add 200 μl/well of 2% nonfat dry milk in PBS. Block non-specific binding by Incubated. The blocking solution is then removed and the sample (conditioned medium i.e. Add 50 μl/well of conditioned medium (diluted in 2% skim milk powder in PBS); Plates were incubated for 3 hours at room temperature. The liquid is then removed and the detection antibody Optimally diluted (1:3333) rabbit anti-hC4bp (Calb iochem) was added. Again, the plates were incubated for 1 hour at room temperature.

This solution was then removed and diluted optimally (1:10GG) to allow HRP to bind. 50 μl/ha of goat anti-rabbit-1gG (Organon Teknika) Well added. Incubate the plate for 1 hour at room temperature, then remove the solution and OPD was added and the plates were again incubated at room temperature for 20-30 minutes. I The color reaction was stopped using N sulfuric acid. Measure O, D, at 490 nm Ta. This assay gave a positive result and CD4(187)-C4bp(S CR4) fusion polypeptide was shown to bind to gp120.

We performed another assay (ELISA 4) to confirm these results. , CD4(187)-C4bp (SCR4) aggregates to form a multimer. It has been shown. Add 50 μl/well of 5 μg/ml gp120 solution in PBS Coat an Imron 11 plate with gp120 by was incubated overnight at 4 °C in PBS after removing the O coating solution. Block non-specific binding by adding 200 μl/well of % skimmed milk powder. and incubated for at least 30 minutes at room temperature. Then add the blocking solution Remove the sample (conditioned medium, i.e. diluted in 2% non-fat dry milk in PBS). 50 μl/well of culture medium) was added and incubated at room temperature for 3 hours. this liquid Remove and optimally dilute (1:1000) L, 50 μl of HRP-bound 6C6. l/well and the plate was incubated for 1 hour at room temperature. remove this solution and added OPD. Incubate for 20-30 minutes at room temperature and remove the IN sulfuric acid. to stop the color reaction. O and D at 49On+* were measured. This two The presence of multimers was confirmed by the second assay. Because only multimers gl) It has multiple binding sites that can simultaneously bind to 120 and 6C6 monoclonal. Cells infected with HIV that express gp120 on their surface are transfected with CD4. It fuses with expressing cells to form multinucleated cells (synditia).

Molecules that bind gl) 120 tend to block syndithia formation.

B. D. Walker et al. -Inhibition of Human I+a +aunodeficiencyVirus 5cytitv Forma tion and vtrus Replication by Ca5tan osper+m1ne-1Proc, Natl, Acad, Scm USA 84. C816 as described in pp. 8120-24 (1987). A 6-cell fusion assay was performed. 5X chronically infected with HTLV-r IIB 103 H9 cells were treated with 10M HEPES adjusted to pH 6.8 and 2mM of glutamine and various concentrations of CD4(187)-C4bp (SCR4> Incubate 20% fetal bovine serum for 30 min at 37 °C in the presence of 5% CO2 using Incubated in 100 μl of RPMI 1640 medium supplemented 9 cells are AIDS Re5 search and Reference Rea gent Program, NIH, Bethesda, Maryland commercially available from ). Then, 15×103 C8166 cells (CD4+ (human cord blood lymphocyte line transformed with) [J.

5odroskf et al., “Role of HTLv-111/LAY Enve rope in Syncytium Formulation and Cy topathtcity”, Nature, 322.pp, 470-7 4 (1986)] to 100 μm of medium, and the final volume of each well was adjusted to 20 μm. 0 μm and incubated at 37° C. in the presence of 5% CO2. (C816 6 cells, Dr. Robert 5chooley, Massachusetts sGeneral　Ho5pita1. Boston, Massachusetts etts). Then, after adding C8166 cells After 2 and 4 hours, the total number of syndithia per well was counted. line in contrast In the co-culture, CO5 transfected with pJOD, C4bp, 3 -7 cells (negative control) or transfected with 0KT4A at 25 μg/+al. Using culture supernatant from infected CO5-7 cells (positive control) Ta. (OKT4A is 0rtho Diagnostics 5ysterns , Raritan, New Jersey). contrast and comparison A 50% decrease in Syndithia was considered a positive result. pJOD The culture supernatant of cells transfected with 0 did not inhibit T4A and CD4(187)-C4bp Culture supernatants of cells transfected with (SCR4) significantly inhibited syndithia formation. It was seriously interfering. This indicates that the fusion protein is g It was shown to bind to pL20/160.

