WO1991018618A2

WO1991018618A2 - Immunotherapeutic compositions for treating and preventing aids, arc and hiv infection

Info

Publication number: WO1991018618A2
Application number: PCT/US1991/003460
Authority: WO
Inventors: Richard A. Fisher; Catherine Hession; Linda C. Burkly
Original assignee: Biogen, Inc.
Priority date: 1990-05-25
Filing date: 1991-05-23
Publication date: 1991-12-12
Also published as: EP0491888A4; JPH05502166A; EP0491888A1; WO1991018618A3; CA2062758A1; AU7976791A; OA09648A

Abstract

Immunotherapeutic, prophylactic and diagnostic compositions useful in treating or preventing diseases in humans caused by infective agents whose primary targets are T4+ lymphocytes, including acquired immune deficiency syndrome, AIDS related complex and human immunodeficiency virus infection. DNA sequences that code for amino acid variants and derivatives of human CD4, or fragments thereof, that elicit in a human antibodies that bind to HIV gp120. Such DNA sequences are useful in the immunotherapeutic, prophylactic and diagnostic compositions of this invention. A novel screening method for selecting amino acid variants and derivatives of human CD4 that elicit in humans antibodies that bind to HIV gp120, human CD4, or both, useful as therapeutic, prophylactic and diagnostic agents for diseases caused by infective agents whose primary targets are T4+ lymphocytes, including acquired immune deficiency syndrome, AIDS related complex and human immunodeficiency virus infection.

Description

r

IMMUNOTHERAPEUTIC COMPOSITIONS FOR TREATING AND PREVENTING AIDS. ARC AND HIV INFECTION

TECHNICAL FIELD OF INVENTION

5 This invention relates to immunotherapeutic, prophylactic and diagnostic compositions useful in treating or preventing diseases in humans caused by infective agents whose primary targets are T4⁺ lymphocytes. Such diseases include acquired immune

10 deficiency syndrome, AIDS related complex ("ARC") and human immunodeficiency virus ("HIV") infection. More particularly, this invention relates to DNA sequences that code for amino acid variants and derivatives of human CD4, or fragments thereof, that elicit in a human

15 antibodies that bind to HIV gpl20. Such amino acid variants and derivatives may be used in the immunotherapeutic, prophylactic and diagnostic compositions of this invention. This invention also relates to a novel screening method for selecting amino

20 acid variants and derivatives of human CD4 that elicit in humans antibodies that bind to HIV gpl20, human CD4 or both. Such amino acid variants and derivatives identified by this screening assay are useful as therapeutic, prophylactic, or diagnostic agents in

25 humans. BACKGROUND OF THE INVENTION

In humans, the class of immune regulatory cells known as T lymphocytes can be divided into two broad functional classes. The first class comprises helper or inducer T cells, which mediate T cell proliferation, lymphokine release and helper cell interactions for immunoglobulin release. The second class comprises T cytotoxic or suppressor T cells, which participate in T cell-mediated killing and immune response suppression. These two classes of lymphocytes are distinguished, inter alia, by expression of one of two surface glycoproteins: CD4 (m.w. 55,000 - 62,000 daltons) which is expressed on T helper or inducer cells ("T4⁺ lymphocytes"), or CD8 (m.w. 32,000 daltons) which is expressed on T cytotoxic or suppressor cells ("T8⁺ lymphocytes") as a dimeric protein.

In immunocompetent individuals, T4⁺ lymphocytes interact with other specialized cell types of the immune system to confer immunity to or defense against infection [E. L. Reinherz and S. F. Schlossman, "The Differentiation Function Of Human T-Cells", Cell. 19, pp. 821-27 (1980)]. More specifically, T4⁺ lymphocytes stimulate production of growth factors which are critical to a functioning immune system. For example, they act to stimulate B cells, which promote the production of defensive antibodies. They also activate macrophages ("killer cells") to attack infected or otherwise abnormal host cells and they induce monocytes ("scavenger cells") to encompass and destroy invading microbes.

The primary target of certain infective agents is the CD4 surface protein. These agents include viruses, such as retroviruses. When T4⁺ lymphocytes are exposed to human immunodeficiency virus ("HIV") — a retrovirus —' they are rendered non¬ functional. As a result, the host's complex immune defense system is suppressed and the host becomes susceptible to a wide^* range of opportunistic infections. Such immunosuppression is seen in patients suffering from acquired immunodeficiency syndrome ("AIDS") .

AIDS is a disease characterized by severe or, typically, complete immunosuppression and attendant host susceptibility to a wide range of opportunistic infections and malignancies. In some cases, AIDS is accompanied by central nervous system disorders. Complete clinical manifestation of AIDS is usually preceded by AIDS related complex ("ARC") , a syndrome accompanied by symptoms such as persistent generalized lymphadenopathy, fever and weight loss. The human immunodeficiency virus ("HIV") is thought to be the etiological agent responsible for AIDS and its precursor, ARC [M. G. Sarngadharan et al., "Detection, Isolation And Continuous Production Of Cytopathic Retroviruses (HTLV-III) From Patients With AIDS And Pre-AIDS", Science. 224, pp. 497-508 (1984)].* Between 85 and 100% of the AIDS/ARC population test seropositive for HIV [G. N. Shaw et al., "Molecular Characterization Of Human T-Cell Leukemia

(Lymphotropic) Virus Type III In The Acquired Immune Deficiency Syndrome", Science. 226, pp. 1165-70 (1984)].

* In this application, human immunodeficiency virus ("HIV") , the generic term adopted by the human retrovirus subcommittee of the International Committee On Taxonomy Of Viruses to refer to independent isolates from AIDS patients, including human T cell lymphotropic virus type III ("HTLV-III") , lymphadenopathy-associated virus ("LAV"), human immunodeficiency virus type 1

("HIV-1") and AIDS-associated retrovirus ("ARV") , will be used. The genome of retroviruses, such as HIV, contains three regions encoding structural proteins. The σaα region encodes the core proteins of the virion. The pol region encodes the virion RNA-dependent DNA polymerase (reverse transcriptase) . The env region encodes the major glycoprotein found in the membrane envelope of the virus and in the cytoplasmic membrane of infected cells. The ability of HIV to bind to target cell receptors and to cause fusion of cell membranes is controlled by its env gene. These properties are believed to play a fundamental role in the pathogenesis of the virus.

HIV env proteins arise from a precursor polypeptide that, in mature form, is cleaved into a large heavily glycosylated exterior membrane protein having about 481 amino acids — gpl20 — and a smaller transmembrane protein of about 345 amino acids, which may be glycosylated — gp41 [L. Ratner et al., "Complete Nucleotide Sequence Of The AIDS Virus, HTLV- III", Nature. 313, pp. 277-84 (1985)].

The host range of the HIV virus is primarily associated with cells that bear the CD4 surface glycoprotein. Such cells include T4⁺ lymphocytes and brain cells [P. J. Maddon et al., "The T4 Gene Encodes The AIDS Virus Receptor And Is Expressed In The Immune System And The Brain", Cell. 47, pp. 333-48 (1986)]. Upon infection of a human with HIV, the T4⁺ lymphocytes are rendered non-functional. The progression of AIDS/ARC syndromes can be correlated with the depletion of T4⁺ lymphocytes, which display CD4 on their surface. This T cell depletion, with ensuing immunological compromise, may be attributable to both recurrent cycles of infection and to lytic growth from cell- mediated spread of the virus. In addition, clinical observations suggest that HIV is directly responsible for the central nervous system disorders seen in many AIDS patients.

CD4 is an essential component of the T cell surface receptor for HIV. More specifically, it is believed that the HIV envelope glycoprotein (gp 120) selectively binds to CD4 epitope(s), using this interaction to initiate entry into the host cell and to accomplish membrane fusion, which contributes to cell- to-cell transmission of the virus and to its cytopathic effects [A. G. Dalgleish et al., "The CD4 (T4) Antigen Is An Essential Component Of The Receptor For The AIDS Retrovirus", nature. 312, pp. 763-67 (1984); D. Klatzmann et al., "T-Lymphocyte T4 Molecule Behaves As The Receptor For Human Retrovirus LAV", Nature. 312, pp. 767-68 (1984); J. Sodroski et al.. Nature. 322, pp. 470-74 (1986); J. Lifson et al.. Nature. 323, pp. 725-28 (1986)].

During the course of HIV infection, the host mounts both a humoral and a cellular immune response to the virus. These responses include the appearance of antibodies which bind to a number of viral products and which exhibit neutralizing effects or antibody dependent cellular cytotoxic functions [M. Guroff- Robert et al., "HTLV-III-Neutralizing Antibodies In Patients With AIDS And AIDS-Related Complex", Nature, 316, pp. 72-74 (1985); D. D. F. Baris et al., "Virus Envelope Protein Of HTLV-III Represents Major Target Antigen For Antibodies In AIDS Patients", Science. 228, pp. 1094-96 (1985); A. H. Rook et al., "Sera From HTLV- III/LAV Antibody Positive Individuals Mediate Antibody Dependent Cellular Cytotoxicity Against HTLV-III/LAV Infected T Cells", J. Immunol.. 138, pp. 1064-68 (1987)]. Epitopes of the HIV envelope have been identified as important determinants in eliciting a neutralizing antibody response. And, determinants in antibody dependent cellular cytotoxicity ("ADCC") activity include HIV env and, possibly, gag epitopes. It is believed that HIV escapes the effects of neutralizing antibodies is vivo by generating new variants which must still interact with CD4 to maintain a cycle of infection [Traunecker et al.. Nature. 331, pp. 84-86 (1988) (citing B. R. Starcich et al.. Cell. 45, pp. 637-48 (1986); M. Alizon et al.. Cell. 46, ^'pp. 63-74 (1986); R. Willey et al., Proc. Natl. Acad. Sci. USA 83, pp. 5038-42 (1986); B. Hahn et al., Science. 232, pp. 1548-53 (1986))].

Therapeutics based upon human soluble CD4 proteins have been proposed for the treatment and prevention of the HIV-related infections AIDS and ARC. The nucleotide sequence and a deduced amino acid sequence for cDNA encoding full length human CD4 have been reported [P. J. Maddon et al., "The Isolation And Nucleotide Sequence Of A cDNA Encoding The T Cell Surface Protein T4: A New Member Of The Immunoglobulin Gene Family", Cell. 42, pp. 93-104 (1985); D. R.

Littman et al., "Corrected CD4 Sequence", Cell. 55, p. 541 (1988)].

Soluble human CD4 proteins have been constructed by truncating mature, full-length CD4 at amino acid 375, eliminating the transmembrane and cytoplas ic domains. Such proteins have been produced by recombinant techniques [R. A. Fisher et al., "HIV Infection Is Blocked In Vitro By Recombinant Soluble CD4", Nature. 331, pp. 76-78 (1988)]. It is believed that recombinant, soluble human CD4 proteins ("rsT4" or "rsCD4") advantageously interfere with the CD4/HIV interaction by blocking or competitive binding mechanisms that inhibit HIV infection of cells expressing CD4. By acting as soluble virus receptors, soluble human CD4 proteins may be used as anti-viral therapeutics to inhibit HIV binding to T4⁺ cells. Other proposed methods for treating or preventing AIDS and ARC have focused on the development of anti-retroviral agents that target the reverse transcriptase enzyme of HIV, thereby interfering with viral replication. These agents include, for example, suramin, azidothymidine ("AZT") and dideoxycytidine [H. Mitsuya et al., "3'-Azido-3'-Deoxythymidine (BW A509U) : An Antiviral Agent That Inhibits The Infectivity And Cytopathic Effect Of Human T-Lymphotropic Virus Type III/Lymphadenopathy- Associated Virus Jn Vitro". Proc. Natl. Acad. Sci. USA.

82, pp. 7096-7100 (1985); H. Mitsuya and S. Broder, "Inhibition Of The £n Vitro Infectivity And Cytopathic Effect Of Human T-Lymphotropic Virus Type III/Lymphadenopathy-Associated Virus (HTLV-III/LAV) By 2• ,3*-Dideoxynucleosides", Proc. Natl. Acad. Sci. USA.

83, pp. 1911-15 (1986); R. Yarchoan et al., "Administration Of 3'-Azido-3'-Deoxythymidine, An

Inhibitor Of HTLV-III/LAV Replication, To Patients With AIDS or AIDS-Related Complex", Lancet. pp. 575-80 (1986)].

Although each of these agents has exhibited activity against HIV in vitro, only AZT has demonstrated clinical benefits in properly designed placebo-controlled clinical trials. An increasing number of patients receiving AZT, however, tolerate only low doses of the drug. Certain dosage regimens of AZT have been reported to be lymphotoxic rYarchoan et al.. supra] . AZT administration in effective amounts also has been accompanied by undesirable and debilitating side effects, such as granulocytopenia and anemia. Over the long term, therefore, hematologic toxicity appears to be a significant limiting factor in the use of AZT in the treatment of AIDS and ARC [D. D. Richman et al.-, "The Toxicity Of Azidothymidine (AZT) In The Treatment Of Patients With AIDS And AIDS-Related Complex: A Double-Blind, Placebo-Controlled Trial", N. Eng. J. Med.. 317, pp. 192-97 (1987)].

Other prophylactic and therapeutic regimens are based on agents exhibiting anti-retroviral activity against steps in the viral replicative cycle other than reverse transcription [PCT patent application WO 87/03903]. Such methods include the administration of glucosidase inhibitors, such as the plant alkaloid castanospermine, which modify glycosylation of envelope glycoproteins of HIV-infected cells by interfering with the normal processing of N-linked oligosaccharides on those glycoproteins. Glucosidase inhibitors are believed to cause reduced expression of functional HIV envelope protein at the cell surface and to inhibit production of infectious virus particles. Such anti- retroviral agents, however, may exert toxic effects on cellular metabolism at higher doses when administered as a monotherapy.

Various types of vaccines are also being investigated as potential prophylactic and/or therapeutic agents for HIV infection [W. C. Goff, "Development And Testing Of AIDS Vaccines", Science. 241, pp. 426-32 (1988)]. For example, the potential utility of anti-idiotypic antibodies elicited in animals by mouse monoclonal anti-CD4 antibodies has been studied. See, e.g., A. G. Dalgleish and R. C. Kennedy, "Anti-idiotypic Antibodies As Immunogens: Idiotype-Based Vaccines", Vaccine. 6, pp. 215-20 (1988); A. G. Dalgleish et al., "Therapeutic Strategies Against HIV Based On The CD4 Molecule: Monoclonal Antibody Therapy, Soluble CD4 And Anti-Idiotype Vaccines", Fourth International Conference On AIDS. June 1988, Book 1, Abstract 3061; A. G. Dalgleish et al., "Neutralization of HIV Isolates By Anti- idiotypic Antibodies Which Mimic The T4 (CD4) Epitope: A Potential AIDS Vaccine", Lancet. Nov. 7, 1987, pp. 1047-50; T. C. Chanh et al., "Monoclonal Anti- idiotypic Antibody Mimics The CD4 Receptor And Binds Human Immunodeficiency Virus", Proc. Natl. Acad. Sci. USA. 84, pp. 3891-95 (1987); Q. J. Sattentau et al., "Antisera To Leu3a With Anti-idiotypic Activity React With gpllO/130 Of HIV-1 And LAV-2", Third International Conference On AIDS. Stockholm, Sweden, June 1987, p. 160, Abstract TH.9.4 and R. C. Kennedy et al., "Internal Image Anti-Idiotypes Representative Of Homobodies Mimic The CD4 Molecule And Bind Human Immunodeficiency Virus", Third International Conference On AIDS. June 1987, p. 160, Abstract TH.9.5.

Despite these efforts, the need still exists for alternative immunotherapeutic agents, methods, and strategies for the treatment and prevention of AIDS, ARC and HIV infection.

DISCLOSURE OF THE INVENTION

The present invention solves the problems referred to above by providing amino acid variants and derivatives of human CD4, or fragments thereof, that elicit in humans antibodies that bind to HIV gpl20. Also provided are recombinant DNA molecules that code for such amino acid variants and derivatives, and unicellular hosts transformed with those DNA molecules. The anti-HIV gpl20 antibodies elicited by the amir_o acid variants and derivatives of this invention are useful for the detection, prevention and treatment in humans of diseases caused by infective agents whose primary targets are T4⁺ lymphocytes, for example, the HIV-related diseases AIDS and ARC. The present invention also provides diagnostic, prophylactic and therapeutic compositions comprising the above-described amino acid variants and derivatives, in either monovalent or polyvalent form, useful for detecting, preventing and treating in humans diseases caused by infective agents whose primary targets are T4⁺ lymphocytes, for example, the HIV- related diseases AIDS and ARC.

The present invention further provides a novel screening process, using a nonhuman, transgenic mammalian model, for selecting variants and derivatives of human CD4 that elicit in humans antibodies that bind to HIV gpl20, human CD4 or both. Such variants and derivatives, by virtue of eliciting those antibodies, are therapeutic and prophylactic in humans for diseases caused by infective agents whose primary targets are T4⁺ lymphocytes, for example, the HIV-related diseases AIDS and ARC. The screening process of this invention comprises the steps of (1) immunizing nonhuman, transgenic mammals that express human CD4, or a fragment thereof, with variants or derivatives of human CD4 and (2) screening the sera of the immunized mammals for antibodies that bind to HIV gpl20, antibodies that bind to human CD4, or both. The present invention further provides a rational drug design scheme comprising the steps of (1) comparing the amino acid sequences of human CD4 and naturally occurring primate CD4 proteins; (2) altering the human CD4 amino acid sequence at one or more of the sites of amino acid divergence between human CD4 and naturally occurring primate CD4 proteins; and (3) testing the amino acid variants in the screening process of this invention. Preferred naturally occurring primate sequences from which to design variants are cynomolgus monkey CD4, rhesus monkey CD4, and chimpanzee CD4.

Those amino acid variants of human CD4 derived from the rational drug design scheme that elicit in humans antibodies that bind to HIV gpl20 are preferred in the diagnostic, prophylactic and therapeutic proteins of this invention.

This invention also provides, as most preferred amino acid variants, rhesus monkey CD4, cynomolgus CD4, chimpanzee CD4, and soluble fragments thereof. Also provided are DNA sequences coding for those proteins, recombinant DNA molecules containing those DNA sequences and unicellular hosts transformed with those molecules.

BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1A-1C ("Figure 1") are schematic outlines of the construction of cynomolgus CD4 subclones pSQ131, pS 134 and pSQ136.

