JPH0355108B2 - - Google Patents

Description

[Detailed description of the invention]

Industrial Application Field The present invention relates to leucine enkephalin (tyrosine Tyr-
Glycine Gly - Glycine Gly - Phenylalanine
A peptide consisting of a 5-amino acid sequence of Phe-leucine and Leu, hereinafter abbreviated as LEK. ), a novel recombinant plasmid pLEK1 that enables large-scale production of fusion proteins containing pLEK1, E. coli containing pLEK1, and LEK
Dihydrofolate reductase-LEK fusion protein (hereinafter referred to as DHFR) has
-Abbreviated as LEK. ), DHFR-LEK separation and purification method,
and a method for manufacturing LEK. The novel recombinant plasmid pLEK1 of the present invention has the DNA sequence shown in FIG. The present invention
Suitable for fields such as fermentation industry and pharmaceutical industry. Prior Art LEK is known as an endogenous peptide that exhibits morphine-like analgesic effects, and is an interesting bioactive peptide that is expected to be used as a non-addictive analgesic or anesthetic. The technical background of the present invention is so-called genetic manipulation technology. As an efficient method for producing LEK using genetic manipulation, the present inventors developed Bacillus subtilis dihydrofolate reductase (hereinafter referred to as
Abbreviated as DHFR. ) Method of using genes (JP-A-Sho
No. 63-102698), but nothing else is known. The method using the DHFR gene of Bacillus subtilis increases the expression efficiency of the DHFR gene derived from Bacillus subtilis in E. coli, introduces a chemically synthesized LEK gene into the EcoRI cleavage site of the DHFR gene, and generates the DHFR gene derived from Bacillus subtilis (hereinafter referred to as As a fusion protein in which LEK is fused to the carboxy terminal side of DHFR _bs ),
After separating and purifying the fusion protein by producing it in Escherichia coli (Japanese Unexamined Patent Publication Nos. 63-87981 and 1988-102696), LEK on the carboxy-terminal side was specifically cleaved, and high-performance liquid chromatography (hereinafter referred to as ,
Abbreviated as HPLC. ) is used for separation and purification. The problem with this method is that the amount of DHFR _bs -LEK produced by E. coli accumulated in the bacteria is
It accounts for at most a few percent of the bacterial protein,
There are some points that need to be improved in terms of production efficiency. On the other hand, the present inventors have already discovered that E. coli-derived
Regarding the DHFR gene, modification of the gene results in a plasmid vector for heterologous gene expression.
pTP70-1 (Japanese Unexamined Patent Publication No. 63-46193) and
We are developing pTP104-4 (Japanese Patent Application No. 302157/1982) and a method for creating fusion genes using these expression vectors (Japanese Patent Application Laid-Open No. 144992/1999). When these methods are used, the amount of the fusion protein obtained as a result of the expression of the fusion gene accumulated in E. coli cells is expected to be approximately 20% of the total cell protein. However, there is no example of using the above expression vector for the production of LEK. Purpose of the invention The purpose of the present invention is to solve problems in terms of production efficiency.
The purpose of this project is to improve the method for producing LEK using the DHFR _bs gene and develop an efficient method for producing LEK using genetic manipulation. The present inventors have already demonstrated that (1) even if the carboxy-terminal sequence of E. coli DHFR is changed, Bacillus subtilis
Similar to DHFR, enzyme activity is not lost, (2)
Plasmid vector pTP104-4 that makes it possible to fuse a heterologous peptide to the carboxy-terminal side of E. coli DHFR (Japanese Patent Application Laid-Open No. 144979/1999)
(4) modified DHFR on pTP104
It has been revealed that the gene is efficiently expressed in E. coli. The present inventors took advantage of the above knowledge and, as a result of intensive research, used pTP104-4 to express the LEK gene.
It was revealed that DHFR-LEK could be efficiently produced by expressing it in fusion with DHFR, and the present invention was completed based on the results. Structure of the Invention The present invention provides (1) a novel recombinant plasmid pLEK1 that enables large-scale expression of DHFR-LEK;
(3) DHFR-LEK produced by E. coli containing pLEK1, (4) Isolation and purification of DHFR-LEK from E. coli containing pLEK1, and (5) LEK using DHFR-LEK. The manufacturing method is constituted by the invention. (1) Novel recombinant plasmid pLEK1 Figure 1 shows the entire base sequence of pLEK1 of the present invention. The figure shows that only one DNA strand sequence of the double-stranded circular DNA is cut by the restriction enzyme ClaI, which is the only one in the plasmid.