B, CD4187-C4b (SCR4c, old V-1 (7) in Inhitroni block 1 Substantially, M. Robert-Guroff et al., Nature, 316.　 CD4(187>-C4 bp (SCR4) (7), old V- in vitro in microreplication assays The blocking ability of 1?11fEl was tested. However, as described in this application, Incubations were performed at 37°C instead of 4°C.

In particular, stepwise dilution 20ttl77)CD4(187)-C4bl)( SCR4) or recombinant soluble CD4 protein (RECEPTIN@trade name sCD4 was provided by Biogen, Inc. Then, add HIV-1 (20 μl; 100 TCIDsll) (to item C below). ) and C8166 cells (10 μm; 40, 000 cells) were pre-incubated. The rsCD4 used was p Chinese hamster ovary cells transformed with BG391 (example m above) It was derived from the cell lineage. In these assays, CD4(187)-C4 Two different preparations of bp(SCR4) were used. One preparation contains CD4 ( A stable CHO cell line (hereinafter referred to as Conditioned cell culture medium from Example ■, Section B). Other preparations include F.A. ST　S@ column from conditioned culture medium from transformed CHO cell line. CD4 (187>-C4bp (SCR4)) was purified by After 0 minutes of infection, three 200 μl RPMI- CD4(187)-C4bp (SCR4) was added in 15 μl portions to 20% FCS. . Incubate plates at 37°C in the presence of 5% CO2 for 4 to 8 Days later, they were examined for syndithia formation, evidence of infection.

As a result, multimeric CD4 (187)-C4bp (SCR4) is associated with HIV-1 sensitivity. 10 molar basis above the concentration of recombinant soluble CD4 required to block staining. It was shown that 0x lower concentrations blocked HIV-1 infection. For example, 30 ( l pM CD4(187)-C4bp(SCR4) (partially purified , and those derived from cell culture media) completely blocked syndithia formation. did. Approximately 30 nM of recombinant soluble CD4 is required to obtain the same results. For OCD4(187)-C4bp (SCR4), it was about 100 pM and At approximately 10 nM, recombinant soluble CD4 was effective against HIV-1 infection of C8166 cells. The protection it provided had declined.

C, CD4187-C4b 5CR4 is an inhuman cell 1'llV-1m Next, CD4(187)-C4bp Tests were conducted showing that (SCR4) inhibits cellular HIV-1 infection. use In this assay, C8166 cells, HIM-1 and the multimeric CD4- Splices generated when incubated with C4bp fusion protein The amount of old V-1+ mRNA was measured.

Recombinant old V-1 was isolated from colon carcinoma cell line 5W480 using CaPOa precipitated pN obtained by transfecting with L4-3. (cell line and plus Mido is AIDS Research and Reference Reage nt Program, NIB, Bethesda, Maryland? (available from ). 107 C8166 cells with 103 TCIDs @ recombinant Old V-1 alone or serially diluted CD4 (1B?)-C4bp (SC Two inks were added together with R4). 48 hours later, by nuclease S1 protection analysis. to determine the amount of spliced HIV-1 mRNA in total cellular RNA. Ta.

A 180 nucleotide single-stranded DNA fragment probe was center Technologies) and labeled the 5' end with 32p. did.

The probe contains all known spliced HIV-1 mRNA molecules [B, Fe1ber et al., “Feedback Regulation of Huma n Immunodeficiency Virus Type l: Exp reaction by the Rev Protein-, J, Virol ,, 64. pp, 3734-41 (1990)] to the splice receptor. It spread. This 180 nucleotide probe (10"cp+a) was Formamide, 0.4M NaCl, 40mM PIPES pH 6.4, and total cellular RNA in 10 μl of buffer containing 1 mM EDTA at 10°C. Ta. Hybridization was carried out overnight at 48°C. hybridization After this, the mixture was treated with 31 nuclease. St does not hybridize Completely digested all probes that were present and all probes that hybridized. was partially digested, yielding a 102 nucleotide protected DNA fragment. 1 80 nucleotide DNA fragments are also produced through viral replication in cells. It also hybridizes with unspliced genomic HIM-I RNA. protected from digestion by 102 nucleotide DNA fragment and 180 nucleotide DNA fragment Both amounts of cleotide fragments were determined by the C4bp fusion protein added as a blocking agent. decreased as the amount of protein increased. From these results, CD4-C4bp The fusion protein allows HIV-1 to enter cells at concentrations ranging from 1 to ng/ml. It was suggested that it could block the infiltration.