Figure 2 depicts the DNA sequence of the synthetic polylinker of sequencing vector pNN12. Figure 3 depicts the DNA and amino acid sequences of the 406 bp NcoI/BspMI fragment from human CD4 Clone DC213-5.

Figure 4 depicts the composite nucleotide sequence and the deduced amino acid sequence of full- length cynomolgus CD4 protein obtained from overlapping clones pSQ131, pSQ134, and pSQ136. The translation start codon is located at the methionine (AA_. ) at nucleotides 171-173 and the mature N-terminus is located at the lysine (AA ) at nucleotides 246-248. The signal sequence cleavage site is marked by an arrow.

In Figure 4, the amino acid sequence of soluble cynomolgus CD4 protein appears between AA - AA_₇_. The signal sequence cleavage site is indicated with an arrow.

Figure 5 demonstrates that soluble cynomolgus CD4 protein has 94.250% similarity and 91.250% identity to soluble human CD4 protein (AA__2g-AA₃₇₅) . The mismatched amino acids are marked with an asterisk. The signal sequence cleavage site is indicated with an arrow.

In Figure 5, and in subsequent figures depicting only amino acid sequences, the amino acids are represented by single letter codes as follows:

Figure 6 depicts the oligonucleotide primers used for the cloning of soluble rhesus CD4 protein and soluble chimpanzee CD4 protein. The primers were all chosen from regions of 100% nucleotide homology between human CD4 protein and cynomolgus CD4 protein. Figure 6 lists the location of each primer in the nucleotide sequence of cynomolgus CD4 protein set forth in

Figure 4. Figure 7 depicts the DNA sequence of the synthetic polylinker of sequencing vector pNN08.

Figure 8 depicts the nucleotide sequence and the deduced amino acid sequence of the rhesus CD4 protein insert of subclone pSQ146. Figure 9 depicts the DNA sequence of the synthetic polylinker of sequencing vector pNNll.

Figure 10 depicts the nucleotide sequence and the deduced amino acid sequence of the rhesus CD4 protein insert of subclone pSQ162. Figure 11 is a schematic outline of the construction of pDGlOO, a chimeric rhesus(5')- human(3') soluble CD4 protein mammalian expression vector.

Figure 12 is a diagram of the mammalian expression vector pBG341. Figure 13 depicts the nucleotide sequence and the deduced amino acid sequence of the CD4 DNA insert of pDGlOO.

Figure 14 is a schematic outline of the construction of pBG341.rhT4, a soluble rhesus CD4 protein mammalian expression vector.

Figure 15 depicts the nucleotide sequence and the deduced amino acid sequence of soluble rhesus CD4 protein (AA_₂₅-AA₃₇₅) from pBG341.rhT4. The translation start codon is located at the methionine (AA_₂ ) at nucleotides 170-172 and the mature N-terminus is located at the lysine (AA^ at nucleotides 245-247.

Figure 16 demonstrates that soluble rhesus CD4 protein has 99.750% similarity and 99.500% identity to the 400 amino acids of soluble cynomolgus CD4 protein. The mismatched amino acids are marked with an asterisk. The signal sequence cleavage site is marked with an arrow.

Figure 17 demonstrates that soluble human CD4 protein has 94.264% similarity and 91.272% identity to soluble rhesus CD4 protein. The mismatched amino acids are marked with an asterisk. The signal sequence cleavage site is marked with an arrow.

Figures 18A-18B ("Figure 18") are schematic outlines of the construction of pBG341JOD.rhT4, a soluble rhesus CD4 protein mammalian expression vector. Figure 19 is a photograph of a Coomassie blue stained SDS-PAGE gel displaying purified, soluble rhesus CD4 protein expressed by CHO cells transformed with pBG341JOD.rhT4. Figure 20 depicts the nucleotide sequence and deduced amino acid sequence of soluble chimpanzee CD4 protein (AA_₂₅~AA₃₇₅) from clone pSQ205. The translation start codon is located at the methionine (AA_₂₅) at nucleotides 96-98 and the mature N-terminus is located at the lysine (AA_X) at nucleotides 171-173.

Figure 21 depicts the nucleotide sequence and deduced amino acid sequence of soluble chimpanzee CD4 protein (AA_₂₅-AA_3?4) from clone pSQ200. The translation start codon is located at the methionine (AA_₂₅) at nucleotides 96-98 and the mature N-terminus is located at the lysine (AA_χ) at nucleotides 171-173.

Figure 22 demonstrates that the 1294 nucleotides of soluble chimpanzee CD4 protein from clone pSQ200 differ from the corresponding 1294 nucleotides of soluble chimpanzee CD4 protein from clone pS 205 at four sites: nucleotide 265, nucleotide 1007, nucleotide 1271, and nucleotide 1293. These sites are marked with an asterisk. Figure 23 demonstrates that the 399 amino acids of soluble chimpanzee CD4 protein from clone pSQ200 (AA_₂₅-AA₃₇₄) have 99.749% similarity and 99.749% identity to the corresponding 399 amino acids of soluble chimpanzee CD4 protein from clone pSQ205. The mismatched amino acids are marked with an asterisk. The signal sequence cleavage site is marked with an arrow.

Figure 24 demonstrates that the 399 amino acids of soluble chimpanzee CD4 protein (AA_₂ -AA₃_.) from clone pSQ200 have 99.248% similarity and 98.997% identity to the corresponding 399 amino acids of soluble human CD4 protein (AA_₂₅-AA_3?4) . The mismatched amino acids are marked with an asterisk. The signal sequence cleavage site is marked with an arrow. Figure 25 depicts the human CD2 genomic and cDNA fragment subcloned into vector Bluescript KS.

Figure 26 depicts the human CD2 3'-flanking DNA fragment subcloned into vector poly III-I. Figure 27 depicts the construction of vector

PATY.6, which contains a full-length human CD4 protein DNA sequence.

Figure 28 depicts the nucleotide sequence and the deduced amino acid sequence of the full-length human CD4 protein sequence (AA__2g-AA₄₃₃) in PATY.6. The translation start codon is located at the methionine (AA_₂ ) at nucleotides 184-186, the mature N-terminus is located at the lysine (AA ) at nucleotides 259-261, and the last amino acid of the protein is located at the isoleucine (AA₄₃₃) at nucleotides 1555-1557.

Figure 29 depicts the construction of the human CD4 transgene.

Figure 30 is a FACS analysis depicting, in graphic form, the expression of human CD4 protein on thymocytes and splenocytes in human CD4 transgenic mice ("Tg") and nontransgenic mice ("NTg") . The x-axes show log fluorescence intensity. The y-axes show relative cell number (linear scale) .

Figure 31 depicts, in graphic form, the anti- human recombinant soluble CD4 protein ("rsCD4" or

"rsT4") antibody titer elicited by immunization with human rsCD4 in CD4 transgenic ("Tg") and nontransgenic ("NTg") mice.

Figure 32 depicts, in graphic form, the results of immunofluorescent staining of human CD4- bearing cells with sera from human CD4 transgenic ("Tg") and nontransgenic ("NTg") mice, both immunized with human rsCD4 (dashed lines) , and from unimmunized mice (negative control) (dotted lines) . The solid lines represent staining by the fluorescently labelled second antibody alone. The graphs are plotted as relative cell number versus log fluorescence intensity.

Figure 33 depicts, in graphic form, anti- rhesus rsCD4 and anti-human rsCD4 antibody titers from transgenic ("Tg") and nontransgenic ("NTg") mice, both immunized with rhesus rsCD4.

Figure 34 depicts, in graphic form, the results of immunofluorescent staining of rhesus, human and activated-human peripheral blood lymphocytes: (1) with human Leu3a monoclonal antibody (positive control) (top row, dotted lines) ; (2) with the second step reagent alone (negative control) (top row, solid lines); (3) with anti-rhesus rsCD4 transgenic mouse sera (dotted lines, middle row) ; (4) with anti-rhesus rsCD4 nontransgenic mouse sera (dotted lines, bottom row) ; and (5) with sera from nontransgenic mice immunized with an irrelevant antigen (negative control) (solid lines, middle and bottom rows) . The graphs are plotted as relative cell number versus log fluorescence intensity.

Figure 35 depicts, in graphic form, HIV gpl20-binding activity in sera of transgenic mice ("Tg") and nontransgenic mice ("NTg"), both immunized with rhesus rsCD4. The data are plotted as absorbance versus serum dilution.

Figure 36 depicts, in graphic form, the kinetics of appearance of human rsCD4 binding activity (left panel) and HIV gpl20 binding activity (right panel) in two transgenic ("Tg") (line 313) mice (solid circles and squares) and two nontransgenic ("NTg") mice (open circles and squares) , both immunized with rhesus rsCD4, and in two negative control mice immunized with an irrelevant antigen (triangles) . The data are plotted as antibody titer versus days post- immunization. Figure 37 depicts, in graphic form, the percent anti-gpl20 binding activity (left panel) and anti-human rsCD4 binding activity in serum fractions isolated by gpl20-affinity chromatography of sera from transgenic (closed bars) and nontransgenic (open bars) rhesus rsCD4-immunized mice.

Figure 38 presents anti-gpl20 IgG antibody titers for a rhesus rsCD4-primed transgenic mouse and control mice. Figure 39 depicts, in graphic form, the results of immunofluorescent staining of transformed CHO cells expressing recombinant gpl60 or LFA-3 on their surface with: two negative control reagents (A) ; a gpl20-specific monoclonal antibody (B, C and D) ; and sera from human CD4 transgenic mice immunized with an irrelevant antigen (sera A) , with an irrelevant antigen followed by challenge with HIV gpl20 in saline (sera B) and with rhesus rsCD4 followed by challenge with HIV gpl20 in saline (sera C) (E and F) .

DETAILED DESCRIPTION OF THE INVENTION

As used herein, "CD4" means any CD4 protein encoded by a naturally occurring CD4 gene.

As used herein, an "amino acid variant" or "variant" of human CD4 is a polypeptide having an amino acid sequence differing from that of human CD4, or a fragment thereof, at one or more positions. Such amino acid variants may be produced synthetically, or by recombinant DNA technology, for example, by utagenesis of the human CD4 gene or variants thereof. Such procedures are well known in the art.

As used herein, a "derivative" of human CD4 is human CD4, or a fragment thereof, that has been covalently modified, for example, with dinitrophenol, in .order to render it im unogenic in humans. The derivatives of this invention also include derivatives of the amino acid variants of this invention. Derivatives also include fragments of human CD4.

As used herein, the term "immunotherapeuti- cally effective amount of an amino acid variant or derivative of human CD4, or fragments thereof" refers to an amount of one or more immunogenic CD4 proteins according to this invention that elicits a sufficient titer of anti-HIV gpl20 antibodies to treat or prevent HIV infection.

It will be understood that by following the screening process of this invention, described infra. one of skill in the art may determine without undue experimentation whether a particular variant or derivative would be useful in the diagnosis, prevention or treatment in humans of HIV infection. Moreover, the rational drug design scheme of this invention, described infra, allows one of skill in the art to determine, without undue experimentation, which variants and derivatives are most likely to be revealed by the screening process of this invention as eliciting in humans antibodies that bind to HIV gpl20 and/or human CD4.

Variants and derivatives of the present invention are those that elicit anti-HIV gpl20 antibodies. Such variants and derivatives are referred to herein as "immunogenic CD4 proteins".

Preferred variants to be tested in the screening process of this invention have one or more amino acid differences from human CD4 between positions approximately corresponding to amino acids 1 to 375 (i.e., the CD4 extracellular region).

Other preferred variants and derivatives are those corresponding to soluble fragments of human CD4 capable of binding to HIV gpl20. Such preferred variants and derivatives include those corresponding approximately to AA₁-AA_3?5, AA₁~AA₁₈₀ and AA₁~AA₁₁₃ of human CD4, as depicted in figure 28. Alternatively preferred variants and derivatives include those corresponding approximately to AA₃-AA_3??, AA₃-AA_lg2 and AA,-AA,,_e of PCT patent application PCT/US88/02940, herein incorporated by reference. Reference should also be made to Littman, Cell. 55, p. 541 (1988), which describes the correct signal sequence cleavage site of human pre-CD4, which was published after the filing date of PCT/US88/02940.

Preferred amino acid variants include naturally occurring amino acid variants, i.e., CD4 or fragments thereof that are derived from nonhuman mammals, preferably nonhuman primates.

Most preferably, variants to be tested in the screening assay of this invention will be chosen from the group consisting of rhesus monkey CD4, cynomolgus monkey CD4, chimpanzee CD4, and soluble fragments thereof. Rhesus monkey soluble CD4 (AA. - A_3?5 of Figure 15) is particularly preferred.

The immunogenic CD4 proteins of this invention also include polymeric forms of the variants and derivatives of human CD4 and fragments thereof. These polymeric forms include, for example, one or more variants and/or derivatives that have been crosslinked with crosslinkers such as avidin/biotin, gluteraldehyde or dimethysuberimidate. Such polymeric forms also include polypeptides containing two or more tandem or inverted contiguous immunogenic CD4 sequences, produced from multicistronic mRNAs generated by recombinant DNA technology.

While not wishing to be bound by theory, applicants believe that the immunogenic CD4 proteins of this invention are prophylactic and therapeutic because they elicit in humans a "first wave" of antibodies, which in turn elicit in the immunized humans a "second wave" of anti-idiotype antibodies that bind to HIV gpl20. The rational drug design scheme of this invention comprises the steps of (1) comparing the amino acid sequences of human CD4 and primate CD4 proteins; (2) altering the human CD4 amino acid sequence at one or more sites corresponding to the sites of amino acid divergence between primate CD4 and human CD4; and (3) testing the amino acid variants in the screening process described infra. Preferred primate CD4 proteins to be used in the first step of the rational drug design scheme include cynomolgus monkey CD4, rhesus monkey CD4 and chimpanzee CD4. The preferred screening process of this invention comprises the steps of (1) immunizing a transgenic, nonhuman mammal that expresses human CD4, or a fragment thereof, with a variant or derivative of human CD4, or a fragment thereof, and (2) screening the serum of the immunized mammal for antibodies that bind to HIV gpl20. Another screening process of this invention comprises the steps of (1) immunizing a transgenic, nonhuman mammal that expresses human CD4, or a fragment thereof, with a variant or derivative of human CD4, or a fragment thereof, and (2) screening the serum of the immunized mammal for antibodies that bind to human CD4. In a further screening process of this invention, the serum of the immunized mammal is screened both for antibodies that bind to human CD4 and for antibodies that bind to HIV gpl20.

It should be noted that a naturally occurring amino acid variant must be tested in a transgenic mammal other than that from which the variant is derived. While any transgenic nonhuman mammal expressing human CD4 is useful in the screening process of this invention, transgenic mice are preferred.

DNA sequences coding for full-length human CD4 or for fragments of human CD4 that bind to

HIV gpl20 (e.g., a DNA sequence coding for AA__2g-AA₃₇₅ of CD4) are useful in generating transgenic mammals for use in the screening process of this invention. The full-length human CD4 sequence of Figure 28 is preferred. Alternatively, one could use any of the full-length human CD4 sequences described in PCT patent application PCT/US88/02940, supra. In addition, genomic DNA coding for human CD4 may be isolated by standard procedures and used to generate the transgenic mammals of this invention. Synthetic DNA coding for human CD4 also may be employed.

The DNA coding for human CD4, or a fragment thereof, must be operatively linked at both ends to noncoding expression control sequences prior to transgenic incorporation into the mammalian genome. The 5'-noncoding DNA sequence should comprise transcriptional and translational regulatory elements, including a promoter, which are functional in the particular transgenic mammal utilized. The 3'- noncoding DNA sequence should comprise transcriptional and translational regulatory elements, including a poly A addition site, which are functional in the particular transgenic mammal utilized. Preferably, the 5' and 3' expression control sequences will be specific for bone marrow-derived cells of the transgenic mammal.

Lymphocyte-specific enhancers that function in the transgenic mammal also may be useful to increase expression of the human CD4, or a fragment thereof.

The 5'- and 3 •-noncoding DNA may be derived from the sequences normally adjacent to human CD4 coding DNA (especially if genomic DNA is used as the source for the human CD4 gene) , except that those sequences may not be used if they are inoperative in the transgenic mammal. Alternatively, these regulatory elements may be derived from the 5•- and 3*-noncoding regions adjacent to other genes. For example, such regions could be derived from viruses such as adenovirus, bovine papilloma virus, Simian virus 40, cytomegalovirus, or the like, where these sequences are associated with a gene that is highly expressed, and where these sequences are functional in the transgenic mammal. Preferably, however, the 5' and 3' regulatory sequences will be those associated with a highly expressed gene of the transgenic mammal. Most preferably, a highly expressed gene specifically expressed in bone marrow-derived cells will be used. These most preferred regulatory sequences could, for example, be derived from those flanking the structural genes of CD2, CD4, CD3, lymphocyte tyrosine kinase, MHC Classes I and II, interleukin-2, or interleukin-2 receptor. The flanking sequences of the CD2 structural gene are particularly preferred.

Transgenic incorporation of the human CD4 gene, or a fragment thereof, and the desired 5*- and 3'-noncoding sequences into mice may readily be accomplished by known procedures. See, e.g., B. Hogan et al. , "Manipulating The Mouse Embryo: A Laboratory Manual", Cold Spring Harbor Laboratory (1986). Those of skill in the art can adapt, without undue experimentation, these known procedures to produce nonhuman, transgenic mammals other than mice expressing human CD4.

The immunization of the transgenic mammal with the human CD4 variant or derivative may be accomplished by standard procedures. Preferably, the variant or derivative will be administered with an adjuvant, such as complete or incomplete Freund's adjuvant. The first injection preferably will be about 2 to 4 mg variant or derivative per kg transgenic mammal body weight. Typically, the transgenic mammal is boosted once with about 2 to 4 mg variant or derivative per kg transgenic mammal body weight on one of days 35-40 post-initial injection.

The immunized transgenic mammals should be bled weekly and the serum from each blood sample assayed for antibodies binding to HIV gpl20, human CD4, or both.

The presence of antibodies binding to human CD4 may be detected using any method that specifically detects binding to human CD4 in its native transmembrane conformation. Preferably, binding to human peripheral blood lymphocytes will be used to detect antibodies binding to human CD4.

Human peripheral blood lymphocytes ("PBLs") are isolated according to standard procedures.