The first "A" of ATCGAT-3' is counted as number 1 and is written in the direction from the 5' end to the 3' end. pLEK1 of the present invention is a novel recombinant plasmid. pLEK1 has a size of 4207 base pairs and can confer trimethoprim and ampicillin resistance to the host E. coli. pLEK1 is pTP104-4 BamHI and
It has a structure in which the larger 4173 base pair DNA fragment obtained by SalI cleavage is joined to a 34 base pair chemically synthesized DNA containing the sequence encoding LEK. In Figure 1, 533rd to 566th
The sequence up to No. 1 is a sequence derived from chemically synthesized DNA.
The other sequences are derived from pTP104-4. Restriction enzymes are used to sequence chemically synthesized DNA.
MluI recognition cleavage site, 5′-ACGCGT-3′ (first
The arrays from 560th to 565th in the figure) are included. The part derived from pTP104-4 contains MluI
Part does not exist. From the BamHI site of pLEK1 (sequence from 532nd to 537th in Figure 1)
By replacing the sequence up to the MluI site with another sequence, heterologous DNA can be introduced in a defined direction, and a fusion gene with the DHFR gene can be easily created. The array from 57th to 557th in Figure 1 is as follows:
It encodes DHFR-LEK, in which LEK is bound to the carboxy-terminal side of DHFR via methionine. Upstream of the sequence encoding DHFR-LEK,
There is a sequence that allows efficient expression of the DHFR-LEK gene (Japanese Patent Application Laid-Open No. 63-46193).
In other words, the sequence from 43rd to 50th is called the SD sequence, which is useful for efficient translation and
Positions 4165 to 4193 are the consensus transcription promoter and contribute to efficient transcription. From this, pLEK1 produces a large amount of DHFR-LEK when introduced into E. coli.
The produced DHFR-LEK accumulates in a soluble state within the bacterial body, accounting for approximately 20% of the bacterial protein. As a result, E. coli harboring pLEK1 becomes resistant to trimethoprim. Furthermore, pLEK1 has a gene derived from pTP104-4 that confers resistance to ampcillin. From this, E. coli into which pLEK1 has been introduced also exhibits resistance to ampicillin. pLEK1 is
introduced into E. coli and kept in a stable state,
E. coli containing pLEK1 was sent to the Microtech Institute.
It has been deposited as FERMBP-1818. pLEK1 having such features can be constructed according to Example 1, but the present invention is not limited by the method for constructing the recombinant plasmid. (2) E. coli containing pLEK1 E. coli containing pLEK1 shows resistance to trimethoprim and ampicillin.
E. coli containing pLEK1 is
As a result of efficient expression of the DHFR-LEK gene,
DHFR-LEK accumulates in large amounts in a soluble state within the bacterial body. YT+ E. coli containing pLEK1
When cultured to stationary phase at 37°C using Ap medium (a liquid medium containing 5 g of NaCl, 8 g of tryptone, 5 g of yeast extract, and 50 mg of oripicillin sodium in 1 liter of medium), The accumulated DHFR-LEK accounts for approximately 20% of the bacterial protein.
reach. When cultured bacterial cells are suspended in an appropriate buffer such as phosphate buffer, disrupted using the French press method or sonication method, and separated into supernatant and precipitate using centrifugation, almost all of the
DHFR-LEK is recovered in the supernatant. pLEK1
Escherichia coli containing FERMBP-
Deposited as 1818. (3) DHFR-LEK Figure 2 shows the DNA sequence encoding DHFR-LEK and the amino acid sequence of the protein predicted to be made from it.
DHFR-LEK is a novel protein consisting of 167 amino acids. Counting from the amino terminal side,
The sequence from positions 1 to 159 is the wild type of E. coli.