K Kango Wataru - CD4 (187) - C4bp (SCR8), CD4 (187) -C4bp (SCR5), CD4 (187) -C4bp (SCR3) and and CD4 187-C4b 5CRI's 1°6CD4 (187)-C4b p (SCR8), CD4 (187) -C4bp (SCR5), CD4 ( 187)-C4bp (SCR3) and CD4 (187)-C4bp (SC Several EL I SA assays were performed to test the production of RI). this The results showed that CO5-7 cells produced all multimeric CD4-C4bp fusion proteins. pJOD, 5CD4. Y187.5CR8, pJOD, 5CD4. Y187 ．． 5CR5, pJOD, 5CD4. Y187.5CR3 and pJOD.

5CD4. It was shown that it was transformed with Y187.5CRI.

pJOD, 5CD4. of CO5-7 cells transformed with Y187.5CR8, In the above examples, except that conditioned medium was used, the 4 iM ELI as previously described was used. SA assays (ELISA 1-4) were performed correctly. ELISA 1-3 It showed a strong positive result. ELISA 4 (plates were coated with gp120) , 6C6 was used as the detection antibody) gave a weakly positive result.

Three different plus codes encoding CD4 (187)-C4bp (SCRI) Six assays were performed on conditioned media of C08-7 cells transformed with mido isolates. Ta. This isolate is 5CR1,1,5CR1,2 and 5CR1,3, respectively. named. The first four assays were described in ELISA Al-4 above. It was done like this. ELISA 4 and ELISA 4 except that antibody 5A8 was used as the detection antibody. A fifth assay (ELISA 5) was performed in a similar manner. Antibody 5A8 is gp1 does not block CD4 binding to CD4, and it blocks domain 2 of CD4. Recognize (see Figure 4). Other monoclonal antibodies with such properties are also , are useful in this assay. Anti-C4bp monoclonal 051-198 Or 051-28 (QuidelS San Dlego, (altfor The 6th assay (EL) was used in the same manner as in ELISA 3, except that ISA 6) was performed.

ELISA 5 (plates were coated with gp120 and 5A8 was used as the detection antibody) positive results were obtained from all three isolates. this thing indicates that this cell produced a protein containing CD4 (187). Ru.

ELISA 1 (plates were coated with anti-hC4bp and 6C6 monoclonal was used as the detection antibody), all isolates gave negative results. Ta. ELISA3 (plates were coated with gp120 and anti-C4bp was the detection antibody) ), a negative result was obtained from 5CR1,1, and 5 False positive results were obtained from CR1,2 and 5CR1,3. ELISA 6 ( Plates were coated with gp120 and detected 051-198 or 051-28. (used as an antibody), positive results from 5CR1,2 and 5CR1,3 The results were obtained. However, 5CRI.

A negative result was obtained from 1. This means that this cell has C which binds to the CD4 site. 41) I) Indicates that a molecule containing both (SCRI) and gp120 was produced. ing. C4bp and 5CR1 were recognized in ELISA 1 and ELISA 3. The reason for this failure is probably due to the polyclonal antiserum and antibody species used. Depends on class. These polyclonals have epitopes in mature human C4bp. It seems to be recognized preferentially.

ELISA 2 (plates were coated with 6C6 and 6C6 was used as detection antibody) ), isolate 5CRI.

A negative result was obtained from 1 and from isolates 5CR1,2 and 5CR1,3. A positive result was obtained. ELISA 4 (plates were coated with gp 120 , 606 was used as the detection antibody), negative results were obtained from isolate 5CR1,1. results were obtained and isolates 5CR1,2 and 5CRI.

A positive result was obtained from 3. These results indicate that CD4(187)-C4bp ( We are consistent in our belief that SCR1) can assemble into multimers.

Other ELISA, ELISA 7 (plates were coated with ID7 and 5A8 pJ) was used as a detection antibody.

D, 5CD4. Y187.5CR5,1, pJOD, 5CD4, Y187.5C R5,2, pJOD, CD4. Y187゜5CR3,2 and pJOD, 5CD 4. Performed with conditioned medium of CO3-7 cells transformed with Y187,5CR3,3 Ta.