According to the preferred protocol, aliquots of the human PBLs (approximately 5 x 10⁵ to about 1 x 10⁶ cells) are incubated at 4°C for 30 minutes in 50-100 ml of buffer (phosphate buffered saline ("PBS")/2% fetal calf serum ("FCS")/0.02% sodium azide) into which sera from an immunized transgenic mammal has been diluted 10- to 100-fold. As a negative control, another aliquot of human PBLs is incubated with a control serum from a mammal of the same species that has been "mock- immunized" with adjuvant alone (no human CD4 variant or derivative) according to the same protocol as the transgenic mammal. Alternate control sera include serum from the transgenic mammal prior to immunization, sera from nonimmunized mammals of the same species as the transgenic mammal, as well as commercially available Ig fractions from the same species as the transgenic mammal.

Each aliquot of PBLs is then washed three times in 1 ml of buffer (PBS/2% FCS/0.02% sodium azide) . Each aliquot of washed human PBLs is incubated with a fluor-conjugated antibody that is specific for immunoglobulins of the transgenic mammal (at about 10 to 20 μg/ml in the wash buffer) for about 30 minutes at about 4^βC. For example, if serum from transgenic mice is being tested, FITC-conjugated goat anti-mouse Ig might be used. Such fluor-conjugated antibodies are commercially available, but also can be generated by well known methods. The cells are then washed two times as described above and analyzed using a fluorescence activated cell sorter ("FACS") using conventional procedures. See generally H. M. Shapiro, Practical Flow Cvtometry. Alan R. Liss, Inc., New York, New York (1985) .

The FACS machine generates a histogram depicting the relative number of cells (y-axis) having a particular fluorescence intensity (x-axis) . Such a histogram for human PBLs incubated with control serum would show approximately a normal distribution centered on a relatively low fluorescence intensity, due to non- specific binding and to auto-fluorescence. PBLs incubated with transgenic serum containing antibodies that bind to human CD4 display that non-specific "control" fluorescence distribution, but additionally display an approximately normal distribution of cells centered on a higher fluorescence intensity. The existence of this second, more intensely fluorescent, population of cells is evidence of specific binding of serum antibodies from the transgenic mammal to human CD4. __ .

The presence in sera of the immunized transgenic mammals of antibodies binding to HIV gpl20 may be detected using standard procedures, for example ELISA, radioimmunoassay, and the like. The gpl20 used in these assays may be provided by cells infected with HIV, by HIV itself, by host cells transformed with the gene for HIV gpl20, or by isolated gpl20. Preferably, HIV gpl20 will be obtained from a unicellular host 'transformed with the HIV gpl20 gene. Such a transformed cell is described, for example, in Laskey et al., "Neutralization Of The AIDS Retrovirus By Antibodies To A Recombinant Envelope Glycoprotein", Science. 233, pp. 209-12 (1986). In addition, HIV gpl20 is available commercially. According to the preferred protocol, antibodies binding to HIV gpl20 are detected as follows. Microtiter plates (96 wells each) are coated with purified HIV gpl20 at 5 μg/ml in PBS (50 μl/well) for about two hours at about 37^βC, or overnight at about 4°C. No difference is found between coating at 37^βC for 2 hours or overnight at 4°C. Plates are washed and then blocked with PBS/1% bovine serum albumin ("BSA")/0.01% Tween-20/0.05% NaN₃ for about 1 hour at room temperature. Dilutions of sera, or of a mouse monoclonal antibody specific for HIV-1 gpl20 are added to each well (50 μl/well) , and the plates are incubated at about 37^βC for about 2 hours. Serum dilutions are made in PBS/1% BSA/0.01% Tween-20/0.05% NaN₃) . Then, the plates are washed with PBS/0.01% Tween-20/0.05% NaN₃. Alkaline phosphatase-coupled goat anti-mouse IgG (Fc specific) antibody is added to each well at a 1:1000 final dilution in PBS/1% BSA/0.01% Tween-20/0.05% NaN₃ and the plates are incubated for about 1 hour at about 37^βC. The plates are washed once again, and the substrate 4-nitrophenylphosphate (PNPP) (10 mg/ml in 0.1 M glycine/1 mM ZnCl₂/lm M MgCl₂«6H₂0, pH 10.6) is added. Absorbance is read at 405 nm. Results are expressed as the reciprocal of the dilution which gives 50% binding relative to the standard control antibody.

This invention also provides, for the first time, DNA sequences coding for cynomolgus monkey CD4, rhesus monkey CD4, chimpanzee CD4 and fragments thereof. Such sequences code for immunogenic CD4 proteins useful in the compositions of this invention. Preferred immunogenic CD4 proteins are soluble forms of rhesus monkey CD4, cynomolgus monkey CD4 and chimpanzee CD4, for example AA₁-AA_37g. Soluble rhesus CD4 proteins are most preferred. DNA sequences encoding the immunogenic CD4 proteins of this invention, portions thereof, o synthetic or semi-synthetic copies of the same, are useful as probes for screening cDNA or genomic DNA libraries prepared from other animals to isolate the CD4 gene from those sources. For example, the DNA sequences coding for soluble chimpanzee CD4 proteins and soluble rhesus monkey CD4 proteins disclosed herein may be used to screen chimpanzee and rhesus monkey genomic DNA or cDNA libraries to select full-length CD4 genes from those sources.

DNA sequences encoding the immunogenic CD4 proteins of this invention, portions thereof, or synthetic or semi-synthetic copies of the same, also are useful as starting materials to prepare other amino acid variants or derivatives. Such amino acid variants may be prepared according to standard techniques, e.g., site-directed mutagenesis. It should also be understood that the DNA sequences of this invention may be used to generate DNA molecules with degenerate mutations, wherein the amino acid sequence is unchanged.

The DNA sequences encoding the preferred immunogenic CD4 proteins of this invention are selected from the group consisting of:

(a) the DNA inserts of: pSQ136, pSQ134, pSQ131, pSQ146, pSQ162, pBG341J0D.rhT4, pSQ200, pS 205, and pDGlOO;

(b) DNA sequences that hybridize to one or more of the foregoing DNA inserts under conditions equivalent to about 20^βC to 27°C below T and 1 M sodium chloride, preferably excluding murine, rat, rabbit and sheep CD4 sequences; and

(c) DNA sequences degenerate to any of the foregoing DNA sequences.

Preferably, the DNA sequences encoding immunogenic CD4 proteins of this invention code for a polypeptide selected from the group consisting of a polypeptide of the formula AA.-AA₄₃₃ of Figure 4 (cynomolgus monkey) , a polypeptide of the formula AA - AA₃₇₅ of Figure 4 (cynomolgus monkey) , a polypeptide of the formula AA -AA₃₇_ of Figure 15 (rhesus monkey) , a polypeptide of the formula AA -AA₃₇₄ (pSQ200) of Figure 23 (chimpanzee) , a polypeptide of the formula __A--AA_ (pSQ205) of Figure 23 (chimpanzee) , a polypeptide of the formula AA -AA₁₈₀ of Figure 4 (cynomolgus monkey) , a polypeptide of the formula AA - AA₁₈₀ of Figure 15 (rhesus monkey) , a polypeptide of the formula AA.-AA.__ (pSQ200) of Figure 23 (chimpanzee) , a polypeptide of the formula AA -AA₁₈₀ (pSQ205) of Figure 23 (chimpanzee) , and portions of any of the foregoing. The DNA sequences encoding the most preferred amino acid variants of this invention are selected from the group consisting of:

(a) the DNA insert of pBG341JOD.rhT4; (b) DNA sequences that hybridize to the foregoing DNA insert under conditions equivalent to about 20°C to 27°C below T and 1 M sodium chloride, preferably excluding murine, rat, rabbit and sheep CD4 sequences; and (c) DNA sequences degenerate to any of the foregoing DNA sequences.

As used herein, a "soluble CD4 protein" is a CD4 protein that is incapable of anchoring itself in a membrane. Such soluble CD4 proteins include, for example, a CD4 protein that lacks both its cytoplasmic domain and a sufficient portion of its membrane spanning domain to anchor the protein in a membrane. Alternatively, such soluble CD4 proteins include a CD4 protein that retains all or some of its cytoplasmic domain but lacks a functional membrane spanning domain. DNA coding for those immunogenic CD4 proteins that are soluble CD4 proteins may be produced by truncation. More particularly, such soluble CD4 proteins may be produced by the conventional techniques of oligonucleotide-directed mutagenesis, restriction enzyme digestion followed by linker insertion, the use of an exonuclease to "chew back" DNA coding for full- length CD4, or by oligonucleotide-directed polymerase chain reaction (PCR) . Alternatively, soluble immunogenic CD4 proteins may be chemically synthesized by conventional peptide synthesis techniques, such as solid phase synthesis [R. B. Merrifield, "Solid Phase Peptide Synthesis. I. The Synthesis Of A Tetrapeptide", J. Am. Chem. Soc.. 83, pp. 2149-54 (1963)]. They may also be prepared by proteolytic cleavage of full-length immunogenic CD4 proteins.

The DNA sequences of this invention are expressed in unicellular hosts in order to generate the immunogenic CD4 proteins encoded by them. As is well known in the art, in order to obtain high expression levels of a transfected gene in a host, the gene must be operatively linked to transcriptional and translational expression control sequences that are functional in the chosen expression host. Preferably, the expression control sequences, and the gene of interest, will be contained in an expression vector that further comprises a bacterial selection marker and origin of replication. If the expression host is a eukaryotic cell, the expression vector should further comprise an expression marker useful in the expression host.

The DNA sequences encoding the immunogenic CD4 proteins of this invention may or may not encode a signal sequence. If the expression host is prokaryotic, it generally is preferred that the DNA sequence not encode a signal sequence. If the expression host is eukaryotic, it generally is preferred that a signal sequence be encoded. An amino terminal methionine may or may not be present on the expressed CD4 proteins of this invention. If the terminal methionine is not cleaved by the expression host, it may, if desired, be chemically removed by standard techniques. A wide variety of expression host/vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors for eukaryotic hosts, include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E.coli. including col El, pCRl, pBR322, pMB9 and their derivatives, wider host range plasmids, such as RP4, phage DNAs, e.g., the numerous derivatives of phage lambda, e.g., NM989, and other DNA phages, such as M13 and filamentous single stranded DNA phages. Useful expression vectors for yeast cells include the 2μ plasmid and derivatives thereof. Useful vectors for insect cells include pVL 941.

In addition, any of a wide variety of expression control sequences — sequences that control the expression of the DNA sequence when operatively linked to it — may be used in these vectors to express the DNA sequences of this invention. Such useful expression control sequences include the expression control sequences associated with structural genes of the foregoing expression vectors. Examples of useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the AC or TRC system, the major operator and promoter regions of phage lambda, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast α-mating system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof. A wide variety of unicellular host cells are useful in expressing the DNA sequences of this invention. These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E.coli. Pseudomonas. Bacillus, gfrf_. tpmycgs, fungi, yeast, insect cells such as Spodootera frugjperda (SF9) , animal cells such as CHO and mouse cells, African green monkey cells such as COS 1, COS 7, BSC l, BSC 40, and BMT 10, and human cells, as well as plant cells in tissue culture. For animal cell expression, we prefer CHO cells and COS 7 cells.

It should of course be understood that not all vectors and expression control sequences will function equally well to express the DNA sequences of this invention. Neither will all hosts function equally well with the same expression system. However, one of skill in the art may make a selection among these vectors, expression control sequences and hosts without undue experimentation and without departing from the scope of this invention. For example, in selecting a vector, the host must be considered because the vector must replicate in it. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered.

In selecting an expression control sequence, a variety of factors should also be considered. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the DNA sequence of this invention, particularly as regards potential secondary structures. Unicellular hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the product coded for by the DNA sequences of this invention, their secretion characteristics, their ability to fold the immunogenic CD4 protein correctly, their fermentation or culture requirements, and the ease of purification from them of the products coded for by the DNA sequences of this invention. Within these parameters, one of skill in the art may select various vector/expression control sequence/host combinations that will express the DNA sequences of this invention on fermentation or in large scale animal culture, e.g. CHO cells or COS 7 cells. The immunogenic CD4 proteins encoded by the DNA sequences of this invention may be isolated from the fermentation or cell culture and purified using any of a variety of conventional methods. One of skill in the art may select the most appropriate isolation and purification techniques without departing from the scope of this invention. Substantially pure soluble rhesus CD4 protein is provided infra.

The immunogenic CD4 proteins of this invention are useful in prophylactic, therapeutic and diagnostic compositions for preventing, treating and diagnosing diseases caused by infective agents whose primary targets are T4⁺ lymphocytes. Such diseases include AIDS, ARC and HIV infection. Preferred pharmaceutical compositions of this invention include, as immunogenic CD4 proteins, one or more of cynomolgus monkey CD4, rhesus monkey CD4, chimpanzee CD4, or soluble fragments of any of the foregoing. Pharmaceutical compositions comprising soluble rhesus CD4 proteins (especially AA -AA₃ ) , as immunogenic CD4 protein, are most preferred.

The pharmaceutical compositions of this invention further comprise other therapeutics for the prophylaxis or treatment of AIDS, ARC, and HIV infection. For example, immunogenic CD4 proteins may be used in combination with anti-retroviral agents that block reverse transcriptase, such as AZT, HPA-23, phosphonoformate, suramin, ribavirin and dideoxycytidine, or with agents that inhibit the HIV protease. Additionally, the pharmaceutical compositions of this invention may further comprise anti-viral agents such as interferons, including alpha interferon, beta interferon and gamma interferon, or glucosidase inhibitors such as castanospermine. Furthermore, one or more immunogenic CD4 proteins may be used in combination with two or more of the foregoing therapeutic agents. Such combination therapies may advantageously utilize lower dosages of the administered therapeutic agents, thus avoiding possible toxicities of the various monotherapies. The pharmaceutical compositions of this invention comprise an immunotherapeutically effective amount of one or more immunogenic CD4 proteins, or polymeric form(s) thereof and, preferably, a pharmaceutically acceptable carrier.

The compositions of this invention may be in a variety of forms. These include, for example, solid, semi-solid and liquid dosage forms, such as tablets, pills, powders, liquid solutions, dispersions or suspensions, liposomes, suppositories, injectable and infusible solutions. The preferred form depends on the intended mode of administration and therapeutic application.

Based upon our belief that the immunogenic CD4 proteins of this invention are prophylactic and/or therapeutic because of the anti HIV-gpl20 antibodies they elicit in the human to whom they are administered, the preferred pharmaceutical compositions of this invention are similar to those used for immunizing humans with other proteins and polypeptides. Therefore, the compositions of this invention preferably comprise a pharmaceutically acceptable adjuvant such as incomplete Freund's adjuvant, aluminum hydroxide, a muramyl peptide, a water-in-oil emulsion, or an ISCOM. The preferred mode of administration is intramuscular, intradermal or subcutaneous. Most preferably, the compositions comprise a water-in-oil emulsion or aluminum hydroxide as adjuvant and are administered intramuscularly. It will be apparent to those of skill in the art that the immunotherapeutically effective amount of immunogenic CD4 protei (s) of this invention will depend, inter alia, upon the immunization schedule, the relative immunogenicity of the particular immunogenic CD4 protein(s) administered, the activity of any adjuvant used, whether the immunogenic CD4 protein(s) are administered in combination with other therapeutic agents, and the immune status of the patient. In monotherapy for treatment of HIV infection, ARC or AIDS, immunotherapeutically effective amounts and immunization schedules are as follows: an initial injection (with adjuvant) of about 0.01 to 10.0 mg, and preferably 0.1 to 1.0 mg, immunogenic CD4 protein per patient, followed by several boosters (with adjuvant) of about 0.001 to 1.0 mg, and preferably 0.01 to 0.1 mg, of immunogenic CD4 protein per patient. Preferably, boosters will be given about once a week for 4 weeks after the initial injection or until antibodies binding to HIV gpl20 are detected, then once a month for 6 months or until clinical or laboratory signs of improvement are evident. It should be recognized, however, that lower or higher dosages and other immunization schedules, may be employed.

For prevention of HIV infection, ARC or AIDS, the treatment protocol described above may be used. Preferably, however, booster injections will be administered at about 1 and 6 months after the initial injection, followed by booster doses every 2-5 years. Polyvalent and/or derivatized forms of immunogenic CD4 proteins may require lower dosages to be effective, as they may be more immunogenic.

Immunogenic CD4 proteins of this invention that are monkey or chimpanzee CD4 proteins, or fragments thereof, may also be used to increase the sensitivity of SIV assay systems now based upon monoclonal or polyclonal antibodies. More specifically, soluble monkey CD4 or soluble chimpanzee CD4 proteins according to this invention may be used to pretreat test plasma in order to concentrate any SIV, even if present in small amounts, so that it will be more easily detected by the assay. Alternatively, the soluble monkey CD4 or soluble chimpanzee CD4 proteins may be used to detect anti-SIV antibodies in sera. For example, a soluble monkey CD4 protein may be linked to an indicator, such as an enzyme, and used in an ELISA assay to detect anti-SIV serum antibodies.

This invention also provides human antibodies that bind to HIV gpl20, produced by immunizing a human with an immunogenic CD4 protein of this invention. Such anti-HIV gpl20 antibodies are useful for passive immunotherapy and immunoprophylaxis of humans infected with HIV. The dosage regimen for such passive immunization would be similar to those of other passive i munotherapies.