This is a sequence in which one amino acid substitution has occurred in DHFR (Cys-152 (wild type) → Glu-152), and the sequence from positions 162 to 167 is LEK. The amino acid immediately preceding the LEK sequence is methionine (Met). This allows DHFR
−By processing LEK with Bromsian,
LEK can be specifically excised. Isoleucine at position 160 and arginine at position 161
Arg is a sequence generated to match the reading frame of the genetic code when introducing DNA encoding LEK into the BamHI site of pTP140-4. DHFR produced by pTP104-4 consists of 162 amino acids, counting from the amino terminal side of the amino acid sequence of DHFR-LEK in Figure 2.
The sequence from positions 1 to 160 is a combination of two amino acid sequences of Gln-lle.
The molecular weight of DHFR-LEK is 18,963. DHFR-LEK has DHFR oxygen activity even though it has a structure in which LEK is fused to the carboxy terminal side of DHFR. Therefore, when E. coli produces large amounts of DHFR-LEK,
They become resistant to trimethoprim, a DHFR inhibitor and antibacterial agent. (4) Separation and purification of DHFR-LEK The method for separating and purifying DHFR-LEK of the present invention is as follows:
It consists of the following steps: culture of bacterial cells, disruption of bacterial cells, DEAE-Toyopearl column treatment, mesotrixate (MTX)-conjugated affinity chromatography, and DEAE-Toyopearl column chromatography. Cultivation of bacterial cells Culture of E. coli containing pLEK1 is carried out using YT+
Ap medium (in medium 1, 5g NaCl, 8g
of tryptone, 5g, yeast extract and
Liquid medium containing 50mg ampicillin sodium. ) can be cultured. As a double land, ST+Ap double land (in double land 1,
Liquid medium containing 2g glucose, 1g dipotassium phosphate, 5g polypeptone, 5g yeast extract and 50mg ampicillin sodium. ), any medium can be used as long as it allows bacterial growth, but as far as we have investigated, YT+Ap medium is optimal for producing DHFR-LEK. E. coli containing pLEK1 is brought into contact with the medium and cultured at 37°C until the late logarithmic growth phase or stationary phase. Depending on the culture temperature,
The amount of DHFR-LEK accumulated varied, and as far as we investigated, the higher the culture temperature, the greater the amount accumulated. The cultured bacterial cells are collected by centrifugation at 5000 rpm. Bacterial cells with a wet weight of 2 to 4 g are obtained from the double base 1. Bacterial collection and subsequent operations are performed at low temperatures (between 0 and 10°C, preferably 4°C) unless otherwise specified. Disruption of bacterial cells The bacterial cells obtained by culturing were suspended in buffer solution 1 (10 mM potassium phosphate buffer containing 0.1 mM sodium ethylenediaminetetraacetate (EDTA), PH 7.0) at 3 times the wet weight, Crush the bacterial cells using a French press. Centrifuge the cell suspension at 5000 rpm for 10 minutes to obtain a supernatant. Furthermore, the supernatant is subjected to ultracentrifugation at 35,000 rpm for 1 hour to obtain a supernatant (cell-free extract). DEAE-Toyopearl column treatment This operation is performed for the purpose of pretreatment for the next purification process. Prepare cell-free extract at 0.1M in advance.
Apply to a DEAE Toyopearl column equilibrated with Buffer 1 containing 0.1M KCl, and wash the column with Buffer 1 containing 0.1M KCl. Enzyme elution is
Perform using buffer 1 containing 0.3M KCl.
Fractionate a certain amount of the eluate using a fraction collector. About the fractionated eluate
Measure DHFR activity and collect fractions containing enzyme activity. MTX-bound affinity chromatography The enzyme solution obtained by the above procedure was pre-equilibrated with buffer 1 and then MTX-bound
Adsorb onto Sepharose affinity column. After adsorption, buffer 2 (0.1
Wash with 10 mM potassium phosphate buffer containing mM EDTA, pH 8.5). For washing, measure the absorbance of the eluate from the column at 280 nm, and continue to flow the same buffer until the absorbance becomes 0.1 or less. Elution of the enzyme is performed using Buffer 2 containing 1M KCl and 3mM folic acid, and the eluate is fractionated in fixed amounts using a fraction collector. DHFR for fractionated eluate
Measure the activity and collect fractions containing enzyme activity. The obtained enzyme solution is dialyzed against buffer solution 1 three times. At this stage, DHFR-LEK with a purity of 90% or more is obtained. DEAE-Toyopearl column chromatography The dialyzed enzyme solution is adsorbed onto a DEAE-Toyopearl column equilibrated with buffer solution 1 in advance. After adsorption, wash with buffer 1 containing 0.1KCl. Wash the eluate from the column at 280n
Measure the absorbance of m and continue to flow the same buffer until the absorbance becomes 0.01 or less. Enzyme elution was performed using buffer 1 with 0.1M to 0.3M KCl.