All assays gave strong positive results.

Cloning of the DNA encoding the K-Shigoney HBeAg-C4bp fusion polypeptide ning Hepatitis B virus e antigen C4bp (“HBeAg-C4bpn) fusion polypep We constructed several plasmids characterized by DNA sequences encoding Built. These plasmids were constructed in two steps. First, pJOD, C4 bp, 2, that is, the DNA encoding the signal sequence of C4bp and the signal sequence of 5CR8. pJOD between the amino terminus (amino acid +1 position in Figure 1), isolated C4bp (actual A unique five baI site was introduced in this example. This codes for the HB eAg epitope. A site was prepared into which a DNA sequence to be coded could be inserted. On the other hand, the epitope of the other This site can be used to insert DNA sequences that code. In the second step , PCR fragments encoding various HBeAg sequences were inserted into Xbal to generate HBeAg. DNA sequence where the Ag sequence encodes the signal sequence of C4bp and 5CR of C4bp A polypeptide flanked by a DNA sequence encoding 8 was produced.

More specifically, in this first step, the following gap mutation is introduced. A unique aI site was introduced into pJOD, C4bp,2. 1st in AJj-1 A sample of plasmids was linearized. Then the second with XhoI and ml A sample of plasmid was cut. This sample is then denatured and it Convert each piece of DNA into single stranded DNA until it hybridizes, and turn the gear knob. make. The mutant oligomer was annealed into this gap. This oligomer is has an array of : GAGGACCACAATTCTAGACCAAGAACAGCA obtained plastic Repair the smid with Flenow enzyme and dXPT and electroexplode it into HBIOI. and isolated this plasmid, pJOD, C4bp, Xbal. . Soleha has only one Xba1 site, and by that only Xba1 site Therefore, C4b isolated from AAT that coats the first amino acid of 5CR8 at the signal junction with GGT encoding the last amino acid of the p signal sequence. It has the sequence GGTCTAGAAT.

This plasmid was tested as shown below. pJOD, C using XbaI 4 bp, Xbal was linearized and this cleavage was performed using mung bean nuclease. The pieces were blunt ended. This plasmid (without inserting any DNA) is then were religated to produce pJOD, C4bp, Xbal, 0.3. this signal The DNA sequence across the cleavage site is GI Y (-1) As in the original C4bp. Coded n (1) and became GGT AAT. Electroporation was performed on CO8 cells. At the time, this plasmid expressed C4bp as effectively as JOD, C4bp. . And C4bpEL I SA (EL I SA8 nibrate is rabbit anti- coated with hC4bp and sheep anti-hC4bp was used as the detection antibody). Measured at

In the second step, pJOD, C4bp, and Xbal are linearized using Xbal. and it was made blunt ended using mung bean nuclease. HBeA g (2-148), HBeAg (2-138”), HBeAg (2-10 PCR products encoding HBeAg 0) and HBeAg (2-89) were obtained, respectively. ligated into the vector. Plasmid 8. as template for PCR fragment. 1 ．． 5 was used. Plasmid 8.1゜5 is a DNA sequence encoding HBeAg characterized by. It is also known as pHBV139A [Pa5ek et al. , supra]. (Plasmid translation 1.5 is Scotsland, herring Presented by Professor Kenneth Murray of Rose University. ) On the other hand, there is may use plasmid pAMG, ATCC45020, as a PCR template. P The lasmid pAMG was characterized by DNA sequences derived from HBV subcultured ADW. Then, code HBeAg. Plasmid 8 using uI. 1. 5 Digest and produce fragments containing the complete PCR target. The plastic shown below PCR was performed on this fragment using imers. Same for all 4 types of constructs Use the 5' sense primer: 5° GACATTGACCCTTATAA AGAATTT.