In order that this invention may be better understood, the following examples are set forth. These examples are for purposes of illustration only, and are not to be construed as limiting the scope of the invention in any manner. Example I - Construction Of A λgtlO Cynomolgus Peripheral Blood Lvmphocvte cDNA Library

We isolated peripheral blood lymphocytes (PBLs) from cynomolgus monkey blood (EG&G Mason, MA) by gradient centrifugation through Lymphocyte Separation Medium ("LSM") (Organon Teknika, Durham, NC, Cat. No. 36427) . We then prepared total RNA from the PBLs cells using the guanidinium isothiocyanate/cesium chloride method [T. Maniatis et al.. Molecular Cloning, p. 196 (Cold Spring Harbor Laboratory) (1982) ; J.M. Chirgwin et al., "Isolation Of Biologically Active Ribonucleic Acid From Sources Enriched In Ribonuclease", Biochemistry. 18, pp. 5294-5299 (1979)]. Poly A⁺ mRNA was isolated by chromotography on an oligo dT-column. We denatured 5 μg poly A⁺ mRNA (500 ng/μl) in CH₃HgOH (2.5 mM) for 10 minutes at room temperature. Subsequently, we added one tenth volume of β- mercaptoethanol (0.7 M) and incubated for 5 minutes at room temperature. First and second strand cDNA synthesis was carried out with a cDNA synthesis kit (Bethesda Research Laboratories, Gaithersburg, MD, Cat. No. 8267 SA) according to the manufacturer's suggested protocol. We ligated the double-stranded cDNA to linker 35/36K using standard procedures. Linker 35/36K is an

EcoRI/ffotl linker/adaptor having the sequence:

5' AATTCGAGCTCGAGCGCGGCCGC 3' 3' GCTCGAGCTCGCGCCGGCG 5'

This linker has a 5' EcoRI overhang and a 3• blunt end. We synthesized the linker on a DNA synthesizer (Applied Biosystems, 380A, Foster City, CA) according to the procedure described in M. D. Matteucci & M. H. Caruthers, "The Synthesis Of Oligodeoxypyrimidines On A Polymer Support", J. Am. Chem. Soc.. 103, pp. 3185-91 (1981) . The ligated cDNA was purified and size selected for fragments larger than 500 bp by chromatography through a Sephadex G150 column (5 ml) in 0.01 M Tris«HCl/0.4 M NaCl/0.01 M Na₂EDTA (pH 7.4). Excess linker was removed by centrifugation through a Select 4L spin column (5 Prime → 3 Prime, PA, Cat. No. 5301-993260), processed according to the manufacturer's suggested protocol.

We prepared our first cynomolgus PBL cDNA library as follows. We ethanol-precipitated the cDNA eluted from the Select 4L column with 5 μg EcoRI- digested bacteriophage ΛgtlO [J. Sambrook et al.. Molecular Cloning. 1, p. 2.41 (Cold Spring Harbor Laboratory Press) (1989) ] . The precipitated material was ligated with T4 DNA ligase (New England Biolabs, Beverly, MA) in 0.05 M Tris (pH 7.8)/0.01 M MgCl₂/0.03 M NaCl/0.001 M spermidine/0.2 mM EDTA/0.002 M dithiothreitol ("DTT")/0.25-1 mM ATP/1 mg/ml bovine serum albumin ("BSA") at 16^βC overnight. We packaged aliquots of the ligation reaction mixture in Gigapak (Stratagene, CA, Cat. No. 200213) according to the manufacturer's suggested protocol.

We prepared a saturated (greater than 10⁹ cells/ml) culture of E.coli BNN102 cells grown in Luria Broth ("LB") supplemented with 0.2% maltose and adjusted to 0.01 M MgS0₄. We used the packaged phage to infect 6 ml of that culture, added the infected culture to 300 ml 0.7% top agarose in LB supplemented with 0.01 M MgS0₄ and plated the cell mixture on 6 plates (21 x 21 cm) containing agar/LB/0.01 M MgSO.. The plates were incubated for approximately 7 hours at 37^βC to amplify the plaques. The phage were then eluted with 50 ml TM (0.01 M Tris-HCl (pH 7.4)/0.01 M MgCl₂) and CsCl-banded to purify. Example II - Screening Of The Cvnomolcrus Monkey PBL AgtlO cDNA Library

We used a fragment of human CD4 DNA to screen the AgtlO cDNA library by plaque hybridization screening. More specifically, we plated a total of 1 x 10⁶ plaque forming units (PFU) on each of thirty 150 mm dishes. Duplicate plaque lifts were made on nitrocellulose filters. We screened the filters with a 694 bp 5* Pstl/PvuII fragment of a human CD4 cloned sequence using the technique described in W. D. Benton and R. W. Davis, "Screening Of Lambda gt Recombinant Clones By Hybridization To Single Plaques In Situ", Science. 196, p. 180 (1977). The -694 bp Pstl/PvuII fragment of vector pl70-2, described in PCT patent application PCT/US88/02940, may be used. Eight duplicate positives were carried through two rounds of screening and plaque purification. We then prepared AgtlO miniprep DNA and digested it with NotI. We selected one clone, 26B, which had the longest cDNA insert (-2 kb) . As depicted in Figure 1A, we digested clone 26B with NotI to excise the approximately 2 kb NotI/NotI fragment containing a portion of the coding region of cynomolgus CD4. We subcloned the fragment into a NotI-digested sequencing plasmid, pNN12, which had been treated with calf intestinal alkaline phosphotase ("CIAP") (Boehringer Mannheim) according to the manufacturer's suggested protocol. We called the resulting construct pSQ131. Sequencing plasmid pNN12 was constructed by removing the synthetic polylinker from the commercially available plasmid pUCδ (Pharmacia PL Biochemicals) by restriction digestion and replacing it with a new synthetic segment having convenient restriction sites. The 2.5 kb backbone common to the pUC plasmids, which provides an origin of replication and confers ampicillin resistance, remained unchanged. The novel synthetic portion of pNN12 is shown in Figure 2.

The nucleotide sequence of the CD4 insert of pSQ131 was determined according to A. M. Maxam and W. Gilbert, "A New Method For Sequencing DNA", Proc. Natl. A<?a<_. ?<__. VSA/ 74, pp. 560-64 (1977). By comparison to the nucleotide sequence of human CD4 protein, we determined that the -2 kb insert did not contain all of the coding region for cynomolgus CD4. Moreover, none of the other clones isolated from the library contained all of the coding region of CD4. Accordingly, we constructed a primer extension cDNA library from the previously isolated cynomolgus PBL poly A⁺ mRNA.

Example III - Synthesis And Screening Of A Cvnomolcrus Primer Extension cDNA Library

Based on the sequence of the insert of pSQ131, we synthesized an antisense oligonucleotide primer, T4AID118, on a DNA synthesizer (Applied Biosystems, 380A) and purified it by acrylamide gel electrophoresis, all according to the manufacturers' suggested protocols. See also L. J. McBride, supra. The sequence of T4AID118 is:

5' TGG GCC ATG TGG GCA CAA CCT TGA TGT TGG 3' . ATP was used to phosphorylate the oligonucleotide in the presence of T4 polynucleotide kinase (New England Biolabs, Beverly, MA) , according to the manufacturer's suggested protocol.

We denatured 20 μg cynomolgus PBL poly A⁺ mRNA in CH₃HgOH (2.5 mM) for 10 minutes at room temperature. We then added one tenth volume 0.7 M β- mercaptoethanol and incubated for 5 minutes at room temperature. First strand cDNA synthesis was specifically primed by added 200 pmol kinased T4AID118. The primer was annealed to the mRNA in 0.0625 M Tris¬ HCl (pH 8.3)/0.75 M KC1/ 0.0015 M EDTA for 5 minutes at 68°C, 7 minutes at 55°C, and 5 minutes at 42°C, and the product was ethanol-precipitated. cDNA synthesis and linker ligation were carried out as previously described. We removed excess linker on a 6L spin column (5 Prime → 3 Prime, PA, Cat. No. 5301-04738) according to the manufacturer's recommendations. The cDNA was ligated to 1 μg of EcoRI-digested AgtlO and packaged as previously described. We used the packaged phage to infect l ml E.coli BNN102, plated the cells on a plate (21 cm x 21 cm) and prepared a phage stock, all as previously described. One million phage were plated and prepared for plaque hybridization screening as previously described. This library was screened with two probes. The first probe, T4AID08, has the sequence:

5• CTG AGT GGC TCT CAT CAC CAC CAG GTT 3' . We synthesized T4AID08 as previously described. A screen with T4AID08 yielded 9 duplicate positives. After iniprep analysis, the insert (- 900 bp) from the largest of these, clone 24, was subcloned into pNN12 for sequencing, as depicted in Figure IB. This subclone was called pSQ134.

Two additional clones, clone 36 and clone 35, were found by screening the cynomolgus extension library with the 406 bp NCOI/BSPMI fragment of DC213-5, a human CD4 clone. The nucleotide sequence and the deduced amino acid sequence of DC213-5 is depicted in Figure 3. The insert from clone 6 as subcloned into pNN12, and the resulting construct was called pSQ136. See Figure IC. Similarly, the insert from clone 35 was subcloned into pNNl2 and the resulting construct was called pSQ135. Vector pSQ136 (containing all of pSQ135 and more) was the most 5' clone obtained and sequenced. None of the subclones contained all of the coding region for full-length cynomolgus CD4.

The DNA sequence for full-length cynomolgus CD4, depicted in Figure 4, is a composite sequence assembled from the three overlapping subclones — pS 136, pS 134 and pSQ131 (in 5' to 3' order). Subclone pSQ136 contained nucleotides 1-560 and 1182- 1342 of Figure 4. Subclone pSQ134 contained nucleotides 467-1341 of Figure 4. Subclone pSQl3l contained nucleotides 998-3064 of Figure 4. Figure 4 also depicts the deduced amino acid sequence of full- length cynomolgus CD4 (AA__2g-AA₄₃₃) . Figure 5 demonstrates that soluble cynomolgus CD4 (AA__2g-AA ) has 94.250% similarity and 91.250% identity to soluble human CD4 from plasmid pGB391 (PCT patent application PCT/US8/02940) (In Vitro International Culture Collection, Linthicum, MD, IVI 10151). In Figure 5, the mismatched amino acids are marked with an asterisk.

Example IV - Cloning Of Soluble Rhesus Monkey CD4

Soluble rhesus (Macaca ulatta) CD4 was cloned essentially as described in P. J. Newman et al., "Enzymatic Amplification Of Platelet-Specific Messenger RNA Using The Polymerase Chain Reaction", J. Clin. Invest.. 82, pp. 739-43 (1988). We cloned the soluble region of rhesus CD4 using oligonucleotide primers chosen from regions of 100% nucleotide homology between human CD4 and cynomolgus CD4 extracellular coding regions. We synthesized these oligonucleotide primers as previously described. All of the oligonucleotide primers used for cloning were phosphorylated at their 5' end with polynucleotide kinase and ATP as described above. These oligonucleotides are depicted in Figure 6. The cloning of the extracellular region was accomplished in three steps. First, the 5' region of rhesus soluble CD4 was generated from mRNA in a specifically primed reverse transcriptase reaction, followed by PCR amplification of the first strand cDNA. Second, an overlapping 3' region was generated by analogous reverse transcriptase/PCR amplification procedures. The third step of the cloning procedure involved attaching a stop codon linker to the 3' fragment. Finally, the fragments were cloned into sequencing vectors.

We prepared PBLs from heparinized rhesus monkey blood (obtained from the New England Regional Primate Center) and isolated total RNA from those PBLs by the same methodologies described above for cynomolgus CD4. We did not obtain enough total RNA to make poly A⁺ mRNA, so we denatured 5 μg of total rhesus PBL RNA in 10 μl CH₃HgOH (2.5 mM) for 10 minutes at room temperature and then quenched by incubating for 5 minutes at room temperature with 1 μl β- mercaptoethanol (0.7 M) .

To obtain the 5'-terminal portion of the extracellular coding region of rhesus CD4, we carried out a reverse transcriptase reaction on the rhesus PBL RNA using the oligonucleotide T4AID156 (Figure 6) to prime first strand cDNA synthesis. cDNA synthesis was carried out in 0.05 M Tris (pH 8.3)/0.003 M MgCl₂/ 0.075 M KCl/0.01 M DTT/0.5 mM dNTP mix/50 pmol T4AID156 primer/500 U MMLV reverse transcriptase (Bethesda Research Labs, Gaithersburg, MD) in a final reaction volume of 50 μl, for one hour at 37°C. The tube was put on ice to stop the reaction.

For the polymerase chain reaction (PCR) amplification, 50 pmol of T4AID156 primer and 100 pmol of T4AID1 8 primer (Figure 6) were mixed and dried down in a Speed Vac (Savant) , then 50 μl of PCR dilution buffer (0.025 M KC1 and 0.02% gelatin) were added to resuspend the dried oligonucleotides. This mixture was added to the stopped reverse transcriptase reaction (see preceding paragraph) and heated to 94°C for two minutes. The mixture was allowed to cool to 37°C in a Perkin Elmer/Cetus DNA Thermal Cycler, at which time 1 μl (5 units) of Taq DNA polymerase isolated from Thermus aquaticus (Cetus) was added. Amplification was performed in the DNA Thermal Cycler for 30 cycles — 1 minute, 20 seconds at 94°C; 3 minutes, 20 seconds at 37^βC; and 10 minutes at 72^βC.

The PCR products were separated on a 1% GTG agarose gel ("Seakem") (FMC Marine Colloids, Rockland, ME) in TAE buffer (0.04 M Tris-acetate/0.001 M EDTA). The appropriate fragment (about 540 bp) was excised and electroeluted in dialysis tubing containing 0.01 M Tris-Cl (pH 8)/0.001 M EDTA at 100 V for one hour in TBE buffer (0.089 M Tris-borate/0.089 M boric acid/0.002 M EDTA) between two electrodes. The appropriate size fragment was determined by comparison to the cynomolgus CD4 DNA sequence flanked by the primers (see Figures 4 and 6) . We reversed polarity for 15 seconds and then ethanol-precipitated the eluted DNA in the presence of 20 μg carrier tRNA.

The PCR fragment was cloned into sequencing plasmid pNN08, which had been digested with Smal and the linearized vector dephosphorylated with CIAP (Boehringer Mannheim) according to the manufacturer's protocol. We constructed pNNOδ by removing the synthetic polylinker from the plasmid pUC8 (Pharmacia PL Biochemicals) by restriction digestion and replacing it with a new synthetic segment. The 2.5 kb backbone common to the pUC plasmids, which provides an origin of replication and confers ampicillin resistance, remained unchanged. The novel synthetic portion of pNN08 is shown in Figure 7. The ligation of the PCR fragment and pNNOδ was carried out with T4 DNA ligase overnight at 16^βC in 0.05 M Tris (pH 7.6)/0.01 M MgCl₂/0.03 M NaCl/ 0.001 M spermidine/0.2 mM EDTA/0.002 M DTT/0.25-1 mM ATP/1 mg/ml BSA.

The ligation mixture was used to transform E.coli DH5α cells and the transformants were plated on LB agar containing ampicillin (50 μg/ml) . Twenty-four of the resulting colonies were grown and analyzed by gel electrophoresis of NotI digests of alkaline mini- prep DNA. Two of these colonies contained the correct size insert (i.e., about 540 bp) . One of the plasmids isolated from those colonies, pSQ146, was purified by CsCl gradient centrifugation and sequenced according to Maxam/Gilbert. The nucleotide sequence and the deduced amino acid sequence of the rhesus CD4 insert of pS 146 is presented in Figure β.

To obtain the 3'-terminal portion of the extracellular coding region of rhesus CD4, first strand cDNA synthesis was primed using the oligonucleotide T4AID150 (Figure 6) . PCR amplification was performed with primers T4AID150 and T4AID178 (Figure 6) . The appropriate PCR fragment (-600 bp) was gel purified. All steps were performed as described supra.

The purified PCR fragment was treated with Klenow fragment of E.coli DNA polymerase to obtain blunt ends, and ligated to T4AID182/183, a linker/adaptor having the sequence: 5' TGA GAT CTT TGT GC 3'

3' ACT CTA GAA ACA CGC CGG 5' T4AID182/183 contains a stop codon, TGA, at its 5¹ end, an internal Bglll site and a partial NotI site at its 3' end. The ligated DNA was cut with NotI and gel- purified as described previously, electroeluted and ligated to the sequencing plasmid pNNll, which had been cut with NotI and treated with CIAP. We constructed pNNll by removing the synthetic polylinker from pUCδ (Pharmacia PL Biochemicals) by restriction digestion and replacing it with a new synthetic segment. The novel synthetic portion of pNNll is shown in Figure 9. The ligation mixture was used to transform E.coli JA221. Mini-prep analysis was done on twenty-four of the resulting colonies. Four of these, pSQ159, pSQ160, pS 161 and pSQ162 contained the correct size fragment (i.e., about 600 bp) . The nucleotide sequence and the deduced amino acid sequence of the rhesus CD4 insert of subclone pSQ162 is presented in Figure 10.

Example V - Construction Of A Mammalian Cell Expression Vector Containing A Soluble Rhesus-Human Chimeric CD4 DNA Seouence

We constructed a soluble rhesus-human chimeric CD4 DNA sequence in a mammalian cell expression vector as depicted in Figure 11. In this construction, the 5' end of the CD4 coding region is rhesus monkey CD4 DNA and the 3' end is human CD4 DNA. More specifically, we digested the mammalian expression vector pBG341 [R. M. Kramer et al.,

"Structure And Properties Of A Human Non-Pancreatic Phospholipase A2", J. Biol. Chem.. 264, pp. 5766-75 (1969)] (Figure 12) with AatH and NotI and isolated a 1 kb fragment containing the promoter region and NotI cloning site.

Rhesus CD4 plasmid pSQ146 was digested with NotI and BspMI and the 543 bp fragment containing rhesus CD4 nucleotides 1 to 499 of Figure δ, preceded by 44 vector nucleotides, was isolated. Human CD4 expression vector pBG391 (PCT patent application PCT/USδδ/02940) (In Vitro International Culture Collection, Linthicum, MD, IVI 10151) was digested with BSPMI and Aatll. This plasmid contains two βspMI sites, one in the CD4 sequence and one in the vector; however, they do not have the same overhang. A 2147 bp Aatll/ BspMI fragment (containing vector sequence) , and a 2324 bp BspMI/BspMI fragment (containing the 3' end of soluble human CD4 and vector sequence) were isolated.

To construct an expression vector containing the soluble rhesus-human chimeric DNA sequence, the following fragments were ligated with T4 DNA ligase:

The resulting chimeric plasmid, pDGlOO, is depicted in Figure 11. Figure 13 depicts the nucleotide sequence and deduced amino acid sequence of the CD4 DNA insert of pDGlOO. In Figure 13, nucleotides 1-489 correspond to rhesus CD4 sequence and nucleotides 490-1296 correspond to human CD4 sequence. We transformed COS 7 cells with pDGlOO according to the protocol described in G. Chu et al., "Electroporation For The Efficient Transfection Of Mammalian Cells With DNA", Nucleic Acids Research. 15, pp. 1311-25 (1987) . The chimeric soluble rhesus/human CD4 encoded by pDGlOO was immunoprecipitable with the mouse monoclonal anti-human CD4 antibodies OKT4a and OKT4 (Ortho Pharmaceutical) , but not with Leu3a (Becton Dickinson) as detected by Western analysis using a rabbit polyclonal anti-human CD4 sera (935) (data not shown) . Example VI - Construction Of Soluble Rhesus CD4 Mammalian Cell Expression Vectors

A. Transient Expression Vector pBG341.rhT4

Figure 14 depicts the construction of a mammalian cell expression vector coding for soluble rhesus CD4 (AA__2g-AA_37g) .