The eluate is fractionated into fixed amounts using a fraction collector. The absorbance at 280 nm and DHFR activity of the fractionated eluate are measured. Enzyme activity/
Collect fractions with constant absorbance value at 280 nm. Through the above operations, DHFR-LEK can be highly purified and homogenized with good reproducibility. According to the invention, the purification of DHFR-LEK consists of
It can be done within a week including culturing,
Uniform enzyme preparations can be obtained with a recovery rate of 50% or more. To measure DHFR enzyme activity, take the reaction solution (0.05mM dihydrofolic acid, 0.06mM NADPH, 12mM 2-mercaptoethanol, 50mM phosphate buffer (PH7.0)) into a 1ml cuvette, and add the enzyme solution to it. In addition, this is done by measuring the change in absorbance over time at 340 nm. One unit of enzyme is defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute under the above reaction conditions. This measurement can be easily performed using a spectrophotometer. (5) Production of LEK using DHFR-LEK The purified DHFR-LEK was freeze-dried, and 7% was added to it to give a concentration of 1 to 10 mg protein/ml.
After adding and dissolving formic acid, approximately 20% of the protein amount
Add twice the amount of crystalline bromic cyanide, cap tightly, and react for 24 hours with stirring at room temperature under a nitrogen atmosphere. After diluting the reaction solution 10 times with water, lyophilize to remove excess reagent. Dissolve the dried sample in 30% acetic acid to give 1 to 10 mg protein/ml.
The dissolved sample was transferred to an HPLC device (Shimadzu LC-4A,
inertsil-ODS column) using a concentration gradient of 15% to 50% acetonitrile in 0.1% trifluoroacetic acid. Eluates can be detected by measuring absorbance at 220 nm. FIG. 3 shows a high performance liquid chromatogram of a DHFR-LEK sample treated with bromocyanide. The peak 17 minutes after sample injection is LEK. Separate this peak fraction. After drying the separated eluate using an evaporator, LEK can be obtained by adding a small amount of water and freeze-drying to remove the solvent. Also,
The amino acid composition of the obtained peptide can be confirmed by acid hydrolysis and amino acid analysis. In the example of the present invention, bacterial cells with a wet weight of about 8 g were obtained from the medium No.
including. ), approximately 43 mg of DHFR-LEK (yield,
50.6%, calculated to contain approximately 1.26 mg of LEK. ) can be obtained by purifying 10 mg of DHFR−LEK.
About 0.16 mg of LEK could be obtained by separating and purifying it by HPLC after decomposing it with bromocyanide. Next, examples and reference examples of the present invention will be shown. Example 1 Creation of pLEK1 The DNA encoding LEK is 1 5'-
GATCCGTATGTACGGTGGTTTCCTGTA
ACGCGTG-3' 2 5-
TCGACACGCGTTACAGGAAACCACCGT
DNA consisting of two 34 nucleotides of ACATACG-3' was chemically synthesized according to the phosphoramidite method, and after purification, the 5' end of each DNA was phosphorylated using polynucleotide kinase. Approximately 0.1ml of phosphorylated DNA
(contains about 0.01 μg of DNA) and incubating it at 60°C.
The DNA was annealed (this is called DNA1). Approximately 1 μg of pTP104-4 was digested with BamHI and SalI and then treated with alkaline phosphatase.
The alkaline phosphatase-treated DNA was treated with phenol to denature and remove coexisting enzyme proteins, and then the DNA was precipitated with ethanol. After washing the precipitated DNA with 70% ethanol, the ethanol was removed and the precipitate was dried under reduced pressure. The operations of DNA cleavage with BamHI and SalI, alkaline phosphatase treatment, phenol treatment, and ethanol precipitation are all
“Molecular Cloning A Loboratory Manual”
(T.Maniatis.E.Fritsch, J.SambrooK, eds.Cold
Spring Harbor Laboratory (1982), hereinafter referred to as Document 1. ).