This 3' antisense primer is: 5' AACAAC AGTAGTCTCCGGAAGCGT[HBeAg(2-148)]5°AG GGGCATTTGGTGGTCTATAAGC[HBeAg(2-138)] 5' TAATTGTCTGAACTTTAGGCCCAC[HBeAg(2- 100)] and 5°GACATAACTGACTACTAGGTCCCT[H BeAg(2-89)].

pJ digested with xba I, i.e. treated with mung bean nuclease These PCR fragments were ligated using OD, C4bp, and Xbal. This concatenation The following plasmids were manufactured respectively: pJOD, HBeAg(2-148), C4bp, 5CR8pJOD, ) IBeAg (2-138>, C4bp, 5CR8pJOD, HBeAg (2-100>, C4bp, 5CR8 and pJOD, HBeAg (2- 89), C4bp, 5CR8゜These plasmids contain the fusion polypeptides shown below. Each contained a DNA sequence encoding a peptide: HBeAg (2-- 148)-C4bp (SCR8); HBeAg (2-138)-C4bp (SCR8); HBeAg (2-Zoo)-c4bp (SCR8) and and HBeAg (2-89)-C4bp (SCR8).

These constructs combine the C4bp signal sequence with the hepatitis B virus precore signal. can be converted by substituting the sequence, thereby converting the original translation product into an appropriate translation product. Seriously bromo nosing.

The microorganisms and recombinant DNA molecules according to the invention were acquired in the United States on January 24, 1990; Inpitro International, Inc., Lynchcum, Maryland. ・Nodo, Culture Collection (In Vitro International Deposited at al, Inc., culture collection) exemplified by the culture described and shown below. : 5CR1,1; pJOD, 5CD4. YlB? ,5CR1,11VI-1022 1SCR1,2; pJOD, 5CD4. Y1B? ,5CR1,21VI-102 22SCR1,3; pJOD, 5CD4. Y187.5CR1,31VI-10 223SCR11,2; pJOD, 5CD4. Y187.5CRI1.2 1V I-10224SCR8,3; pJOD, 5CD4. Y187.5CR8,31 VI-10225SCR4,2; pJOD, 5CD4. Y187.5CR4,2 1VI-10226SCR4,3; pJOD, 5CD4. Y187.5CR4, 3, IVI-10227187, 5naB1:pJOD, 5cD4. Y1B? , 5naB11VI-10228p170.2:p170.2 1VT-1022 9C4bp, 3: pJOD, C4bp, 3 1V l-10230 also , the following cultures were also deposited at In Vitro International on January 26, 1991: did. : Monoclonal antibody ID7-Gll IVI-10269 Mata'S 1991 The following culture was also deposited at In Vitro International on January 28th. : 5CR3,2; pJOD, 5CD4. Y1g? , 5CR3, 21VI-1027 0SCR3,3; pJOD, 5CD4. Y187.5CR3,3IVI-102 71SCR5,l; pJOD, 5CD4. Y187.5CR5,l IVI-1 0272SCR5,2; pJOD, 5CD4. Y187.5CR5,21VI- 10273 As many embodiments of the invention have been described above, the basic embodiment may be modified to provide other embodiments of the methods and compositions of the invention. It is clear that Therefore, the scope of the present invention is defined in the above specification and and all alternative embodiments defined by the additional claims. It will be understood that this includes all modifications and variations. ; and the present invention as an example It is not intended to be limited by the particular embodiments shown herein.

-14) -%J) -ψ -ψ -ψmouth I++ ψΦ ~ -ron -i Gate bar - 1 - 0Ln　e)Lj”I　O+7’l　OLl’11Φ　to-M　QF　Ln　 o” o ′-o″ to sahero to ~ F/64 N Mu/G6A FIG, 6B FIG　68(con’θ ρGAPf, 6 FIG, 6D l Full 1 ≧′1 BSfEX l　Children's failure 1 Number 6 FI6.6H +j7'7/ljJ de FIG, 8A FIG, 8B abstract The present invention provides multimeric and heteromultimeric fusions with C4 binding protein (C4bp). It relates to proteins, their compositions and methods of using them. In more detail, the book The invention is an aggregation or assembly of C4 bp monomers linked to a functional moiety. The present invention relates to body C4bp fusion proteins. The present invention also provides C4 bp fusion polypeptides , particularly regarding CD4-C4bp fusion polypeptides. Here, CD4-C4bp fusion The synthetic polypeptide is preferably a C4b polypeptide with four short consensus repeat regions. Contains the amino acid sequence of soluble human CD4 protein fused to p monomer.