The rhesus-human chimeric plasmid pDGlOO was digested with Hindlll and £§£MI sequentially, and the 572 bp rhesus CD4 5' fragment was isolated. The vector pSQ162 was digested with BspMI and NotI sequentially, and the 800 bp soluble rhesus CD4 3' fragment was isolated. The expression vector pBG341 was digested with Hindlll and NotI sequentially, treated with CIAP, and the 4.8 kb vector fragment was isolated. These three fragments were ligated with T4 ligase to produce the expression vector pBG341.rhT4, which was transfected into COS-7 cells (ATCC ≠ 1651) as described in Example V.

Figure 15 depicts the nucleotide sequence and the deduced amino acid sequence of soluble rhesus CD4 from pBG341.rhT4. Figure 16 demonstrates that soluble rhesus CD4 has 99.750% similarity and 99.500% identity to soluble cynomolgus CD4 (Figure 4). Figure 17 demonstrates that soluble rhesus CD4 has 94.264% similarity and 91.272% identity to soluble human CD4 (from pBG391, supra) . The mismatched amino acids in Figures 16 and 17 are marked with an asterisk.

B. Stable Expression Vector pBG341JOD.rhT4

The rhesus CD4 insert of pBG341.rhT4 was used to make another construct for stable expression of soluble rhesus CD4 in DHFR^" Chinese hamster ovary (CHO) cells. This construct is called pBG341JOD.rhT4. As depicted in Figure 18A, pBG341.rhT4 (10 μg) was cleaved with NotI (in 150 mM NaCl/10 mM Tris¬ HCl (pH 7.9)/10 mM MgCl₂/100 μg/ml gelatin/0.01% Triton X-100) and the 1.357 kb fragment encoding soluble rhesus CD4 was isolated by electrophoresis through low temperature melting agarose. We digested pBG341 (Figure 12) with £a£II and fia£I and isolated the - l kb fragment. We ligated this fragment to the 6.750 kb NotI/Aatll fragment of pJOD-s [PCT patent application PCT/US89/01416] and called the resulting plasmid pBG341.JOD. Plasmid pBG341.JOD (10 μg) was cleaved with NotI, the 5' termini were dephosphorylated using CIAP, and the linearized plasmid DNA was isolated by low temperature melting agarose electrophoresis. The linearized pBG341.JOD was ligated to the 1.357 kb

NotI/NotI fragment encoding soluble rhesus CD4 and the resulting plasmid was called pBG341JOD.rhT4 (Figure 18B) .

We transfected this plasmid into DHFR^" CHO cells by electroporation and selected cells which grew in the presence of 500 nM methotrexate [see European patent application 343,783]. More specifically, pB341JOD.rhT4 (200 μg) was cleaved with Aatll in 50 mM KCl/10 mM Tris-HCl (pH 7.5)/10 mM MgCl₂/l mM DTT. The cleaved DNA was ethanol-precipitated and the precipitate was resuspended in 0.8 ml lx HeBS (20 mM HEPES (pH 7.05)/137 mM NaCl/5 mM KCl/0.7 mM Na₂HP0₄/6 mM dextrose) . DHFR^" CHO cells [G. Urlaub and L. A. Chasin, "Isolation Of Chinese Hamster Ovary Cell Mutants Deficient In Dihydrofolate Reductase Activity", Proc. Natl. Acad. Sci. USA. 77, pp. 4216-20 (1980)] were grown to 50% confluence in α⁺ Modified Eagle's Medium ("MEM") supplemented with 4 mM glutamine and 10% dialyzed fetal bovine serum. We trypsinized the cells and then added fresh culture medium to inactivate the trypsin. The cells were centrifuged at (-2000 x g ) for 4 minutes. The cells (approximately 1 x 10⁷) were resuspended in the 0.8 ml HeBS containing the Aatll- cleaved pBG341JOD.rhT4. We transferred the sample to a BioRad electroporation cuvette and electroporated using a BioRad Gene Pulser apparatus with the capacitance set to 960 μFd and the voltage set to 290 V. The cells then were placed on ice for 10 minutes, before being transferred to 10 ml α⁺ MEM supplemented with 4 mM glutamine and 10% fetal bovine serum and seeded into three 100 mm tissue culture dishes.

The cells were cultured for three days in an incubator (37°C and 5% C0₂) , and then split into α^" MEM (α⁺ MEM lacking nucleotides) supplemented with 4 mM glutamine and 10% dialyzed fetal bovine serum. After five days we fed the cells with α^" MEM supplemented with 4 mM glutamine, 10% dialyzed fetal bovine serum and 500 nM ethotrexate ("Selection Medium") . The Selection Medium was changed every three to four days and the plates were examined for the outgrowth of cells. Cells which grew were assayed for the production of soluble rhesus CD4, as described immediately below. We selected the cell line designated CHO rhesus 500.21 for the production of soluble rhesus CD4. This cell line produces about 5 pg/cell/day of soluble rhesus CD4 (AA.-AA₃ of Figure 15) .

Example VII - Detection and Quantitation of Recombinant Soluble Rhesus CD4

Soluble rhesus CD4 produced by the transformed CHO cells described above was quantitated as follows. We coated wells of Immulon II 96-well microtiter plates (Dynatech, Chantilly, Virginia) with 5 μg/ml of the anti-human CD4 monoclonal antibody 1D7 in 0.05 M bicarbonate buffer, pH 9.0 (50 μl/well) and incubated the plates overnight at 4°C. 1D7 (a gift from Patricia Chisholm of Biogen, Inc.) is a mouse monoclonal antibody that binds to the extracellular region of human CD4. Other commercially available

_ monoclonal antibodies that bind to the extracellular region of human CD4 would be functional substitutes for 1D7 (e.g., OKT4A or Leu3A) .

Before use, the 1D7 monoclonal antibody was purified as follows. 1D7 ascites was diluted with PBS (V/V) and the proteins were precipitated with 40% ammonium-sulfate. The precipitate was dissolved in PBS and dialyzed against PBS. The antibodies were purified on an Affi-gel Protein A MAPS II kit (Biorad, Cat. No. 153-6159) with the material and the procedure provided by the manufacturer. The purified antibodies were dialyzed extensively against PBS, and aliquots of the antibodies were stored at -70°C.

All subsequent steps were carried out at room temperature except as otherwise noted. We washed the plates with 0.05% Tween-20/PBS. We blocked the plates with 2% non-fat dry milk in PBS (2% milk/PBS) (200 μl/well) for 2 hours. We then washed as described above.

Subsequently, we added samples of conditioned media (50 μl/well) at various dilutions in 2% milk/PBS, incubated the plates for 3-4 hours, and washed as described above. We then added a horseradish peroxidase-conjugated anti-CD4 monoclonal antibody diluted 1/1000 in 2% milk/PBS (50 μl/well) , incubated 1.5 hours, then washed the plates as described above. We made the HRP-conjugate by conjugating commercially available HRP (Boehringer Mannheim) to a mouse monoclonal antibody that binds to the extracellular region of human CD4 (a gift of Patricia Chisholm, Biogen, Inc.). The monoclonal antibody was purified as described above. Another commercially available monoclonal antibody that binds to the extracellular region of human CD4 (e.g., 0KT4) would be a functional substitute.

Finally, we added 100 μl/well O- phenylethylenediamine ("OPD")* (Calbiochem)

(0.4 mg/ml), incubated for 20-30 minutes and then stopped the color development by adding 100 μl/well of 1 N H₂S0₄. We measured absorbance at 490 nm, using an ELISA plate reader ("Thermomax", Molecular Devices, Menlow Park, CA) .

Example VIII - Purification of Recombinant Soluble Rhesus CD4

Soluble rhesus CD4 (AA₁-AA_3?g of Figure 15) was purified from the stably transformed cell line CHO rhesus 500.21, described supra.

The transformants were grown to confluency in Growth Medium (α~ modified Eagle's medium supplemented with 10% fetal bovine serum, 1 mM 1-glutamine, 500 nM methotrexate, 150 μg/ml streptomycin and 50 μg/ml gentamicin) . The cells were cultured at 37°C in a 10- liter Nunc cell factory (American Bioanalytical, Natick, Massachusetts, Cat. No. 139446). At confluence, the spent medium was drained and the cells were fed with 8 liters of Production Medium (Growth Medium containing 1% instead of 10% fetal bovine serum) . The Production Medium was allowed to condition

* This is a potential carcinogen which should be detoxified before disposal using a solution of: 50 g K₂CrO_?, 25 ml 10 N H₂S0₄, 145 ml H₂0. for another 3 to 4 days at 37^βC. The conditioned medium was harvested and the cells were fed with 8 liters of fresh Production Medium and incubated at 37°C for another 3 to 4 days. This cycle was repeated a total of 40 times. We added sodium azide to the harvested conditioned medium to a final concentration of 0.02%. Then, we stored the conditioned medium at 4°C until 50 liters were accumulated. All subsequent steps were performed at 4°C. The conditioned medium (50 L) was filtered through a Millipore Minidisk 5 micron hydrophilic cartridge (Millipore, Bedford, Massachusetts, Cat. No. MSL 10S 02) and diluted with an equal volume of 30 mM sodium acetate (pH 5.5). The diluted conditioned medium (100 L) was applied at about 5-10 L/hr to a Superflo-250 column (Sepragen Corp., San Leadro, California, Cat. No. 10- 0250-00) packed with 250 ml of S-Sepharose Fast Flow resin (Pharmacia LKB Biotechnology, Inc., Piscataway, New Jersey, Cat. No. 17-0511-01) pre-equilibrated with 15 mM sodium acetate (pH 5.5). The column was washed at a flow rate of 5-10 L/hr with about 5 column volumes of 20 mM Tris/HCl (pH 8.5). The remaining proteins (including rhesus rsCD4) were eluted at a flow rate of 2-5 L/hr with 5-6 column volumes of an elution buffer containing 20 mM Tris/HCl (pH 5.5) and 120 mM sodium chloride. During elution, 20 ml fractions were collected, and their absorbance at 280 nm was measured. Fractions with significant absorbance at 280 nm were pooled. The eluate pool (about 750 ml) was divided into 5 aliquots (of about 150 ml each) , four of which were frozen and stored at -80^βC until use. The aliquot not frozen was immediately subjected to affinity chromatography on a monoclonal anti-CD4 affinity column, as described below. The anti-CD4 monoclonal antibody used as the affinity reagent, 1D7, described in Example VII, was supplied as ascites. The ascites (74 ml) was mixed with saturated ammonium sulfate (60 ml) to precipitate the monoclonal antibody. The precipitate was pelleted by centrifugation at 10,000 x g for 30 minutes, and resuspended in 70 ml of 10 mM triethylamine (pH 7.6). The resuspended ammonium sulfate fraction was dialyzed overnight against 10 mM triethylamine (pH 7.6). The dialyzed fraction was loaded onto a 30 ml

Q-Sepharose Fast Flow column (Pharmacia LKB Biotechnology, Inc., Piscataway, New Jersey, Cat. No. 17-0510-01) pre-equilibrated with 10 mM triethylamine (pH 7.6). The column was washed with about 5 column volumes of equilibration buffer, and eluted at 40 ml/hr with a 500-ml linear gradient from 0.0 to 0.3 M sodium chloride in 10 mM triethylamine (pH 7.6). Fractions (4-5 ml each) were collected and analyzed by sodium dodecyl sulfate polyacrylamide electrophoresis ("SDS- PAGE") and Coomassie blue staining. Fractions containing antibody were pooled. The eluate pool — 108 ml containing approximately 77 mg protein as determined by absorbance at 280 nm — was concentrated in an A icon ultrafiltration cell to a volume of 21 ml (containing approximately 53 mg protein as determined by absorbance at 280 nm) . The ultrafiltrate was dialyzed overnight against 0.1 M sodium borate (pH 8.0)/0.5 M sodium chloride, and then concentrated in an Amicon ultrafiltration cell to a volume of 10 ml (containing approximately 51 mg protein as determined by absorbance at 280 nm) .

The purified 1D7 monoclonal antibody (10 ml containing 51 mg antibody) was coupled to 4 g of CNBr- Sepharose according to the manufacturer's directions (Sigma Chemical Co., St. Louis, Missouri, Cat. No. C9142), yielding 12 ml derivatized resin. That resin (12 ml) was packed into a column and equilibrated with phosphate buffered saline ("PBS") . The reserved 150- ml aliquot of S-Sepharose eluate was passed through the column. The column was then washed sequentially with about 5 column volumes of PBS, about 5 column volumes of PBS supplemented with 0.5 M sodium chloride, and about 5 column volumes of PBS. Rhesus rsCD4 was eluted from the affinity column with about 5 column volumes of 50 mM glycine/HCl (pH 3.0)/250 mM sodium chloride. Fractions (1 ml each) were collected into tubes containing 75 μl 0.5 M HEPES (pH 7.2) to neutralize the eluted proteins immediately. Fractions having significant absorbance at 280 nm were pooled and stored at -80°C. The affinity purification step was repeated for the other 150 ml aliquots of S-Sepharose eluate. The affinity column eluate pools typically were 4-5 ml in volume and contained 1-2 mg of protein.

The above purification protocol resulted in substantially pure rhesus rsCD4, as analyzed by

Coomassie blue staining of gels (SDS-PAGE) . As shown in Figure 19, the purified rhesus rsCD4 ran as a doublet, with relative mobilities of 48 and 52 kDa on SDS-PAGE. In Figure 19, lane φl contains BRL High MW prestained marker (Cat. No. 6041LA) and lanes ≠2 and #3 contain 5 μg rhesus CD4, Not-Reduced and Reduced, respectively. The doublet is not believed to be a purification artifact because pulse chase experiments of transformed CHO cells have revealed that rhesus rsCD4 is secreted extracellularly as a doublet with the same mobility (data not shown) .

Other anti-CD4 monoclonal antibodies may be substituted for 1D7 in the above-described purification protocol. Such antibodies include 0KT4 and 0KT4a, available from Ortho Pharmaceuticals, Raritan, New Jersey.

It will be apparent to those skilled in the art that the protocol is easily adapted to the purification of other CD4 variants, as long as the anti-CD4 antibody selected for the affinity column binds to the CD4 variant being purified.

-Example IX - Cloning Of Soluble Chimpanzee CD4

Soluble chimpanzee CD4 was cloned in essentially the same fashion as rhesus CD4 using the reverse transcriptase/PCR amplification procedure described in P. J. Newman et al., supra. Reverse transcriptase reactions for first strand synthesis were carried out using two different primers: a specific oligonucleotide prepared from the 3' end of the soluble cynomolgus CD4 sequence and a nonspecific oligo dT. We obtained cultured, phytohemagglutinin ("PHA")-activated chimpanzee PBLs (a gift from David Watkins, New England Regional Primate Center) and prepared total RNA as described above.

We performed a reverse transcriptase reaction for first strand synthesis of cDNA using T4AID150 (Figure 6) to prime synthesis of CD4. We also used a nonspecific oligo dT (12-18 nucleotides) to prime first strand synthesis. PCR amplification was performed on each batch of DNA using T4AID148 (Figure 6) and T4AID150 as primers. Thirty PCR cycles were carried out for 1 minute 20 seconds at 94°C; for 3 minutes 20 seconds at 55°C; and for 4 minutes at 72°C. The resulting PCR fragments were incubated with Klenow fragment of E.coli Poll (New England Biolabs) and dXTPs to render them blunt-ended. The fragments were then gel purified and blunt-end ligated into sequencing plasmid pNNOδ, which had been digested with Smal and then treated with CIAP.

This vector was then used to transform E.coli JA221. Resulting colonies were analyzed by gel electrophoresis of ϋ£ϊ£I-digested alkaline mini-prep DNA. We sequenced one clone resulting from the T4AID150-primed PCR cDNA — pSQ205 — and one clone resulting from the oligo-dT primed cDNA — pSQ200. The nucleotide sequence and the deduced amino acid sequence of the soluble chimpanzee CD4 insert of pSQ205 (AA_₂ - AA₃₇₅) is depicted in Figure 20. The nucleotide sequence and deduced amino acid sequence of the soluble chimpanzee CD4 insert of pSQ200 (AA__2g-AA₃₇₄) is depicted in Figure 21. Figure 22 compares the nucleotide sequences of the pSQ200 and pSQ205 CD4 inserts. The amino acid sequences of the soluble chimpanzee CD4 proteins encoded by pSQ200 and pSQ205 are compared in Figure 23. In Figures 22 and 23, the mismatched nucleotides and amino acids, respectively, are marked with an asterisk. As depicted in Figure 23, the amino acid sequences display 99.749% similarity and 99.749% identity.

Figure 24 demonstrates that the soluble chimpanzee CD4 sequence from pSQ200 has 99.246% similarity and 98.99% identity to the soluble human CD4 sequence (from pBG391, supra) . Mismatched amino acids are marked with an asterisk.

Example X - Studies With Human CD4 Transgenic Mice We carried out studies with human CD4- transgenic mice in order to assess the immunogenicity of recombinant, soluble rhesus CD4 ("rhesus rsCD4") in an animal that, like humans, expresses and therefore should be tolerant of human CD4 protein. In this sense, the human CD4-transgenic mice are predictive of the immune response to the amino acid variant rhesus rsCD4 in man. The human CD4-transgenic mouse model provides a system for ascertaining whether a therapeutic benefit results from the immune response to a variant CD4 molecule.