The dried DNA was mixed with 50μ of ligase reaction solution (10mM Tris-HCl, PH7.4, _5mM MgCl2,
After dissolving in 10mM dithiothreitol, 5mM ATP), 5μ of DNA1 was added, 1 unit of T4-DNA ligase was added thereto, and the DNA ligation reaction was carried out at 10°C for 14 hours. This reactant,
It was introduced into E. coli according to the transformation method (described in Document 1 above). The treated cells were transferred to a nutrient agar medium containing 50 mg/ml ampicillin sodium and 10 mg/ml trimethoprim (in medium 1, 2 g glucose, 1 g dipotassium phosphate, 5 g yeast extract, 5 g of voripeptone and 15g of agar).
By coating on the top and culturing at 37℃ for 24 hours,
Approximately 15 colonies were obtained. Select 8 colonies from these colonies and add 1.5ml of YT+Ap.
The bacterial cells were cultured overnight at 37°C in a medium (medium medium 1 contains 5 g of NaCl, 5 g of yeast extract, 8 g of tryptone, and 50 mg of ampicillin sodium). Transfer each culture solution to an Etzpendorf centrifuge tube, centrifuge at 12,000 rpm for 10 minutes,
The bacterial cells were collected as a precipitate. Add 0.1 ml of electrophoresis sample preparation solution (0.0625 M Tris-HCl,
PH6.8, 2% sodium lauryl sulfate (SDS),
Contains 10% glycerin, 5% 2-mercaptoethanol, 0.001% bromophenol blue. ) was added to suspend the bacterial cells, and this was kept in boiling water for 5 minutes to dissolve the bacterial cells. This treated sample was subjected to SDS-polyacrylamide gel electrophoresis (UK Lammli; Nature, Vol. 227, p680).
(1970)). as standard sample
Escherichia coli containing pTP104-4 was treated in the same way, and the molecular weight markers were lactalbumin (molecular weight 14200), trypsin inhibitor (molecular weight 20100), trypsinogen (molecular weight
24000), carbonic anhydrase (molecular weight
29000), glyceraldehyde 3-phosphate dehydrogenase (molecular weight 36000), egg albumin (molecular weight
45,000) and bovine serum albumin (molecular weight 66,000)
The samples were run on a 10 to 20% polyacrylamide gradient gel. As a result, 7 out of 8 colonies had pTP104-4.
The DHFR band disappeared and a protein with a molecular weight clearly larger than that (molecular weight approximately 22,000
It is estimated to be. ), and the remaining colony produces a protein approximately the same size as DHFR of pTP104-4.
It was revealed that DHFR of pT104-4 (molecular weight 18379) migrates as a protein with a molecular weight of about 21000 under these conditions. Select one of the colonies that produce a new protein with a large molecular weight, culture it in YT+Ap medium, and mix it with Tanaka.
Weisblum's method (T.Tanaka, B.Wejsblum; J.
Bacteriology, vol.121, p.354 (1975)),
A plasmid was prepared. The obtained plasmid
It was named pLEK1. pLEK1 is pTP104-4
It should have a structure in which the sequence between the BamHI and SalI sites has been replaced with synthetic DNA. synthetic dna
contains a sequence recognized by restriction enzyme MluI,
Since it contains 5′−ACGCGT−3′, use MluI to
When we tried to cleave pLEK1, it was indeed cleaved. In addition, M13 phage was used for approximately 11,100 nucleotides of DNA obtained by cleaving pLEK1 with EcoRI (sequences 471-476 in Figure 1) and Pvu (sequences 1563-1568 in Figure 1). dideoxy method (J.Messing;Mehtods in
According to Enzymology, vol.101, p. 20 (1983),
The nucleotide sequence was determined in the direction from EcoR to Pvu.
As a result, the entire base sequence of pLEK1 shown in Figure 1 was determined.