Off-duty investigation report

Claims (1)

[Claims] 1. A recombinant DNA molecule comprising a DNA sequence encoding a C4bp fusion polypeptide. 2. The DNA sequence is fused to the 5' end of the DNA sequence encoding the C4bp monomer. The recombinant recombinant according to claim 1, comprising a DNA sequence encoding a combined polypeptide moiety. A DNA molecule. 3. 3. A recombinant DNA molecule according to claim 2, wherein the C4bp monomer comprises at most 8 SCRs. 4. The C4bP monomer has 8 SCRs and includes amino acids from positions +1 to +549 in Figure 1, and the C4bp monomer has 5 SCRs and includes amino acids from positions +188 to +549 in Figure 1. a C4bP monomer containing 4 SCRs and containing amino acids from positions +248 to +549 in Figure 1; a C4bp monomer having 3 SCRs and containing amino acids from positions +314 to +549 in Figure 1; C4bP monomer, and C4bp monomer having one SCR and containing amino acids from positions +433 to +549 in Figure 1. 4. A recombinant DNA molecule according to claim 3, selected from the group consisting of: 5. The polypeptide portion may be a target molecule, an enzyme, an enzyme inhibitor, an enzyme substrate, a site Consists of viral receptors, cellular receptors, cellular ligands, bacterial immunogens, parasitic immunogens, viral immunogens, immunoglobulins or fragments thereof that bind to kines, growth factors, colony stimulating factors, hormones and toxins. 3. A recombinant DNA molecule according to claim 2, selected from the group: 6. 6. A recombinant DNA molecule according to claim 5, wherein said polypeptide moiety is a soluble CD4 protein. 7. 7. The recombinant DNA molecule of claim 6, wherein the soluble CD4 protein is selected from the group consisting of CD4(111), CD4(181), CD4(183), CD4(187) and CD4(375). 8. The polypeptide portion is a viral polypeptide that exhibits antigenicity of hepatitis B virus e. 6. A recombinant DNA molecule according to claim 5, comprising a repeptide. 9. The viral polypeptide is selected from HBeAg (2-89), HBeAg (2-100), HBeAg (2-138) and HBeAg (2-148). 9. A recombinant DNA molecule according to claim 8, selected from the group consisting of: 10. The polypeptide moiety is a cellular receptor or cell selected from the group consisting of ICAM1, ELAM1, VCAM1 or VCAMlb and LFA3. 6. The recombinant DNA molecule according to claim 5, which is a cell ligand. 11. The polypeptide portion may include hirudin, the C-terminal peptide of hirudin, and human 6. The recombinant DNA molecule according to claim 5, selected from the group consisting of 12. 3. The recombinant DNA molecule of claim 1 or 2, wherein the DNA sequence encoding the C4bP fusion polypeptide is operably linked to an expression control sequence. 13. The expression control sequence is derived from the genes of prokaryotic or eukaryotic cells or their viruses. SV40 or adenovirus early and late promoters, lac system, trp system, TAC or TRC system, fer major operator and promoter region of diλ, control region of fd coat protein, promoter of 3-phosphoglycerate kinase or other glycolytic enzymes, promoter of acid phosphatase, promoter of yeast α mating factor, baculo 13. The recombinant DNA molecule of claim 12, selected from the group consisting of polyhedral promoters and other sequences of the viral family, and various combinations thereof. 14. The DNA molecule is pJOD. sCD4. Y187. SCR1.1, pJ OD. sCD4. Y187. SCR1.2, pJOD. sCD4. Y187. S CR1.3, pJOD. sCD4. Y187. SCR3.2, pJOD. sCD 4. Y187. SCR3.3, pJOD. sCD4. Y187. SCR4.2, pJOD. sCD4. Y187. SCR4.3, pJOD. sCD4. Y187. SCR5.1, pJOD. sCD4. Y187. SCR5.2, pJOD. s CD4. Y187. SCR8.2, and pJOD. sCD4. Y187. 14. A recombinant DNA molecule according to claim 13, selected from the group consisting of SC R8.3. 15. pJOD. HBeAg (2-89). C4bP. SCR8, pJOD. HBeAg(2-100). C4bP. SCR8, pJOD. HBeAg(2-138). C4bp. SCR8 and pJOD. HBeAg(2-148). C4 bP. The recombinant DNA component according to claim 13, selected from the group consisting of SCR8. Child. 16. A unicellular host transformed with a recombinant DNA molecule according to claim 12. 