We generated transgenic mice, which expressed human CD4 on the surface of both their thymocytes and splenocytes, by direct microinjection of a human CD4 cDNA transgene into fertilized mouse embryos. The methodology used to generate the human CD4 transgenic mice of this invention is described in B. Hogan et al.. Manipulating The Mouse Embrvo (Cold Spring Harbor Laboratory) (1986) . To achieve T cell-specific expression of human CD4, we constructed a transgene composed of human CD4 cDNA under the control of human CD2 gene regulatory elements [See G. Lang et al., "The Structure Of The Human CD2 Gene And Its Expression In Transgenic Mice", EMBO J.. 7, pp. 1675-82 (1988); D. R. Greaves et al., "Human CD2 3'-Flanking Sequences Confer High-Level T Cell-Specific, Position-Independent Gene Expression In Transgene Mice", Cell. 56, pp. 979-86 (1989)]. Our starting materials consisted of: (1) a Bluescript KS vector (Stratagene) containing a human CD2 gene fragment composed of 5'-flanking and coding sequences (a gift of Dr. Dimitris Kioussis, Laboratory of Gene Structure and Expression, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA) (Figure 25) ; (2) a poly III-I vector containing a human CD2 gene fragment composed of 3'-flanking sequence (a gift of Dr. Kioussis) (Figure 26) ; and (3) subclone PATY.6, which contained DNA coding for the full-length human CD4 protein (Figure 27) . These materials are described with more detail as follows. As depicted in Figure 25, the Bluescript KS vector contained a Sail/BamHl human CD2 fragment composed of -5 kb genomic, 5'-flanking DNA directly upstream of the CD2 coding region; an -0.2 kb genomic DNA fragment composed of the first exon and the first intron of the human CD2 gene; and an -1.8 kb cDNA fragment containing the remainder of the human CD2 gene (absent introns 2-4) . The Sail/BamHl fragment depicted in Figure 27 is substantially described in Lang, supra. Figure 1A (depicts the organization of the human CD2 gene, which contains 5 exons and 4 introns) ; Greaves supra. p. 980 and Figure 3 (CD2-A) (all introns but the first were removed) . The protocol set forth in Figure 25 differs from that of the above-cited documents in the following ways. The Kpnl site, which appears in Lang, supra. Figure 1A; Greaves, supra. Figure 3 (CD2-A) , was destroyed and changed, by site- directed mutagenesis, to a Sail site. In addition, a Sac site was destroyed and changed to the EcoRI site shown in Figure 25. This EcoRI site is in the CD2 gene 5' untranslated region. Finally, the EcoRV site in the second exon of the CD2 gene [see Lang, supra. Figure IB] was destroyed and changed to a stop codon. This stop codon, shown in Figure 25, prevents CD2 protein expression in the transgene.

As depicted in Figure 26, the poly III-I vector contained a -5.5 kb BamHl/Xbal DNA fragment of human CD2 gene 3'-flanking DNA [See Greaves, supra. Figure 3 (CD2-B) ] . Subclone PATY.6, containing DNA coding for full-length human CD4, was constructed from plasmids pBG178A [PCT patent application PCT/USδ8/02940] and pBG378 [PCT patent application PCT/USδδ/02940] as depicted in Figure 27. The sequence of the human CD4 gene in PATY.6 is depicted in Figure 28. As depicted in Figure 29, PATY.6 was digested with Bqlll. which cuts in the 5*- and 3'-untranslated regions of the human CD4 gene and treated with Klenow fragment to blunt the ends. EcoRI linkers were added and the 2.8 kb fragment containing human CD4 cDNA was isolated. This fragment was inserted into the unique EcoRI site located in the 5' untranslated region of the CD2 gene sequence in Bluescript KS. In this position, the CD4 cDNA was under the control of elements located immediately upstream in the CD2 gene 5'-flanking DNA. The construct was then digested with Xbal and partially digested with BamHl to isolate the 10 kb Bluescript KS fragment. The -5.5 kb BamHl/Xbal fragment from poly III-I was inserted into the 10 kb Bluescript KS fragment, placing control elements in the CD2 gene 3'- flanking DNA downstream of the human CD4 cDNA. Finally, the resulting construct was digested with Sail and NotI to isolate the human CD4 transgene.

Human CD4 transgenic mice were generated substantially as described in Hogan, supra. In particular, fertilized murine embryos were isolated at the single cell stage from (C57BL/6 x CBA/J) strain female mice (bred at the National Institute for Medical Research, Mill Hill, London) . A solution containing the human CD4 transgene was microinjected into the pronucleus of a given egg. Eggs surviving manipulation were transferred back into the oviducts of foster mothers. Upon birth, the genomes of the progeny were subjected to Southern blot analysis [see e.g., Southern, i_ fol. Biol.. 98, pp. 503-517 (1975)] to identify progeny carrying the transgene. Individuals carrying the transgene were then bred to establish transgenic lines of mice. The transgenic lines so established were maintained by sequential backcross onto C57BL/6 strain mice (Jackson Laboratories, Bar Harbor, ME) . Two independent lines of transgenic mice — line 310 and line 313 — were chosen for further studies. Line 310 has a relatively low copy number of the human CD4 transgene (approximately 2 copies/cell) ; line 313 has a higher copy number of the transgene (greater than 10 copies/cell) .

We employed immunofluorescent staining and FACS analysis to detect cell surface expression of the

_ human CD4 transgene in lines 310 and 313. Thymocytes and splenocytes were prepared from lines 310 and 313, as well as from nontransgenic C57BL/6 control mice. Thymocytes were prepared by removing the thymus from a mouse, placing it into RPMI 1640 media supplemented with 2 x 10^"5 2-mercaptoethanol, 2 mM L- glutamine, 100 units/ml penicillin G, 100 μg/ml streptomycin G, and 10% (v/v) fetal calf serum (hereinafter "Complete RPMI"), followed by pressing the organ between the frosted ends of slides (Fisher Scientific Co., Pittsburgh, PA, Cat. No. 12-544-2) to create a single cell suspension. The thymocytes were washed in Complete RPMI and passed through a cotton plug lodged in the neck of a 9-inch Pasteur pipette, to remove large debris. A cell count was then performed. Spleen cells were prepared by removal of a spleen, followed by cutting the spleen crosswise to mince the organ and then pressing the organ between the frosted ends of slides to create a single cell suspension. After washing once in Complete RPMI, the red blood cells were lysed with Hemolytic Geys solution according to the method described in B. B. Mishell & S. M. Shiigi, eds.. Selected Methods In Cellular Immunology (Freeman & Co., San Francisco) (1980). Viable cells were recovered free of debris by passage through a cotton plugged Pasteur pipette. Spleen cells were then counted. Immunofluorescent staining was performed using FITC-coupled Leu3a, a mouse monoclonal antibody specific for the extracellular region of human CD4 (Becton Dickinson, Cat. No. 7236) or FITC-coupled normal mouse IgG (Becton Dickinson "Simultest" reagent. Cat. No. 95-0012) as a negative control antibody. We carried out staining by incubating 5 x 10⁵ thymoctyes _vor splenocytes with FITC-coupled Leu3a or FITC-coupled mouse IgG at concentrations specified by the supplier in PBS supplemented with 2% fetal calf serum and 0.02% NaN₃ (total volume 100 μl) . The cells were incubated on ice for about 30 minutes, washed three times in the same buffer, and then analyzed on a FACStar fluorescence activated cell sorter. Figure 30 depicts the relative cell number

(linear scale) versus log fluorescence intensity of splenocytes and thymocytes from human CD4 transgenic mice (lines 310 and 313) and nontransgenic mice (strain C57BL/6) stained with FITC-Leu3a (dotted lines) and negative control FITC-mouse IgG (solid lines) . Log fluorescence intensity reflects the density of stained molecules/cell. Nontransgenic control cells showed no expression of human CD4. In contrast, both line 310 and line 313 expressed the human CD4 molecule on thymocytes, with line 313 expressing higher levels of the protein on most cells. Peripheral lymphocytes, i.e. splenocytes, bear significant levels of human CD4 only in line 313 mice. Since immunological tolerance is established, in large part, during T cell development in the thymus [see Sprent et al., Immunol. Rev.. 101, p. 173 (1986) ] we expected that both lines would be tolerant to immunization with human CD4 protein. Accordingly, both lines were used to study the immunogenicity of human rsCD4 and rhesus rsCD4 as described below. Example XI - Tolerance Studies With Human rsCD4

In order to determine whether expression of human CD4 impaired the ability of transgenic mice to respond to the human CD4 "self protein," we immunized transgenic (line 310) and nontransgenic mice with human rsCD4 and tested for the generation of antibodies to human CD4. The human rsCD4 used for all injections and assays that follow throughout this text was a gift of Dr. Tom Hageman, Biogen, Inc. The sequence of human rsCD4 is published in PCT/US88/02940.

The transgenic mice received either 50 μg human rsCD4 emulsified in 0.2 ml complete Freund's adjuvant ("CFA") (Colorado Serum Co., Denver CO, Cat. No. CS1450) injected intraperitoneally ("i.p.") or 50 μg human rsCD4 in CFA (0.2 ml) divided between and injected into each of the hind foot pads (0.05 ml/foot pad) . A control nontransgenic mouse was immunized with an irrelevant antigen — 50 μg pork insulin (Sigma Chemical Co., St. Louis, MO, Cat. No. 13505) in CFA (0.2 ml, i.p.). The mice were bled at days 7, 14, 24 and 40 post-immunization and serum samples were analyzed by ELISA on human rsCD4-coated plates, as described infra. for the presence of IgG-specific anti- human rsCD4 antibodies. On day 40, all transgenic mice were boosted with 50 μg human rsCD4 in RIBI adjuvant (RIBI Immunochem Research, Inc., Hamilton, MT, Cat. No. R-730) (0.2 ml, i.p.). The control mice were boosted with RIBI alone (0.2 ml, i.p.). Additional bleeds were collected on days 54, 63 and 76 post- immunization and the serum samples were again assayed by ELISA on human rsCD4-coated plates, as described infra. for the presence of anti-human rsCD4 antibodies.

The aforementioned ELISA assays were conducted as follows. First, 96-well polyvinyl plates (Dynatech Laboratories, Inc., Chantilly, VA, Cat. No. 001-010-2101) were coated with human rsCD4 (the same rsCD4 with which the mice were immunized) at 5 μg/ml in PBS (50 μl/well) for 2 hours at 37^βC or overnight at 4°C. No difference was found between coating at 37^βC for 2 hours or overnight at 4°C. The plates were washed 4-5 times using a Skatron A/S Micro Plate Washer and then blocked with PBS/1% BSA/0.01% Tween-20/0.05% NaN₃ (-250 μl/well) for 1 hour at room temperature. After removal of the buffer, each well received dilutions of sera (50 μl/well) in PBS/1% BSA/0.02% Tween-20/0.05% NaN₃, or a standard mouse monoclonal anti-human CD4 antibody specific for the extracellular region of CD4, described infra (50 μl/well in the same buffer) . The plates were incubated at 37^βC for 2 hours, then washed 4-5 times (Skatron A/S Microplate Washer) with PBS/0.01% Tween-20/0.05% NaN₃- Next, an alkaline-phosphatase coupled goat anti-mouse IgG (Fc specific) antibody (Jackson Immunoresearch, West Grove, PA, Cat. No. 11 5-055-071) (50 μl/well,

1/1000 final dilution in PBS/1%BSA/0.02% Tween-20/0.05% NaN₃) was added and the plates were incubated for 1 hour at 37°C. The plates were washed again (4-5 times with Skatron A/S Micro Plate Washer) and the substrate 4-nitrophenylphosphate (PNPP) (Boehringer Mannheim,

West Germany, Cat. No. 738-352) was added to the wells (150 μl of 10 mg/ml solution in 0.1 M glycine/1 mM MgCl./l mM ZnCl «6 H.O, pH 10.6). Absorbance was read at 405 nm (Molecular Devices Thermomax Microplate Reader) after achieving maximal, binding of the highest dilution of the standard antibody.

The mouse monoclonal anti-human CD4 antibody used in the aforementioned assay, 2-5-2E6, was produced by the following protocol. It should be noted, however, that any mouse monoclonal anti-human CD4 antibody generated by this procedure would be useful in the aforementioned assay. First, two Balb C mice (Jackson Immunoresearch, West Grove, PA) were immunized with 100 μg human rsCD4 in a 1:1 emulsion with CFA (i.p.). Two weeks later, one of the mice was boosted with 75 μg human rsCD4 in PBS (i.p.) and the other mouse was boosted with 75 μg human rsCD4 in a 1:1 emulsion with IFA (i.p.). One month after boosting, both mice were boosted with 50 μg human rsCD4 in PBS, intravenously. Three days after this boost, spleen cells from both mice were pooled for fusion with myeloma cells. The fusion was accomplished according to the standard procedure set forth in W. Goding, ed.. Monoclonal Antibodies: Principles and Practice (Academic Press, New York, 1983).

Two parallel assays were run on the supernatant resulting from the fusion, and antibodies giving a positive response to both assays were selected. One such assay was comprised of an ELISA on human rsCD4-coated plates, substantially as described supra. In particular, the supernatant was added to human rsCD4-coated plates, followed by the addition of a peroxidase-labelled goat anti-mouse IgG antibody. The other assay was comprised of an ELISA, substantially as described supra. on plates coated with a standard goat anti-mouse Ig. In particular, the supernatant was added to these plates, followed by ¹²⁵i- rsCD4 (human) .

Figure 31 shows the results of the ELISA assays used to determine whether expression of human CD4 in transgenic mice established tolerance to human rsCD4. Figure 31 presents serum titers for anti-human rsCD4 antibodies in transgenic mice (line 310) and nontransgenic mice at various times post-immunization. Antibody titers are expressed on a logarithmic scale as the reciprocal of the serum dilution which gave 50% binding relative to the standard monoclonal anti-human rsCD4 antibody. Solid symbols represent individual transgenic mice initially immunized with human rsCD4 in CFA (solid squares, foot pad injection; solid circles, i.p. injection). Open symbols represent individual nontransgenic mice initially immunized with human rsCD4 in CFA (open boxes, foot pad injection; open circles, i.p. injection). The negative control mouse (i.e., nontransgenic mouse injected with the irrelevant antigen) is represented by solid triangles. In an independent assay, identical results were obtained for negative control, transgenic mice immunized with the same irrelevant antigen (data not shown) . This assay illustrates that both the human

CD4 transgenic and nontransgenic mice mounted a primary antibody response to human rsCD4, however, the response of the human CD4 transgenic mice was significantly lower than that of the nontransgenic mice. Secondary immunization (the booster on day 40) resulted in a strong antibody response to human rsCD4 of higher titer in the nontransgenic mice. In contrast, the human CD4 transgenic mice failed to mount any increased response upon secondary immunization with human rsCD4. Instead, their anti-human rsCD4 antibody titer fell after secondary immunization. Thus, the expression of human CD4 as a self component in transgenic mice markedly impaired the ability of those mice to mount an immune response to human rsCD4, reflecting a difference in the repertoire of responsive lymphocytes between human CD4- expressing and non-expressing animals.

In an additional assay, we immunized two human CD4 transgenic mice (line 313) and two nontransgenic mice with 50 μg human rsCD4 emulsified in CFA (0.2 ml, i.p.), followed by 50 μg human rsCD4 in incomplete Freund's adjuvant ("IFA") (Colorado Serum Co., Denver, CO, CS #1451) (0.2 ml, i.p.) on day 35 post-immunization. As negative controls, two nontransgenic mice were immunized with 50 μg pork insulin (an irrelevant antigen) (0.2 ml, i.p.), followed by IFA only (0.2 ml, i.p.) on day 35 post-immunization. All six mice were bled for sera and the serum samples were assayed by ELISA for anti-human rsCD4 antibodies exactly as described above except that 96-well plates manufactured by Corning were used

(Corning Glass Works, Corning, NY, Cat. No. 25801) . No significant difference was found between the Dynatech and Corning microtiter plates used. The results obtained from this assay were consistent with the experimental data shown in Figure 31, thus supporting the observation that human CD4 transgenic mice are tolerant to the human CD4 protein.

We also analyzed the antibody response of human CD4 transgenic mice to human rsCD4 by immunofluorescent staining of human CD4-bearing cells to determine whether antibodies are generated that recognize the native, transmembrane form of the human CD4 molecule.

Staining was performed by incubating 5 x 10⁵ human Jurkat cells (American Type Culture Collection, Rockville, MD, Cat. No. TIB 152) in 100 μl PBS/2% fetal calf serum ("FCS")/0.02% NaN containing one tenth volume of sera collected on day 24 post-immunization from human CD4 transgenic mice (line 310) or nontransgenic mice (CS7BL/6) ; or, as a negative control, sera from a non-immunized, human CD4 transgenic mouse (line 310) . Immunizations were carried out exactly as detailed above (i.e., 50 μg human rsCD4/CFA; 0.2 ml i.p.). After incubation on ice for 30 minutes, the cells were washed in PBS/2% FCS/0.02% NaN₃. Then, FITC-coupled sheep anti-mouse Ig (H+L) reagent (Cappell, Cooper Biomedical, West Chester, PA, Cat. No. 1311-1744) was added (as specified by the supplier in PBS/2% FCS/0.02% NaN₃) and the cells were incubated for an additional 20 minutes on ice. The cells were washed two times, then analyzed on a FACStar fluorescence activated cell sorter.

Figure 32 shows the results of this FACS analysis in histograms plotting relative cell number (linear scale) vs. log fluorescence intensity. Solid lines indicate cells stained only with the second step reagent — FITC-conjugated sheep anti-mouse Ig ("control") . Dashed lines indicate cells stained with sera from human CD4 transgenic ("Tg") and nontransgenic ("NTg") mice, both immunized with human rsCD4. Dotted lines indicate cells stained with sera from unim unized nontransgenic mice ("control") .

The FACS analysis indicates that primary antibodies elicited in human CD4 transgenic mice on immunization with human rsCD4 do not recognize the native, transmembrane form of the human CD4 molecule. The antibodies appear to recognize only epitopes unique to the soluble form of human CD4. Thus, there is a clear difference between the response of human CD4 transgenic and nontransgenic mice to human rsCD4. In stark contrast to the nontransgenic mice, the transgenic mice did not mount an immune response to the "self" epitopes possessed by native, transmembrane human CD4.

Example XII - Antibody Characterization

In order to determine whether an immune response would be elicited in human CD4 transgenic mice by the amino acid variant rhesus rsCD4, we immunized transgenic (line 310) and nontransgenic mice with 50 μg rhesus rsCD4 (produced and purified as described supra) emulsified in CFA (0.2 ml, i.p.). These mice were boosted on day 43 post-immunization with 50 μg rhesus rsCD4 emulsified in IFA (0.2 ml, i.p.). In an independent assay, we immunized human CD4 transgenic (line 313) and nontransgenic mice with rhesus rsCD4 as described above. These mice were boosted on day 35 post-immunization as described above. In both assays, bleeds were collected and serum samples were analyzed by ELISA on various days post-immunization for antibodies recognizing rhesus rsCD4 and for cross- reactive antibodies recognizing human rsCD4. ELISA assays were performed as described in Example XI on plates coated with either rhesus rsCD4 or with human rsCD4 (5 μg/ml, diluted in PBS) .