The sequence from position 471 to approximately 850 was confirmed. The nucleotide sequence of pTP104-4 has been revealed by the present inventors (Japanese Unexamined Patent Publication No. 144979/1999). The sequence of BamH−Sal in pLEK1 is
The 294 nucleotide long sequence between BamH and Sal of pTP104-4 was replaced with a 34 nucleotide long sequence designed and synthesized as a sequence encoding LEK. In addition, approximately 4.2 kilobase pair DNA obtained by BamH-SalI digestion of pLEK1 contains EcoR,
Pst, Hind, Hpa, Aat, Pvu, Bgl
The results of restriction enzyme cleavage experiments using , and Cla showed that the DNA was completely identical to the approximately 4.2 kilobase pair DNA obtained by BamH-SalI digestion of pTP104-4. From the above results, it was determined that the entire base sequence of pLEK1 was the sequence shown in FIG. Example 2 DHFR-LEK produced by E. coli containing pLEK1 DHFR-LEK produced by E. coli containing pLEK1
The amino acid sequence of can be predicted from the base sequence of the DHFR-LEK gene. Since the sequence from 57th to 557th in FIG. 1 encodes DHFR-LEK, the amino acid sequence was deduced using a triplet code table. As a result, the amino acid sequence shown in FIG. 2 was obtained. DHFR-LEK was isolated and purified from E. coli containing pLEK1, and the purified protein was used to confirm as follows. Purification of DHFR-LEK A Amount of bacterial cells used: Wet weight 8 g B Enzyme purification table (The purification process in the table is cell-free extract, DEAE-Toyopearl column treatment,
Represents mesotrixate-linked affinity chromatography, and DEAE-Toyopearl column chromatography.

[Table] DHFR enzyme activity was measured using the reaction solution (0.05mM dihydrofolic acid, 0.06mM NADPH, 12mM 2-mercaptoethanol, 50mM phosphate buffer (PH).
7.0)) was carried out by taking a 1 ml cuvette, adding the enzyme solution thereto, and measuring the change in absorbance at 340 nm over time. One unit of enzyme was defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute under the above reaction conditions. When the obtained enzyme protein was analyzed by SDS electrophoresis (method described in the above example),
Approximately 22,000 single protein bands were shown, indicating that the obtained enzyme preparation was homogeneous. Properties of isolated and purified DHFR-LEK When the purified protein exhibiting DHFR activity was examined by enzyme immunoassay,
It was shown to react with antibodies against LEK.
In other words, the purified protein is immunologically
It was revealed that it has a structure equivalent to that of LEK. In order to clarify the amino acid sequence of the carboxy-terminal side of the purified protein, carboxypeptidase Y was applied to the purified protein at varying times, and the released amino acids were quantified (carboxypeptidase method). method for determining the carboxy-terminal amino acid sequence). the result,
-Gly-Gly-Leu (carboxy terminal) was expected. Furthermore, when the purified protein was subjected to acid hydrolysis and then subjected to amino acid analysis, results were obtained that matched the amino acid composition expected from the base sequence. Example 3 Separation of LEK from purified and separated DHFE-LEK The purified protein obtained in Example 2 (approximately 10 mg,
About 530 nmoles of DHFR-LEK) was freeze-dried,
Dissolve this in 2ml of 70% formic acid and add about 200mg
Bromsyanide was added and dissolved, the mixture was sealed tightly under a nitrogen atmosphere, and the mixture was reacted with stirring at room temperature for 24 hours. After the reaction, 20 ml of water was added and then freeze-dried. 30% of 10ml of the specimen obtained by freeze-drying
Dissolved in acetic acid. Of that, 0.5ml (approximately 26nm
ole (which should contain DHFR-LEK) and using a high-performance liquid chromatograph (Shimadzu LC-4A)
Separation was performed using a lnertsil-ODS 5 μm column. Elution is 0.1
This was done by applying a concentration gradient (15% to 50%) of acetonitrile in % trifluoroacetic acid.
From 0 to 2 minutes, use 15% acenitrile,
From 2 minutes to 32 minutes, a linear concentration gradient of 15% to 50% acetonitrile was applied. As a result, an elution curve as shown in FIG. 3 was obtained. 17 after sample injection
The separated eluate was dried in an evaporator, and then a small amount of water was added and lyophilized to remove the solution to obtain the peptide. After acid hydrolysis of the obtained peptide, 1/2 the volume was used for amino acid analysis. As a result, tyrosine, glycine, phenylalanine, and leucine are respectively 7.2 and
14.6, 7.1 and 7.6 nmole were detected. The amino acid composition is consistent with that of LEK,
The heptide analyzed was approximately 7.4 nmole (approximately 4.1 μg).