17. The host is E. col1, Pseudomonas, Bacillus, Streptomyces, fungi, yeast, CHO cells, mouse cells, African Drizal cells, COS-1 cells, COS-7 cells, BSC1 cells, BSC40 cells 17. The unicellular host of claim 16, wherein the unicellular host is selected from the group consisting of cells, BMT10 cells, insect cells, and human and plant cells in tissue culture. 18. The unicellular host according to claim 17, wherein the host is a COS-7 cell or a CHO cell. 19. The host is pJOD. sCD4. Y187. Transformed using SCR4 18. The unicellular host according to claim 17, wherein 20. A C4bP fusion polypeptide comprising a functional moiety and a C4bP monomer. 21. The C4bP monomer has 8 SCRs and includes amino acids from positions +1 to +549 in FIG. 1, and the C4bP monomer has 5 SCRs and includes amino acids from positions +188 to +549 in FIG. A C4bP monomer containing 4 SCRs and containing amino acids from positions +248 to +549 in Figure 1, and a C4bP monomer having 3 SCRs and containing amino acids from positions +314 to +549 in Figure 1. 21. The C4bP fusion polypeptide of claim 20, wherein the C4bP fusion polypeptide is selected from the group consisting of: C4bP monomer having one SCR and comprising amino acids +433 to +549 in FIG. 22. The functional moiety may be a target molecule, enzyme, enzyme inhibitor, enzyme substrate, or cytokine. Viral receptors that bind to proteins, growth factors, colony stimulating factors, hormones and toxins. 21. The C4bP fusion polypeptide of claim 20, selected from the group consisting of a receptor, a cellular receptor, a cellular ligand, a bacterial immunogen, a parasitic immunogen, a viral immunogen, an immunoglobulin or a fragment thereof. 23. 23. The C4bP fusion polypeptide of claim 22, wherein the functional moiety is a soluble CD4 protein. 24. the soluble CD4 protein is selected from the group consisting of CD4(111), CD4(181), CD4(183), CD4(187)-C4bP(SCR5), CD4(187)-C4bP(SCR3) and CD4(375) 24. The C4bP fusion polypeptide of claim 23. 25. The polypeptides include CD4(187)-C4bP(SCR8), CD4(187)-C4bP(SCR5), CD4(187)-C4bP(SCR4), CD4(187)-C4bP(SCR3) and CD4(187)- 24. The C4bP fusion polypeptide of claim 23, selected from the group consisting of C4bP (SCR1). 26. The functional part is a viral polypeptide expressing hepatitis B virus e antigenicity. 23. The C4gbP fusion polypeptide of claim 22, wherein the C4gbP fusion polypeptide is a polypeptide. 27. The polypeptides include HBeAg(2-89)-C4bp(SCR8), HBeAg(2-100)-C4bP(SCR8), HBeAg(2-138)-C4bP(SCR8) and HBeAg(2-148)-C4bP( 27. The C4bp fusion polypeptide of claim 26, wherein the C4bp fusion polypeptide is selected from the group consisting of: 28. 23. The C4bP fusion polypeptide of claim 22, wherein the functional moiety is a cellular receptor or cellular ligand selected from the group consisting of ICAM1, ELAM1, VCAM1 or VCAM1b, and LFA3. 29. The functional portion may include hirudin, the C-terminal polypeptide of hirudin, and hirudin. 23. The C4bp fusion polypeptide of claim 22, wherein the C4bp fusion polypeptide is selected from the group consisting of: 30. The C-terminus of the polypeptide moiety is fused to the N-terminus of the C4bp monomer. 21. The C4bP fusion polypeptide of claim 20. 31. 21. The C4bp fusion polypeptide of claim 20, wherein the functional moiety is selected from the group consisting of toxins, antiretrovirals, enzyme substrates, and enzyme inhibitors. 32. 32. The C4bP fusion polype of claim 31, wherein the functional moiety is AZT. Petite. 33. The functional moieties include enzymes, radionuclides, fluorescent markers and chemiluminescent 21. The C4bP fusion polypeptide of claim 20, wherein the C4bP fusion polypeptide comprises a reporter group selected from the group consisting of target markers. 34. Multimeric C4bP fusion protein. 35. 35. The fusion protein of claim 34, wherein the protein is a multimeric CD4-C4bP fusion protein. 36. The protein is a CD4(187)-C4bP (SCR4) fusion protein 36. The fusion protein of claim 35, wherein the fusion protein is a protein. 37. 35. The fusion protein of claim 34, wherein the protein is a multimeric HBeAg-C4bP fusion protein. 38. 35. The fusion protein of claim 34, wherein the protein is selected from the group consisting of ELAM1-C4bp fusion protein, VCAM1-C4bP fusion protein, VCAM1b-C4bp fusion protein and ICA M1-C4bp fusion protein. 