The results of the ELISA assays are shown in Figure 33. The antibody titers shown were determined as follows. For sera reactive with human rsCD4, titers are expressed as the reciprocal of the serum dilution which gave 50% binding relative to the standard monoclonal anti-human rsCD4 antibody (see Example XI) . However, this monoclonal antibody did not bind to rhesus rsCD4-coated plates. Thus, a high titer, nontransgenic mouse anti-rhesus rsCD4 polyclonal sera which bound to both human and rhesus rsCD4-coated plates, was used as a standard for the anti-rhesus rsCD4 antibody assay. Specifically, the standard used was sera from a nontransgenic mouse immunized with 50 μg rhesus rsCD4 in CFA and boosted on day 43 with rhesus rsCD4 in IFA; sera was collected on day 7 of the secondary response (i.e., day 50 post-immunization). Anti-rhesus rsCD4 titers for experimental sera were defined on rhesus rsCD4-coated plates as the reciprocal of the serum dilution which gave 50% binding relative to the standard nontransgenic polyclonal anti-rhesus rsCD4 serum.

In order to convert the titers obtained for rhesus rsCD4-specific antibodies to values directly comparable to titers obtained for human rsCD4-specific antibodies, a conversion factor was established. This was done by assaying the standard polyclonal anti- rhesus rsCD4 sera in parallel on both human and rhesus rsCD4-coated plates, thereby directly measuring its relative binding capacity with each form of rsCD4. We determined that the anti-rhesus rsCD4 sera bound to rhesus rsCD4 two times better than it bound to human rsCD4. That is, binding of the standard anti-rhesus rsCD4 sera to human rsCD4-coated plates was equal to binding of the sera at a two-fold dilution on rhesus rsCD4-coated plates. Thus, the anti-rhesus rsCD4 antibody titer of the standard sera was twice its anti- human rsCD4 antibody titer. All experimental anti- rhesus rsCD4 serum titers were adjusted accordingly by comparison to the standard polyclonal anti-rhesus rsCD4 serum.

In Figure 33, the solid symbols represent human CD4 transgenic mice (line 310) ("Tg") and open symbols represent nontransgenic mice ("NTg") immunized with rhesus rsCD4 in CFA on day 0 and boosted with rhesus rsCD4 in IFA on day 43. Individual mice are indicated by squares or circles. Open triangles represent the response of nontransgenic mice that received pork insulin (50 μg) emulsified in CFA (0.2 ml, i.p.) as an irrelevant control immunogen on day 0 and IFA alone (0.2 ml, i.p.) on day 43. The left panel depicts the anti-rhesus rsCD4 titer of the sera at various days post-immunization. The right panel depicts the anti-human rsCD4 titer at various days post-immunization. The results obtained from the independent assay with line 313 transgenic mice were consistent with the experimental data shown in Figure 33.

As demonstrated in Figure 33, immunization of human CD4 transgenic and nontransgenic mice with rhesus rsCD4 elicited antibodies that recognized the immunogen (rhesus rsCD4) and antibodies that recognized human rsCD4. These results indicate that human CD4 transgenic mice can generate an anti-rhesus CD4 immune response that is comparable to the response of nontransgenic mice. Moreover, the results demonstrate that immunization with rhesus rsCD4 succeeded in "breaking tolerance" in the human CD4 transgenic animals, because both human CD4 transgenic mice and nontransgenic mice produced high titer antibodies that bound to human rsCD4.

The sera of human CD4 transgenic and nontransgenic mice immunized with rhesus rsCD4 was also analyzed for antibodies recognizing the native, transmembrane form of human CD4. Immunofluorescent staining was performed on normal rhesus peripheral blood lymphocytes ("PBLs") (New England Primate Center, Southboro, MA) and on normal human PBLs (obtained from a healthy donor) , as sources of normal CD4⁺ lymphocytes.

Rhesus and human PBLs were isolated as follows. Blood (10 ml) was diluted two-fold with RPMI- 1640 media (not supplemented) and layered over 3 ml of Lymphocyte Separation Media (Organon Teknika, Durham, NC, Cat. No 36427) in a 50ml tube at room temperature. The tube was centrifuged at room temperature for 30 minutes at 400 x g . PBLs were collected from the interface and washed three times with PBS/2% FCS/0.02% NaN₃ prior to staining. We also stained human PBLs (prepared as described immediately above) that had been activated by exposure to the mitogen phytohemagglutinin ("PHA") followed by maintenance in recombinant interleukin-2 (IL-2) , since these cells might present a somewhat different form of the human CD4 molecule. Activated human PBLs were prepared as follows. Normal human PBLs (2 x 10⁶ cells/ml in 10 ml of Complete RPMI) were placed in a Costar T-25 flask (Costar, Cambridge, MA, Cat. No. 3025) with 1 μg/ml of PHA (Difco Laboratories, Detroit, MI, Cat. No. 3110-57-3). The cells were cultured for three days at 37^βC in a humidified, 5% CO incubator. After three days, the cells were adjusted to a density of 1 x 10⁶ cells/ml in Complete RPMI media and recombinant IL-2 ("rIL-2") was added at 20 units/ml (r-T-Cell Growth Factor human, rhTCGF, Lot No. NP 6003S09, 2.1 x 10⁶ units/mg in 50 mM acetic acid, manufactured at Biogen, Inc. , Cambridge, MA, stored at -70^βC) . Fresh rIL-2 was added every three days and cell density adjusted, if necessary, to maintain cell density at 1 x 10⁶ cells/ml. The cells were cultured for a total of 3-4 weeks. No difference was apparent among cells used within this time period.

Immunofluorescent staining was performed as described in Example X using 3 x 10⁵ PBLs (rhesus, human or activated human) and sera (at a one tenth dilution) from the transgenic and nontransgenic mice immunized with rhesus rsCD4. The monoclonal antibody Leu3a (Becton Dickinson, Mountain View, CA, Cat. No. 6320) — which recognizes CD4 on both human and rhesus T cells — was used (as specified by supplier) as a positive control for staining. FITC-coupled goat anti- mouse IgG Fc-specific antibody (Jackson Immunoresearch, West Grove, PA, Cat. No. 115-015-071) was used as the second step reagent. The stained cells were analyzed by FACS, as described in Example X.

Figure 34 depicts the immunofluorescent staining of rhesus, human and human PHA-activated PBLs with (1) the positive control Leu3a monoclonal antibody (top row, dotted lines), (2) the second step reagent alone, i.e., negative control staining (top row, solid lines) , (3) anti-rhesus rsCD4 transgenic sera ("Tg") (dotted lines, middle row), (4) anti-rhesus rsCD4 nontransgenic sera ("NTg") (dotted lines, bottom row) , and (5) sera from nontransgenic mice immunized with pork insulin in CFA and boosted with IFA alone, i.e., negative control staining (solid lines, middle and bottom rows) . All sera are from day 19 of the secondary response (i.e., day 62 post-immunization).

This experiment indicates that both the human CD4 transgenic sera and the nontransgenic sera contained antibodies recognizing native transmembrane rhesus CD4. However, only nontransgenic sera contained antibodies recognizing native, transmembrane human CD4 on either freshly isolated or activated human PBLs.

Example XIII - Potential For Prophylaxis Or Treatment Of HIV Infection

We next determined whether rhesus rsCD4 immunization would elicit antibodies useful for prophylaxis and treatment of HIV infection, for example, antibodies recognizing HIV. Elicitation of such antibodies is believed to be possible based on observations supporting the existence of immunological networks (i.e., the elicitation by antibodies of anti- idiotype antibodies) [see e.g., I. M. Roitt, et al.. Immunology, pp. 10.1-10.11 (Gower Medical Publishing) (1985)]. In general, an antigen elicits antibodies bearing a particular variable region structure (idiotype) which in turn may elicit anti-idiotype antibodies. Certain of those anti-idiotype antibodies will be structurally related to the original antigen, such that they compete with the original antigen for binding to the idiotype antibodies. More specifically, antibodies elicited by a CD4 immunogen (anti-CD4 antibodies) will have a particular specificity (idiotype structure) and may elicit anti-idiotype antibodies that are the internal image of the idiotype antibodies. Those anti-idiotype antibodies will be structurally similar to the immunogen, CD4, and will bind HIV as does CD4.

A. Assays For HIV gpl20 Binding Activity

In order to test this possibility, ELISA assays were performed, substantially as described in Example XI, on plates coated with purified HIV gpl20 (5 μg/ml in PBS) and alkaline-phosphatase conjugated goat anti-mouse IgG specific detection reagent, followed by the substrate PNPP. The results of this assay are shown in Figure 35, which depicts HIV gpl20 binding activity in sera of a transgenic mouse

(line 310) ("Tg") and a nontransgenic mouse ("NTg") , both immunized and boosted with rhesus rsCD4 emulsified in Freund's adjuvant, as described in Example XII. The graphs depict absorbance at 405 nm versus serum dilution. Solid circles represent sera from day 10 of the primary anti-rhesus rsCD4 response (i.e., day 10 post-immunization) . Solid triangles represent sera from day 7 of the secondary anti-rhesus rsCD4 response (day 50 post-immunization) . Solid squares represent sera from day 19 of the secondary response (day 62 post-immunization) . Open circles represent sera from day 28 of the secondary response (day 71 post- immunization) . This assay demonstrated that upon immunization with rhesus rsCD4, gpl20 binding activity was elicited in human CD4 transgenic mice. Little or no such activity was elicited in nontransgenic mice immunized with rhesus rsCD4. The data depicted in Figure 35 are similar to the results obtained with two other human CD4 transgenic (line 310) and four other nontransgenic mice immunized with rhesus rsCD4. In addition, we found no detectable gpl20 binding activity in control sera from Tg and NTg mice immunized with pork insulin in CFA, followed by IFA (data not shown) . Figure 36 depicts the kinetics of appearance of human rsCD4 binding activity (left panel) and HIV gpl20 binding activity (right panel) for two line 313 transgenic mice (solid circles and squares) and two nontransgenic mice (open circles and squares) immunized with 50 μg rhesus rsCD4 in CFA (0.2 ml, i.p.) and boosted on day 35 post-immunization with 50 μg of rhesus rsCD4 in IFA (0.2 ml, i.p.). Figure 36 also depicts human rsCD4 and HIV gp^'120 binding activities for two negative control mice (one transgenic, one nontransgenic) immunized with 50 μg pork insulin in CFA (0.2 ml, i.p.) and boosted with IFA (0.2 ml, i.p.) on day 35 post-immunization (solid and open triangles) . The data are plotted as anti-human rsCD4 and anti-gpl20 antibody titer (determined by ELISA on human rsCD4- coated plates, as described in Example XI, and on gpl20-coated plates, as described above) versus days post-immunization. The titer for anti-gpl20 binding activity is expressed as ng equivalents/ml relative to a standard gpl20-specific mouse monoclonal antibody (anti-HIV-1 gpl20N, sequence specific, neutralizing) (Du Pont Company, NEN Research Products, Wilmington, DE, Cat. No. NEA-9305) . Although both transgenic and nontransgenic mice responded to rhesus rsCD4 by making antibodies cross-reactive for human rsCD4, only the trangenic mice immunized with rhesus rsCD4 developed significant anti- HIV gpl20 titers. The gpl20 binding activity appeared late in the primary response or early in the secondary response to rhesus rsCD4. During the course of the secondary response, the anti-gp 120 titer leveled out or increased slightly. The occurrence of gpl20-specific binding activity and its uniqueness to the sera of transgenic mice immunized with rhesus rsCD4 is striking. We wished to demonstrate that the gpl20-specific binding activity was due to antibodies with combining sites specific for the gpl20 molecule, and not due to antibodies specific for rhesus rsCD4, which bind to the immunogen or to a fragment thereof, which in turn binds to gpl20. Such a possibility is unlikely, since both transgenic and nontransgenic mice make anti-rsCD4 antibodies, but only transgenic mice have significant gpl20-specific binding activity. Nevertheless, we took two independent approaches to demonstrate that the elicitation of gpl20-specific antibodies was in fact occurring in human CD4 transgenic mice. These approaches are described below. They demonstrate that: (1) gpl20-specific antibodies can be separated from rsCD4-specific antibodies contained in the anti-rhesus rsCD4 sera of transgenic mice; and (2) gpl20-specific Ig-producing B cells have been primed in rhesus rsCD4- immunized transgenic mice.

B. Fractionization of HIV gpl20-specific Antibodies

Sera obtained from rhesus rsCD4-immunized human-CD4 transgenic and nontransgenic mice were fractionated on a gpl20 affinity column in order to purify gpl20-specific antibodies and to separate them from other activities in the whole sera. The gpl20 affinity column was prepared as follows. Purified gpl20 (1 ml) at a concentration of 5 A₂₈₀/ml in 0.1 M sodium borate/0.3 M NaCl (pH 8.4) was coupled to 0.3 g Cyanogen bromide activated Sepharose 4B (Sigma, Cat. No. C-9142) according to the manufacturer's recommended _% protocol. The coupling efficiency was checked by SDS- PAGE analysis and found to be greater than 95 percent. The resin was washed with 5 volumes of 50 mM glycine/0.5 M NaCl (pH 3.0), followed by 5 volumes of 20 mM Tris-HCL/0.5 M NaCl/0.02% sodium azide, and stored at 4°C in the last wash buffer.

Sera used for "large scale" fractionation experiments aimed at recovering gpl20-specific antibodies were whole sera (100 μl) derived from a human CD4 transgenic mouse (line 313) and a nontransgenic mouse, both immunized with 50 μg rhesus rsCD4 in CFA (0.2 ml, i.p.) on day 0, and boosted with 50 μg rhesus rsCD4 in IFA (0.2 ml, i.p.) on day 35.

The specific serum samples used were from day 49 post- immunization. PBS (pH 7.5) (900 μl) was added to each 100 μl aliquot of serum sample. Twenty μl of each diluted serum sample was set aside as representative of starting material.

The rest of each sample (980 μl) was added to 250 μl gpl20-coupled Sepharose (prepared as described supra) in a 1.7 ml epitube (American Bioanalytical, Cat. No. 702800) . The epitubes were capped and rocked for three hours at room temperature on a TEK-PRO tube rocker (Cat. No. R4185-10) , then centrifuged at 10,000 x g for 5 seconds in order to pellet the resin. The supernatant containing unbound material was removed. The gpl20-Sepharose (with bound material) was transferred into a column made from a 2 ml plastic pipet plugged with glass wool and washed by gravity with 3 x 0.5 ml PBS. Two washes were performed with 500 μl/wash of PBS/0.5 M NaCl, and two final washes were performed with 500 μl/wash PBS. Bound material was then eluted from the column with 100 μl of 50 mM glycine (pH 3.0)/250 mM NaCl/1 mg/ml BSA. Six elution fractions (-100 μl/each) were collected from each column. Each fraction was neutralized immediately after collection by adding 7.5 μl of 0.5 M HEPES (pH 7.2) .

The reserved starting material, the "unbound fraction" (i.e., the supernatant after the initial incubation with sera) , the PBS washes, and the eluted fractions were assayed by ELISA on gpl20-coated, human rsCD4-coated and rhesus rsCD4-coated microtiter plates, as described in Examples XIII, XI, and VII respectively. Antibody titers or relative concentrations were calculated as described in Example XII, yielding the concentration of gpl20- specific or rsCD4-specific antibodies in each fraction. Total units of antibody could be calculated for each fraction because the antibody concentration was determined and the total volume of each fraction was known. The results of this experiment are depicted in Figure 37. The left panel displays percent anti-gpl20 binding activity in the various fractions for transgenic (solid bars) and nontransgenic (open bars) rhesus rsCD4-immunized mice. The right panel displays percent anti-human rsCD4 activity in the various fractions. The starting material is defined as having 100% of the binding activities.

Approximately 60% of the gpl20-specific binding activity of the transgenic anti-rhesus rsCD4 sera was removed by exposure to the gpl20-Sepharose. Other data suggest that more gpl20-specific binding - 76 -

activity could have been removed by simply increasing the amount of gpl20-Sepharose, because 100% of gpl20- binding activity was removed when a smaller volume of this same serum sample was applied to the column (data not shown) . Only negligible gpl20-specific binding activity was evident in the PBS washes. However, a substantial amount of gpl20-specific binding activity was eluted from the column. In contrast, antibodies specific for human rsCD4 did not bind to the gpl20 column (less than 1 ng/ml) and essentially no anti- human rsCD4 activity was detected in the eluate fraction. The results for rhesus rsCD4-specific binding activity are consistent (data not shown) . These data indicate the gpl20-specific binding activity in human CD4 transgenic anti-rhesus rsCD4 sera is due to gpl20-specific antibodies and is not mediated by anti-rsCD4 antibodies.

C. HIV-gpl20/Saline Challenge

The second approach used to determine whether gpl20-specific antibodies are in fact elicited in human CD4 transgenic mice immunized with rhesus rsCD4 is based on the following hypothesis. If the response to rhesus rsCD4 results in the stimulation of B cells bearing Ig receptors specific for gpl20 and the secretion of anti-gpl20 antibodies, then mice previously immunized with rhesus rsCD4 and subsequently challenged with the gpl20 antigen itself would be expected to mount a boosted response to gpl20 and not simply a primary anti-gpl20 response. To test this hypothesis, a human CD4 transgenic mouse (line 313) which had been primed to rhesus rsCD4 — 50 μg rhesus rsCD4 in CFA (0.2 ml, i.p.) on day 0, 50 μg rhesus rsCD4 in IFA (0.2 ml, i.p.) on day 35 — was challenged with 50 μg gpl20 in saline (0.2 ml, i.p.) on day 75 post-immunization. The basis for gpl20 challenge in saline is that administration of an antigen in saline is not sufficient to elicit a strong primary immune response to a protein antigen, but can boost a response for which the animal has been previously primed. Two control mice were included in this experiment. One transgenic control mouse (line 313) received 50 μg pork insulin in CFA (0.2 ml, i.p.) on day 0, followed by IFA alone (0.2 ml, i.p.) on day 35, then received 50 μg gpl20 in saline (0.2 ml, i.p.) on day 75. A second transgenic control mouse (line 313) had no prior immunizations, but received 50 μg gpl20 in saline (0.2 ml, i.p.) on day 75. The results for this experiment are depicted in Figure 36, which shows anti- gpl20 IgG antibody titer as measured by solid phase ELISA.