It has become clear that it contains LEK. Using this result, the yield is approximately 5.7% (7.4x2nmole/26nmole) by separating 0.5ml of the sample obtained by Promsyan treatment using HPLC.
It is shown that LEK can be recovered with 10 mg of DHFR-LEK by repeating this operation 20 times. In addition, the yield of purification of DHFR-LEK is approximately 50%, and the yield of separation of LEK from DHFR-LEK is approximately
57%, it is calculated that the isolation yield of the LEK peptide moiety produced by E. coli is approximately 29%. Effects of the invention As mentioned above, the novel recombinant plasmid pLEK1
is encrypting DHFR-LEK, and
E. coli carrying pLEK1 accumulates and produces large amounts of DHFR-LEK in a soluble state. Furthermore, the produced DHFR-LEK retains DHFR enzyme activity and can be easily purified. By following the purification method of the present invention, DHFR-LEK can be purified quickly and efficiently. Also,
LEK can be easily isolated by treating DHFR-LEK with bromic cyanide and then separating it by HPLC. Because of these properties,
The present invention is based on DHFR-LEK and LEK using it.
It is beneficial for the production of Furthermore, pLEK1 has a newly added Mlu site, and is considered to be useful as a vector for expression of a heterologous gene.

[Brief explanation of drawings]

Figure 1 shows the entire base sequence of pLEK1, with only one DNA strand sequence of the double-stranded DNA described in the direction from the 5' end to the 3' end. The symbols in the figure represent nucleic acid bases, A is adenine, C
indicates cytosine, G indicates guanine, and T indicates thymine. The number in the figure indicates the restriction enzyme Cla cleavage recognition site that exists in pLEK1, 5′-ATCGAT.
-3', the first "A" is counted as number 1. Figure 2 shows DHFR-LEK present in pLEK1.
FIG. 2 is a diagram showing the base sequence of the portion encoding the protein and the amino acid sequence of the protein. The symbols in the figure represent nucleobases and amino acids, A represents adenine, C
stands for cytosine, G stands for guanine, T stands for thymine,
Ala is alanine, Arg is arginine, Asn is asparagine, Asp is aspartic acid, Cys
is cysteine, Gln is glutamine, Glu is glutamic acid, Gly is glycine, His is histidine, Ile is isoleucine, Leu is leucine, Lys is lysine, Met is methionine, Phe
is phenylalanine, Pro is proline, Ser
represents serine, Thr represents threonine, Trp represents tryptophan, Tyr represents tyrosine, and Val represents valine. The number in the diagram is “A” of the ATG codon that encodes the first amino acid, methionine.
It shows the number counted starting from 1. Figure 3 shows DHFR-
High performance liquid chromatogram of LEK sample is shown. The horizontal axis represents the time after sample injection in minutes, and the vertical axis represents the absorbance at 220 nm in arbitrary units.
The peak indicated by the arrow is the LEK elution peak.

Claims (1)

[Claims] 1. A novel recombinant product that is stably replicated in E. coli, can confer trimethoprim resistance and ampicillin resistance to the host E. coli, has a size of 4207 base pairs, and has the DNA sequence shown below. Plasmid pLEK1. [Table] [Table] [Table] [Table] 2 E. coli containing pLEK1. 3. A dihydrofolate reductase-leucine enkephalin fusion protein produced by E. coli containing pLEK1 and having the amino acid sequence shown below. [Table] 4 E. coli containing pLEK1 was cultured, and dihydrofolate reductase-leucine enkephalin fusion protein was extracted from the cell-free extract of the cultured cells using an ion-exchange column, using dihydrofolate reductase activity as a guideline. 1. A method for separating and purifying a dihydrofolate reductase-leucine enkephalin fusion protein, the method comprising purifying it using mesotrixate-coupled affinity column chromatography and anion exchange column chromatography. 5. A method for producing leucine enkephalin, which comprises separating and purifying leucine enkephalin after separating a dihydrofolate reductase-leucine enkephalin fusion protein produced by Escherichia coli containing pLEK1 by a bromcyanic degradation method.