39. 35. The fusion protein of claim 34, wherein said protein is selected from the group consisting of hirudin C4bP fusion protein, hirudin C-terminal polypeptide C4bP fusion protein, and hirulog C4bP fusion protein. 40. encoding a C4bP fusion polypeptide operably linked to expression control sequences. A method for producing a C4bP fusion poly comprising the step of transforming a unicellular host with a recombinant DNA molecule containing a DNA sequence that encodes a C4bP polypeptide. 41. Heteromultimeric C4bP fusion protein. 42. wherein the fusion protein comprises a first functional moiety selected from the group consisting of a viral receptor, a cellular receptor, and a cellular ligand; and a toxin and a cellular ligand. 42. The heteromultimeric C4bP fusion protein of claim 41, comprising a second functional moiety selected from the group consisting of antiretroviral agents and antiretroviral agents. 43. 42. The heteromultimeric C4bp fusion protein of claim 41, wherein said fusion protein comprises a recognition molecule and a reporter molecule. 44. 42. The heteromultimeric C4bP fusion protein of claim 41, wherein the first functional moiety is soluble CD4 and the second functional moiety is AZT. 45. 42. The heteromultimeric C4bP fusion protein of claim 41, wherein said fusion protein comprises at least two different immunogens. 46. transforming a unicellular host with the recombinant DNA molecule of claim 12. A method for producing a multimeric C4bP fusion protein. 47. administering to a patient a therapeutically effective amount of the multimeric CD4-C4bP fusion protein of claim 35 or the heteromultimeric CD4-C4bP fusion protein of claim 42. Yes How to treat patients. 48. 48. The method of claim 47, wherein the fusion protein comprises CD4(187)-C4bP (SCR4). 49. The heteromultimeric CD4-C4bP fusion protein is a fusion protein according to claim 44. 48. The method of claim 47, which is a synthetic protein. 50. Contacting a sample with the heteromultimeric C4bp fusion protein of claim 43. A method for confirming the presence of a target molecule in a sample. 51. 42. A method of determining the presence of a target molecule in vivo, comprising administering to a patient an effective amount of the heteromultimeric C4bP fusion protein of claim 41. 52. A retrovirus containing a DNA sequence encoding a C4bP fusion polypeptide A method for treating a human disease, the method comprising the step of infecting human somatic cells using a virus. 53. 53. The method of claim 52, wherein the DNA sequence encodes a CD4-C4bP fusion polypeptide. 54. Recombinant human C4 binding protein. 55. A recombinant method comprising the step of transforming a unicellular host with a recombinant DNA molecule comprising an expression control sequence operably linked to a DNA sequence comprising the DNA sequence from nucleotide position 4 to nucleotide position 1743 in Figure 1. Production of C4 binding protein Construction method. 56. A recombinant DNA molecule comprising a DNA sequence encoding a non-human C4bP fusion polypeptide. 57. 57. The recombinant DNA molecule of claim 56, wherein the non-human is a mouse or a guinea pig. 58. 57. A unicellular host transformed with a recombinant DNA molecule according to claim 56, wherein said DNA sequence is a non-human C4bP fusion polypeptide. 59. 59. The unicellular host of claim 58, wherein the non-human is a mouse or a guinea pig. 60. A non-human C4bP fusion polypeptide comprising a functional moiety and a non-human C4bP monomer. 61. 61. The C4b P fusion polypeptide of claim 60, wherein said non-human is a mouse or a guinea pig. 62. Multimeric non-human C4bP fusion protein. 63. 63. The multimeric non-human C4bP fusion protein of claim 62, wherein the non-human is a mouse or a guinea pig. 64. Heteromultimeric non-human C4bP fusion protein. 65. 65. The heteromultimeric non-human C4bP fusion protein of claim 64, wherein the non-human is a mouse or a guinea pig. 66. 57. A method for producing a non-human C4 binding protein, comprising the step of transforming a unicellular organism with a recombinant DNA molecule according to claim 56. 67. 67. The method of claim 66, wherein the non-human is a guinea pig or mouse.