We found that both control mice failed to generate a substantial primary response to the gpl20 administration in saline. The transgenic mouse primed to rhesus rsCD4 in Freund's adjuvant, however, generated significantly increased levels of the gpl20- specific titer in response to the gpl20/saline challenge. Moreover, this increased titer was much higher than would be expected if it were simply due to a primary anti-gpl20 response. This result indicates that exposure to rhesus rsCD4 primed for the gpl20 response elicited by subsequent exposure to gpl20 itself. This result also indicates a method whereby the gpi20 binding response elicited by rhesus rsCD4 immunization might be augmented.

D. Immunofluorescent Staining Of Cells Expressing gp!60

We next examined whether anti-gpl20 antibodies elicited by rhesus rsCD4 immunization of human CD4 transgenic mice were able to recognize gp120-expressing cells. Immunofluorescent staining was performed with transformed CHO cells expressing recombinant gpl60 on their surface (In Vitro International Culture Collection, Linthicum, MD, IVI- 10236) and, as a control population with transformed CHO cells expressing recombinant LFA-3 [PCT patent application PCT/US88/01924].

The CHO cells, which are adherent, were recovered from cell culture flasks for staining by treatment with 5 mM EDTA/PBS (pH 7.5) for 5 minutes at 37^βC, followed by knocking the culture flask (Costar T- 75 or T-150) containing the cells and collecting the resuspended cells in a 50 ml conical tube. The cells were washed twice with cold Staining Buffer (PBS/2% FCS/0.02% NaN₃) . Staining was performed as described supra. with 5 x 10⁵ cells (in 50 μl Staining Buffer) incubated with various sera at 1/10 final dilution. As a positive control, the Du Pont anti-HIV-1 gpl20N mouse monoclonal antibody was used at 10 μg/ml. As a negative control, an irrelevant, isotype-matched mouse myeloma antibody produced by MOPC-21 (IgG.,k) (Litton Bionetics, Charleston, SC) was used at 10 μg/ml. After incubating for 30 minutes at 4^βC, the cells were washed three times with Staining Buffer. Then, the cells were incubated for 30 minutes at 4^βC with FITC-coupled goat anti-mouse Ig (Jackson Immunoresearch, Cat. No. 115- 016-062) at a 1/20 final dilution in Staining Buffer to detect mouse antibodies bound to the cell surface. The cells were then subjected to FACS analysis, the results of which are shown in Figure 39.

Figure 39A depicts the results of staining CHO cells expressing recombinant gpl60 with the negative control reagents FITC-goat anti-mouse Ig ("FITC-G M Ig") alone (solid line) , or with MOPC-21 Ig ("7-k") and FITC-Goat anti-mouse Ig (dotted line). The staining with these two negative controls was identical.

Figure 39B (left) shows that the staining of recombinant gpl60 CHO cells with the gpl20-specific monoclonal antibody ("α gpl20 mAb") (solid line) is shifted to a higher fluorescence intensity as compared to staining with the irrelevant MOPC-21 negative control antibody (dotted line) . In contrast, staining

_ of recombinant LFA-3 CHO cells (Figure 39B, right) with the gpl20-specific antibody and the control MOPC-21 antibody are indistinguishable.

Staining of the recombinant gpl60 CHO cells with the gpl20-specific monoclonal antibody decreased as it was titered down to 1 μg/ml (Figure 39C) , and further to 0.1 μg/ml (Figure 39D) , as compared to Figure 39B.

Staining with mouse sera are shown in Figures 39E and 39F. Control mouse sera A and B were obtained from a transgenic mouse that received 50 μg pork insulin in CFA (0.2 ml, i.p.) on day 0, IFA alone (0.2 ml, i.p.) on day 35, and gpl20/saline (0.2 ml, i.p. on day 75. Sera A was taken from this mouse on day 75 before boosting with gpl20/saline, and Sera B was taken on day 101 post-immunization (day 26 post- gpl20/saline boost). As shown in Figure 38, Group II, this mouse generated only a weak primary anti-gpl20 response. Figure 39E reveals that the two control sera — A and B — were indistinguishable in their staining of recombinant gpl60-CHO cells. A third sera ("sera C") was obtained from a transgenic mouse (line 313) immunized with 50 μg rhesus rsCD4 in CFA (0.2 ml, i.p.) on day 0, boosted with 50 μg rhesus rsCD4 in IFA (0.2 ml, i.p.) on day 35, and challenged with gpl20 in saline (0.2 ml, i.p.) on day 75. Sera C was isolated from this mouse 26 days after - 62 -

the gpl20/saline challenge. As shown in Figure 38, Group I, this transgenic mouse generated a high titer anti-gpl20 response. Interestingly, sera C stained with higher fluorescence intensity than control sera B (see Figure 39F) , with a shift in fluorescence intensity comparable to that observed with the Du Pont gpl20-specific monoclonal antibody staining. Sera C staining was specific for gpl60-expressing CHO cells (see Figure 39F, right) . The above experiment demonstrates that gpl20-specific antibodies recognizing cell surface gpl60 molecules were elicited in human rsCD4 transgenic mice by immunization with rhesus rsCD4.

E. Infectivjty Assays To determine the potential therapeutic effects of antibodies raised in response to rhesus rsCD4 by human CD4 transgenic mice, sera from the transgenic mice were subjected to each of two in vitro assays. The first assay measured inhibition of HIV infectivity. The second assay measured inhibition of syncytia formation amongst HIV infected cells. For the infectivity measurements, a microassay was performed based on the protocol described in Robert-Guroff et al., "HTLV-III- neutralizing Antibodies In Patients With AIDS And AIDS- related Complex", Nature. 316, p. 72 (1985). Specifically, 100 TCID_gQ of an HTLV-IIIB isolate in supplemented RPMI (RPMI 1640 medium containing 10 mM HEPES (pH 6.8) and 2mM glutamine, supplemented with 20% FBS) (20 μl) was added to 20 μl of undiluted mouse sera or human rsCD4 (the positive control) . Both the serum samples and the human rsCD4 were titrated. After incubation for 1 hour at 4^βC, and then 15 minutes at room temperature, 4 x 10⁴ C8166 cells in supplemented RPMI (10 μl) were added to each 40 μl sample of HTLV/serum and HTLV/rsCD4. C8166 is a CD4^* transformed human umbilical cord blood lymphocyte cell line [J. Sodroski et al.. Nature. 322, pp. 470-74 (1986)]. After incubation for 1 hour at 37^βC, aliquots of each mixture were put into 3 wells (15 μl/well) and each well was brought to a total volume of 200 μl with the supplemented RPMI media. The wells were visually scored at least 5 days later for the presence of syncytia (+) or absence of infection (-) .

In three independent microassays, performed as described above, 4 transgenic anti-rhesus CD4 serum samples and 1 nontransgenic anti-rhesus CD4 serum sample were measured. In each assay, an independent control serum sample was included. These control samples came from a nontransgenic mouse immunized with an irrelevant antigen — moth cytochrome C — in CFA, and boosted with the same antigen in IFA [See R. H. Schwartz, "Key Lymphocyte Recognition of Antigen In Association With Gene Products Of The Major

Histocompatibility Complex", Ann. Revs_τ Jmnun- _r 3, pp. 237-61 (1985)]. In each assay, the control mouse sera blocked infectivity out to dilutions of 1/16 or greater. No protective effect was observed for either transgenic or nontransgenic anti-rhesus CD4 sera at dilutions greater than 1/16.

We believe that these observations are inconclusive for the following reasons. The nonspecific blocking effects characteristic of normal mouse sera limited our analysis of transgenic anti- rhesus sera to dilutions greater than 1/16 — dilutions that may have contained an antibody titer that was too low to reveal protective effects under the conditions in vitro. Moreover, the assay, as performed, could detect blocking activity due to anti-gpl20 antibodies and/or anti-transmembrane CD4 antibodies. Yet a nontransgenic anti-human rsCD4 serum, which contained anti-transmembrane CD4 antibodies, and which previously showed strong blocking activity in syncytia assays was unable to even partially block infectivity in this assay. Thus, although human rsCD4 does provide a positive control for blocking (at concentrations of about 1 μg/ml) , the antibody titer in mouse sera may have been too low to block infection under these assay conditions. (We believe that the titer of anti-gpl20 antibodies was less than 1 μg/ml when diluted 1/16 based on ELISA estimates of antibody concentration) . The assay we performed was simply scored as "+" (presence of syncytia) or "-" (absence of infection) . At present, there is no way to quantitate differences in the level of infection or to detect a delay in kinetics. Finally, our analysis was limited to HTLV- IIIB, a laboratory strain. Assays using HIV patient isolates may produce more conclusive results. Transgenic anti-rhesus CD4 mouse sera was also tested for its ability to block syncytia formation between HIV-infected H9 cells and uninfected C8166 cells, as described in B. D. Walker et al., Proc. Natl. Acad. Sci. USA. 84, pp. 8120-24 (1984). Specifically, we incubated 5 x 10³ H9 cells chronically infected with HTLV-IIIB in 100 μl RPMI 1640 medium containing 10 mM HEPES (pH 6.8) and 2 mM glutamine, supplemented with 20% FBS for 30 minutes at 37°C in 5% CO. with samples of transgenic anti-rhesus CD4 mouse sera. (H9 cells are available from the AIDS Research and Reference

Reagent Program, NIH, Bethesda, MD.) We then added 15 x 10³ uninfected C8166 cells in 100 μl media to a final volume of 200 μl in each well, incubated at 37°C in 5% C02, and counted the total number of syncytia per well at 2 hours and 24 hours after adding the C8166 cells. Parallel co-cultivations used nontransgenic sera from mice immunized with an irrelevant antigen — pork insulin — in CFA and boosted with IFA (negative control) , or an anti-human CD4 monoclonal antibody at 10-0.62 μg/ml (positive control). We considered a positive result as a 50% reduction in syncytia compared to controls.

Two independent assays were performed as described above. In one assay, one transgenic anti- rhesus CD4 serum sample showed blocking activity, as did two nontransgenic anti-rhesus CD4 serum samples. In a second experiment, the same transgenic antisera and the same nontransgenic antisera (containing anti- human transmembrance CD4 antibodies) failed to demonstrate a blocking effect.

Microorganisms and recombinant DNA molecules according to this invention are exemplified by cultures deposited in the In Vitro International, Inc. culture collection in Linthicum, Maryland, U.S.A. on April 26, 1990, and identified as: pSQ131 / E. COli JA221 pSQ134 / E. COli JA221 pSQ136 / E. coli JA221 PSQ146 / E. coli JA221 pSQ162 / E. COli JA221 pSQ205 / E. coli JA221 pSQ200 / E. coli JA221 pDGlOO / E. COli JA221 pBG341JOD.rhT4 / E. COli JA221 These cultures were assigned accession numbers IVI 10243-10251, respectively.

While we have hereinbefore described a number of embodiments of this invention, it is apparent that our basic embodiments can be altered to provide other embodiments which utilize the processes and - 66 -

compositions of this invention. Therefore, it will be appreciated that the scope of this invention includes all alternative embodiments and variations which are defined in the foregoing specification and by the claims appended hereto; and the invention is not to be limited by the specific embodiments which have been presented herein by way of example.

Claims

CLAIMS We claim:

1. A DNA sequence coding for an amino acid variant or derivative of human CD4, or a fragment thereof, that elicits in a human antibodies that bind to HIV gpl20.

2. The DNA sequence according to claim 1, excluding DNA sequences encoding murine CD4, rat CD4, rabbit CD4 and sheep CD4.

3. The DNA sequence according to claim 2, further excluding DNA sequences encoding a primate CD4.

4. The DNA sequence according to claim l, wherein the amino acid variant is a polypeptide having an amino acid sequence differing from that of human CD4 at one or more sites corresponding to the sites of amino acid divergence of primate CD4 from human CD4, or fragments thereof.

5. The DNA sequence according to claim 4, wherein the one or more sites of amino acid divergence from human CD4 are selected from the group consisting of the sites depicted in ?igures 5, 17, 23 and 24.

6. The DNA sequence according to claim 1, wherein the amino acid variant is selected from the group consisting of mammalian CD4 and fragments thereof.

7. The DNA sequence according to claim 6, wherein the amino acid variant is selected from the group consisting of cynomolgus monkey CD4, rhesus monkey CD4, chimpanzee CD4 and fragments thereof.

8. The DNA sequence according to claim 7, wherein the DNA sequence encodes a soluble CD4 protein selected from the group consisting of cynomolgus monkey soluble CD4 proteins, rhesus monkey soluble CD4 proteins and chimpanzee soluble CD4 proteins.

9. The DNA sequence according to claim 1 or 2, wherein the amino acid variant is selected from the group consisting of:

(a) the DNA inserts of pSQ136, pSQ134, pSQ131, pSQ146, pSQ162, pBG341JOD.rhT4, pSQ200, pSQ205, and pDGlOO;

(b) DNA sequences that hybridize to one or more of the foregoing DNA inserts under conditions equivalent to about 20^βC to 27^βC below T _t and 1 M sodium chloride; and

(c) DNA sequences degenerate to any of the foregoing DNA sequences.

10. The DNA sequence according to claim 9, wherein the amino acid variant is selected from the group consisting of:

(a) the DNA insert of pBG341J0D.rhT4;

(b) DNA sequences that hybridize to the foregoing DNA insert under conditions equivalent to about 20°C to 27°C below T _cι and 1 M sodium chloride; and

(c) DNA sequences degenerate to any of the foregoing DNA sequences.

11. A recombinant DNA molecule comprising a DNA sequence selected from the group consisting of the DNA sequences of claims 1, 4 and 9 and one or more - 69 -

expression control sequences operatively linked to the DNA sequence.

12. A unicellular host transformed with a recombinant DNA molecule of claim 11.

13. The unicellular host according to claim 12, wherein the host is selected from the group consisting of strains of E.coli. Pseudomonas. Bacillus. Streptomyces. yeast, fungi, animal cells, plant cells, insect cells and human cells in tissue culture.

14. A polypeptide coded for by a DNA sequence of any one of claims 1-10.

15. The polypeptide according to claim 14, wherein the polypeptide is selected from the group consisting of a polypeptide of the formula AA₁-AA₄₃₃ of Figure 4 (cynomolgus monkey) , a polypeptide of the formula AA.-AA_37g of Figure 4 (cynomolgus monkey) , a polypeptide of the formula AA.-AA_37g of Figure 15 (rhesus monkey) , a polypeptide of the formula AA_χ- AA₃₇₄ (pSQ200) of Figure 23 (chimpanzee) , a polypeptide of the formula AA₁-AA_37g (pSQ205) of Figure 23 (chimpanzee) , a polypeptide of the formula AA.-AA_18Q of Figure 4 (cynomolgus monkey) , a polypeptide of the formula AA -AA.₈₀ of Figure 15 (rhesus monkey) , a polypeptide of the formula AA -AA.₈₀ (pSQ200) of Figure 23 (chimpanzee) , a polypeptide of the formula AA₁-AA.₈₀ of Figure 23 (chimpanzee) and portions of any of the foregoing polypeptides.

16. An amino acid variant or derivative of human CD4, or a fragment thereof, that elicits in a human antibodies that bind to HIV gpl20.

17. The amino acid variant according to claim 16, which is a variant of soluble human CD4.

18. The amino acid variant according to claim 16, excluding murine CD4, rat CD4, rabbit CD4 proteins and sheep CD4.

19. The amino acid variant according to claim 18, further excluding primate CD4.

20. The amino acid variant according to claim 16, which is a polypeptide having an amino acid sequence differing from that of human CD4 at one or more sites corresponding to the sites of amino acid divergence of primate CD4 from human CD4.

21. The amino acid variant according to claim 20, wherein the one or more sites of amino acid divergence from human CD4 are selected from the group consisting of the sites depicted in Figures 5, 17, 23 and 24.

22. The amino acid variant according to claim 16, which is selected from the group consisting of mammalian CD4 and fragments thereof.

23. The amino acid variant according to claim 22, which is selected from the group consisting of cynomolgus monkey CD4, rhesus monkey CD4, chimpanzee CD4 and fragments thereof.

24. The amino acid variant according to claim 23, which is selected from the group consisting of cynomolgus monkey soluble CD4 proteins, rhesus monkey soluble CD4 proteins and chimpanzee soluble CD4 proteins.

25. A method for producing a polypeptide selected from the group consisting of the polypeptides of claims 14 and 15, comprising the step of culturing a unicellular host of claim 12.

26. A process for selecting an amino acid variant or derivative of human CD4, or a fragment thereof, that elicits in a human antibodies that bind to HIV gpl20, comprising the steps of:

(a) immunizing a transgenic mammal that expresses human CD4, or a fragment thereof, with a member selected from the group consisting of amino acid variants and derivatives of human CD4, and fragments thereof;

(b) testing the ability of serum antibodies from the immunized transgenic mammal to bind to HIV gpl20; and

(c) selecting the amino acid variant or derivative if serum antibodies from the immunized transgenic mammal bind to HIV gpl20.

27. A process for selecting an amino acid variant or derivative of human CD4, or a fragment thereof, that elicits in a human antibodies that bind to human CD4, comprising the steps of:

(b) testing the ability of serum antibodies from the immunized transgenic mammal to bind to human CD4; and

(c) selecting the amino acid variant or derivative if serum antibodies from the immunized transgenic mammal bind to human CD4.

28. The process according to claim 26 or 27, wherein the transgenic mammal expresses human CD4.

29. The process according to claim 28, wherein the expression of the human CD4 is lymphocyte specific.

30. The process according to claim 26 or 27, wherein the transgenic mammal is a mouse.

31. The process according to claim 30, wherein the transgenic mouse is immunized with an amino acid variant of a human soluble CD4 protein.

32. A pharmaceutical composition comprising an immunotherapeutically effective amount of one or more amino acid variants or derivatives of human CD4 according to any one of claims 16-24, or fragments thereof.

33. The pharmaceutical composition according to claim 32, further comprising a pharmaceutically acceptable adjuvant.

34. The pharmaceutical composition according to claim 32, wherein the amino acid variants or derivatives are polyvalent.

35. The pharmaceutical composition according to claim 32 or 33, wherein the amino acid variant is a polypeptide of the formula AA₁-AA_3?g of Figure 15 (rhesus monkey) .

36. An antibody that binds to HIV gpl20 produced by immunizing a human with an amino acid variant or derivative of human CD4 according to any one of claims 16-24, or a fragment thereof.